Cancer Research Meeting Calendar Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arlt, A.
Right arrow Articles by Schäfer, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arlt, A.
Right arrow Articles by Schäfer, H.
[Cancer Research 62, 910-916, February 1, 2002]
© 2002 American Association for Cancer Research

Tumor Biology

Autocrine Production of Interleukin 1ß Confers Constitutive Nuclear Factor {kappa}B Activity and Chemoresistance in Pancreatic Carcinoma Cell Lines1

Alexander Arlt2, Jens Vorndamm2, Susanne Müerköster, Honggang Yu, Wolfgang E. Schmidt, Ulrich R. Fölsch and Heiner Schäfer3

Laboratory of Molecular Gastroenterology, Department of Medicine, University of Kiel, D-24105 Kiel, Germany [A. A., J. V., S. M., U. R. F., H. S.], and Department of Medicine I, St. Josef Hospital, Ruhr-University of Bochum, D-44791 Bochum, Germany [H. Y., W. E. S.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have recently shown that several pancreatic carcinoma cell lines are resistant to topoisomerase II{alpha} inhibitors due to elevated basal nuclear factor {kappa}B (NF-{kappa}B) activity, and blockade of this activity by various means strongly increased chemosensitivity. In search of possible mechanisms leading to exaggerated NF-{kappa}B activity, we identified interleukin (IL)-1ß as a key mediator of this activation in two of the chemoresistant cell lines (A818-4 and PancTu-1). These cells express and secrete high levels of IL-1ß, as demonstrated by reverse transcription-PCR, immunocytochemistry, and ELISA. Culture supernatants from both cell lines induced NF-{kappa}B activity in chemosensitive PT45-P1 pancreatic carcinoma cells and significantly attenuated etoposide-induced apoptosis in a NF-{kappa}B-dependent fashion, similar to that seen in PT45-P1 cells treated with recombinant IL-1ß. Treatment of these cells with IL-1ß also changed the DNA damage characteristics toward those observed in A818-4 and PancTu-1 cells. NF-{kappa}B activation and the gain of chemoresistance in PT45-P1 cells on treatment with supernatants from both chemoresistant cell lines was abolished in the presence of a blocking anti-IL-1 receptor (I) antibody. Furthermore, this antibody decreased the resistance of A818-4 and PancTu-1 cells to etoposide treatment along with reduced NF-{kappa}B activity. Blockade of NF-{kappa}B activation by MG132, sulfasalazine, or an I{kappa}B{alpha} superrepressor disrupted the IL-1ß-mediated amplification loop and the accompanying chemoresistance. Our data provide insights into an autocrine mechanism involving IL-1ß by which pancreatic carcinoma cells develop chemoresistance that could serve as a molecular target in anticancer therapy.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The transcription factor NF-{kappa}B4 is of great importance for cellular survival. By inducing certain antiapoptotic target genes (reviewed in Ref. 1 ), NF-{kappa}B is capable of conferring cellular resistance against various apoptotic triggers, including death receptor activation and DNA-damaging insults. Consequently, loss of NF-{kappa}B activity renders many cells highly sensitive to these apoptotic stimuli (2 , 3) . Whereas NF-{kappa}B is of beneficial value for tissue regeneration and protection of T cells against autocytotoxicity, the antiapoptotic potential of NF-{kappa}B, on the other hand, is a substantial cause of the development of tumors and their resistance to common anticancer therapy, i.e., treatment with DNA-damaging drugs (4, 5, 6, 7, 8, 9, 10) .

NF-{kappa}B represents a dimeric protein complex composed of members of the rel/NF-{kappa}B protein family (11) , including RelA, RelB, c-Rel, p50/NF{kappa}B1, and p52/NF{kappa}B2. The activation of NF-{kappa}B by a plethora of stimuli involves the sequential activation of specific protein kinases, designated IKKs, that phosphorylate and thereby induce proteasomal degradation of I{kappa}B proteins, which in turn sequester NF-{kappa}B complexes in the cytoplasm (reviewed in Ref. 12 ). On release from I{kappa}B, NF-{kappa}B translocates into the nucleus and exerts its action as a transcription factor and possibly exerts other yet-to-be-defined functions.

Along with its high potential to confer increased survival, elevated NF-{kappa}B activity is found in a variety of malignant tumors (8 , 13, 14, 15, 16, 17, 18) . Therefore, NF-{kappa}B is regarded as an important molecular determinant of tumorigenicity. We recently found that a variety of pancreatic tumor cell lines resistant to treatment with certain anticancer drugs are characterized by high levels of constitutive NF-{kappa}B activity (10) . Interruption of this NF-{kappa}B activity by various measures renders these cells much more sensitive to chemotherapy (10) . In particular, the combination of certain anticancer drugs with pharmacological NF-{kappa}B blockade by established anti-inflammatory agents and other NF-{kappa}B inhibitors (6 , 7 , 10 , 14 , 19 , 20) may be of great benefit for the treatment of pancreatic cancer.

For a better understanding of the mechanisms leading to elevated NF-{kappa}B activity, knowledge of the inducing signaling pathways is of fundamental importance. Many tumors have acquired alterations in those signaling pathways that control the nuclear transition of NF-{kappa}B. This includes mutations in the I{kappa}B{alpha} gene or exaggerated activities of IKK and Akt/protein kinase B (15 , 18 , 21, 22, 23) . In addition, mutations and gene amplifications have been described for members of the Rel protein family (reviewed in Ref. 24 ). Another mode of permanent amplification of NF-{kappa}B activity may involve the autocrine action of cytokines. Recent studies have revealed that certain tumors, i.e., skin cancer, or certain cell lines produce a variety of cytokines (i.e., tumor necrosis factor {alpha}, IL-1{alpha}, and IL-1ß) or chemokines (CXCL1 and CCL5) that induce NF-{kappa}B in an autocrine fashion (25, 26, 27, 28, 29) and thereby lead to NF-{kappa}B-dependent protection from apoptosis.

In the present study, we show that certain pancreatic carcinoma cell lines produce IL-1ß, providing an autocrine mechanism of permanent NF-{kappa}B activation and chemoresistance. Inhibition of IL-1ß-dependent NF-{kappa}B activity disrupts chemoresistance and may therefore be useful for new combined chemotherapeutic strategies.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Materials.
The human pancreatic carcinoma cell lines A818-4, PT45-P1, and PancTu-1 were kindly provided by H. Kalthoff (Kiel, Germany), and they were handled essentially as described previously (30) . The expression vector for the I{kappa}B{alpha} superrepressor (pcDNA6-{Delta}NI{kappa}B{alpha}) was a gift from Dr. F. Emmerich (Max-Delbrueck-Center for Molecular Medicine, Berlin, Germany). Etoposide was purchased from Sigma (Deisenhofen, Germany), IL-1ß was purchased from Calbiochem (Bad Soden/Ts, Germany), and the neutralizing anti-IL-1R(I) antibody CD121a was purchased from R&D Systems (Wiesbaden, Germany). Materials for total RNA preparation were purchased from Qiagen (Hilden, Germany), and materials for RT-PCR were purchased from Life Technologies, Inc. (Karlsruhe, Germany).

Apoptosis Assay.
Apoptotic cells were stained with annexin V (ApoAlert apoptosis assay; Clontech, Heidelberg, Germany) under conditions described previously (10) . Analysis was done by fluorescence flow cytometry (Galaxy Argon Plus; Dako, Hamburg, Germany) using FLOMAX software, and cells exhibiting high annexin V staining were regarded as apoptotic (10) .

RNA Isolation and RT-PCR.
Total RNA was isolated using the RNeasy kit (Qiagen), treated with DNase I, and reverse-transcribed into single-stranded cDNA as described previously (31) . Two µl of cDNA were subjected to PCR (95°C for 2 min; 25 cycles of 95°C for 60 s, 58°C for 30 s, and 72°C for 30 s; and 72°C for 10 min) using 1.5 units of Taq polymerase (Life Technologies, Inc.) and forward/reverse primers for IL-1ß (5'AGTGCTCCTTCCAGGACCTGGA3'/5'CACTCTCCAGCTGTAGAGTGG3'; position 184–687; GenBank accession number M15330). For control, ß-actin was amplified in parallel as described previously (31) . All PCR products were separated by PAGE (8% polyacrylamide) and visualized by EtBr staining.

EMSA.
Nuclear extracts were prepared as described previously (32) and incubated (3–5 µg of protein) with a {gamma}-32P-labeled oligonucleotide (5'-AGTTGAGGGGACTTTCCCAGGC-3') containing a consensus NF-{kappa}B binding site (Promega, Mannheim, Germany) for 30 min at room temperature. Samples were electrophoresed at 100 V and 4°C, and gels were dried and exposed to X-ray Hyperfilm (Amersham, Freiburg, Germany). Anti-p65 and anti-p50 antibodies (Santa Cruz Biotechnology, Heidelberg, Germany) were used for NF-{kappa}B supershift assay (1 h, 4°C).

Immunocytochemistry and ELISA.
Cells were grown on coverslips placed in 12-well culture plates (3 x 105 cells/well). After 36 h of culture, supernatants were collected and used for ELISA (see below), and cells were washed twice with PBS, fixed in acetone for 10 min, air-dried for 15 min, and washed in PBS. To avoid nonspecific binding, cells were treated with 2% normal rabbit serum for 15 min, followed by incubation with 0.5 µg/ml mouse antihuman IL-1ß antibody (BD-PharMingen, Heidelberg, Germany) for 45 min. After washing, the slides were incubated with a biotinylated rabbit antimouse antibody (Dianova, Hamburg, Germany) for 45 min. After washing three times in PBS, cells were treated with horseradish peroxidase-conjugated streptavidin for 30 min. Slides were washed with PBS, and the substrate reaction was performed with Peroxidase Substrate Kit DAB from Vector Laboratories (Alexis, Grünberg, Germany). The cells were then washed with water, counterstained with hemalaun, and mounted with glycerol-gelatin. The same protocol was performed for negative controls, in which either the first antibody was omitted or an isotype-matched control antibody was used. All staining steps were performed in a humidified chamber at room temperature. The amount of IL-1ß in cell culture supernatants was quantified by an ELISA, using the Quantikine-HS immunoassay (R&D Systems) and following the manufacturer’s instructions. Supernatants were precleared by centrifugation (10,000 rpm for 10 min) and analyzed as 150-µl samples, as suggested by the manufacturer. IL-1ß concentrations were normalized to the cell numbers determined in parallel.

Western Blotting.
Cells (5–10 x 106) were washed twice with PBS and then lysed with 250 µl of hypotonic HEPES buffer [10 mM (pH 7.6)] containing 50 mM KCl, 0.5 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 1 mM DTT, 0.2 mM EDTA, and 0.1 mM sodium orthovanadate. Supernatants were adjusted to equal amounts of protein, diluted with 1 volume of 2x SDS sample buffer, and heated for 5 min at 95°C. Samples (10 µg of protein) were run on 12.5% SDS-PAA gels. Immunoblotting was performed as described previously (10) using a monoclonal antibody against I{kappa}B{alpha} (Santa Cruz Biotechnology) and {alpha}-tubulin (Sigma) at a 500- and 1000-fold dilution, respectively.

Single-cell Microgel Electrophoresis Assay (Comet Assay) (33) .
Cells cultured in 12-well dishes were treated with etoposide, IL-1ß, or MG132. The cells were then collected by mild trypsinization and prepared for electrophoresis by mounting 5 x 104 cells in 75 µl of 1% low melting point agarose (Sigma) between a two-layer sandwich of agarose (85 µl of 0.5% NEEO-agarose; Roth, Deisenhofen, Germany) for the foundation layer on the slide and 75 µl of 1% low melting point agarose for the upper layer on the slide. Agarose slides were lysed in 1% Triton X-100, 10% DMSO (Sigma), and 89% lysis buffer [2.5 M NaCl, 100 mM EDTA, 10 mM Tris, and 1% N-laurylsarcosine sodium salt (pH 10)] for at least 1 h. After equilibration for 20 min in electrophoresis buffer [300 mM NaOH and 1 mM EDTA (pH >12.5)], agarose slides were electrophoresed at 25 V and 300 mA for 20 min. The slides were then neutralized in 0.4 M Tris (pH 7.5), and DNA was stained with 50 µl of 20 µg/ml EtBr solution. The cells were catalogued using a fluorescence microscope and photographed. Cells with DNA tails longer than one diameter of the nucleus were considered positive for DNA damage. Routinely, 40–50 cells were analyzed.

Cell Transfection.
Semiconfluent cells grown in 6-well dishes were serum- starved for 2 h and then subjected to lipofection (12 µl/well; Effectene; Qiagen) using 0.2 µg/well of an expression plasmid (pCDNA6) encoding {Delta}NI{kappa}B{alpha} plus 0.2 µg/well pCMV-lacZ or pCMV-lacZ alone. Transfection efficacy was checked by determination of ß-galactosidase expression using a commercial Gal ELISA (Boehringer, Mannheim, Germany).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Cell Culture Supernatants from Chemoresistant A818-4 and PancTu-1 Cells Decrease Etoposide-induced Apoptosis and Induce NF-{kappa}B Activity in Chemosensitive PT45-P1 Cells.
To elucidate whether the resistance of A818-4 and PancTu-1 cells to etoposide-induced apoptosis is due to secreted autocrine activity, we tested cell culture supernatants from both cell lines for the capacity to induce chemoresistance in PT45-P1 cells. This cell line is representative of various chemosensitive pancreatic carcinoma cell lines in that it is strongly affected by etoposide and lacks high basal NF-{kappa}B activity (10) . As shown in Fig. 1ACitation , PT45-P1 cells were highly sensitive (45 ± 9% apoptotic cells; 5 ± 2% if untreated) to treatment with 20 µM etoposide for 24 h if cultured with normal serum (5% FCS)- conditioned RPMI 1640. Etoposide-induced apoptosis was significantly attenuated in PT45-P1 cells if conditioned cell culture media (36 h) from A818-4 or PancTu-1 cells were added 8 h (18 ± 2% and 23 ± 3%, respectively) or 12 h (17 ± 4% and 20 ± 3%, respectively) after anticancer drug administration. This desensitizing effect of both supernatants was obviously restricted to a time period between 8 and 12 h after etoposide administration, whereas earlier (0, 2, and 4 h) or later (16 and 20 h) medium exchange was without significant effect on chemosensitivity (data not shown). In contrast, the addition of conditioned media (36 h) from PT45-P1 cells or RPMI 1640 did not alter the sensitivity of PT45-P1 cells to etoposide treatment at any time. The desensitizing potential of A818-4 and PancTu-1 cell culture supernatants was not influenced by the amount of FCS, as shown by similar experiments with conditioned media containing 0.5–10% FCS (data not shown).



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Cell culture supernatants from chemoresistant A818-4 and PancTu-1 cells protect PT45-P1 cells from etoposide-induced apoptosis and induce NF-{kappa}B. A, PT45-P1 cells were cultured for 24 h in normal RPMI 1640 (5% FCS) followed by administration of etoposide (20 µM). After 8 or 12 h, medium was replaced by cell culture supernatants (36 h) from A818-4, PancTu-1, and PT45-P1 cells or by fresh RPMI 1640. After 24 h of treatment with etoposide, cells were prepared for annexin V staining, followed by FACS analysis. Data represent the mean ± SD of six independent experiments. B, NF-{kappa}B activation was measured by EMSAs performed with nuclear lysates from PT45-P1 cells treated with cell culture media from A818-4 or PancTu-1 cells for various time periods. C, Western blotting for the detection of I{kappa}B{alpha} was performed with cytoplasmic extracts from PT45-P1 cells treated with cell culture supernatants for the indicated time periods; ß-tubulin was used as internal control.

 
By means of EMSAs (Fig. 1B)Citation , a strongly elevated NF-{kappa}B activity was detectable within 1–3 h in PT45-P1 cells incubated with A818-4 and PancTu-1 cell culture supernatants, whereas normal culture medium or PT45-P1 supernatants did not induce NF-{kappa}B activity (data not shown). In addition, immunoblot analysis detected a significant decline in I{kappa}B{alpha} protein levels within 30–60 min after supernatant addition (Fig. 1C)Citation , indicating signal-induced proteasomal degradation of I{kappa}B{alpha}.

Detection of IL-1ß Expression and Secretion in A818-4 and PancTu-1 Cells.
Recent studies have shown that IL-1ß is produced by various lymphoid and skin tumors. Because IL-1ß is also a potent inducer of NF-{kappa}B activity, we elucidated the contribution of this cytokine to the chemoresistance of A818-4 and PancTu-1 cells. For this purpose, expression of IL-1ß in A818-4 and PancTu-1 cells was analyzed by RT-PCR. As shown in Fig. 2ACitation , both cell lines contained significant levels of IL-1ß mRNA, whereas PT45-P1 cells did not. In contrast, mRNA levels of ß-actin did not differ among the cell lines. Next, the presence of mature IL-1ß protein was analyzed by means of immunocytochemistry. Strong immunostaining for IL-1ß was seen in A818-4 and PancTu-1 cells grown on coverslips, but no staining was observed in PT45-P1 cells (Fig. 2B)Citation . The corresponding isotype control stainings were all negative, indicating the specificity of the strong staining seen with A818-4 and PancTu-1 cells. For the detection and quantitation of secreted mature IL-1ß, cell culture supernatants (30–36 h) were subjected to a commercial IL-1ß ELISA. As shown in Fig. 2CCitation , A818-4 cells secreted the highest amount (103 ± 16 pg/106 cells) of IL-1ß, followed by PancTu-1 cells (59 ± 11 pg/106 cells). In contrast, PT45-P1 cells revealed no detectable amounts of IL-1ß compared with the medium control.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Etoposide-resistant A818-4 and PancTu-1 cells, but not chemosensitive PT45-P1 cells, express IL-1ß. A, total RNA samples from all three cell lines cultured in RPMI 1640 (5% FCS) were subjected to RT-PCR analysis using primers specific for IL-1ß. In parallel, RT-PCR was conducted for ß-actin, which was used as control. B, cells grown on coverslips for 30 h were fixed and prepared for immunostaining with an anti-IL-1ß antibody; an isotype control exhibiting no staining was included. C, cells were cultured for 30–36 h in 6-well plates. The supernatants were then cleared and subjected to a commercial IL-1ß immunoassay (Quantikine HS; R&D Systems). The amount of IL-1ß was normalized to equal cell number (expressed as pg IL-1ß/106 cells). Data represent the mean ± SD of six independent experiments.

 
The Desensitizing Activity in A818-4 and PancTu-1 Cell Supernatants Can Be Attributed to Secreted IL-1ß.
To verify IL-1ß as a mediator of NF-{kappa}B-dependent chemoresistance, we first checked the effect of a blocking anti-IL-1R(I) antibody on the desensitizing activity of supernatants from A818-4 and PancTu-1 cells. As shown in Fig. 3ACitation , etoposide-induced apoptosis in PT45-P1 cells approximated the levels observed without A818-4 or PancTu-1 supernatants if cells were incubated with 2 µg/ml of a blocking CD121a antibody. No such effect was observed if cells were incubated with a nonblocking IL-1R(I) antibody or with an unrelated antibody isotype control. Similarly, the sensitivity of A818-4 and PancTu-1 cells to 24-h etoposide treatment (8 ± 1% and 15 ± 4% apoptotic cells, respectively) was strongly increased (23 ± 4% and 30 ± 6% apoptotic cells, respectively) by preincubation (2 h) with the blocking CD121a antibody, but not by preincubation with the control antibodies (Fig. 3B)Citation . The same sensitization to etoposide was observed when using the recombinant IL-1R antagonist (data not shown). Along with the loss of the rescuing effect on PT45-P1 cells, the induction of NF-{kappa}B by A818-4 and PancTu-1 cell supernatants was abolished by the antagonistic CD121a antibody, as shown by EMSA (Fig. 3C)Citation , whereas the control antibodies exhibited no effect on NF-{kappa}B activation. In A818-4 and PancTu-1 cells, the high basal NF-{kappa}B activity was significantly reduced in the presence of the blocking CD121a antibody.



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. A blocking anti-IL-IR(I) antibody inhibits resistance to etoposide and the activation of NF-{kappa}B. A, PT45-P1 cells were preincubated with the blocking anti-IL-1R(I) antibody (2 µg/ml) or with a control antibody [nonblocking anti-IL-1R(I)-antibody] 2 h before the addition of etoposide (20 µM). Ten h after etoposide administration, cell culture supernatants (36 h) from A818-4 and PancTu-1 cells were added. B, A818-4 and PancTu-1 cells were preincubated with the blocking anti-IL-1R(I) antibody (2 µg/ml) or with a control antibody [nonblocking anti-IL-1R(I) antibody] 2 h before the addition of etoposide (20 µM). After 24 h of treatment with etoposide, all cell lines were prepared for annexin V staining, followed by FACS analysis. Data (A and B) represent the mean ± SD of four independent experiments. C, NF-{kappa}B activation was measured by EMSAs performed with nuclear lysates from A818-4 and PancTu-1 cells treated with normal RPMI 1640 (5% FCS) or nuclear lysates from PT45-P1 cells treated with cell culture media from A818-4 and PancTu-1 cells. All cell lines were incubated for 2 h with the blocking anti-IL-1R(I) antibody (2 µg/ml).

 
To mimic the desensitizing effect of A818-4 and PancTu-1 cell supernatants, recombinant IL-1ß was administered to PT45-P1 cells at various time points. As shown in Fig. 4ACitation , the addition of IL-1ß (1 ng/ml) 8 or 12 h after etoposide administration decreased the number of apoptotic cells from 44 ± 13% to 26 ± 4% and 21 ± 6%, respectively, whereas the addition of IL-1ß at earlier or later time points was without effect (0, 4, 16, and 24 h). Along with the decreasing effect on etoposide-induced apoptosis, IL-1ß addition (8 h after etoposide administration) led to an increase in NF-{kappa}B activity in PT45-P1 cells, as demonstrated by EMSA (Fig. 4B)Citation . Furthermore, a significant and transient decrease in I{kappa}B{alpha} protein levels was detected by immunoblotting (Fig. 4C)Citation .



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. IL-1ß protects PT45-P1 cells from etoposide-induced apoptosis and induces NF-{kappa}B. A, PT45-P1 cells were cultured for 24 h in normal RPMI 1640 (5% FCS), followed by administration of etoposide (20 µM). At various time points, recombinant IL-1ß was added at 1 ng/ml or not added. After 24 h of treatment with etoposide, cells were prepared for annexin V staining, followed by FACS analysis. Data represent the mean ± SD of six independent experiments. B, EMSAs were performed with nuclear lysates from PT45-P1 cells treated with etoposide for 8 h followed by the addition of recombinant IL-1ß (1 ng/ml) for various time periods. C, Western blotting for the detection of I{kappa}B{alpha} was performed with cytoplasmic extracts from PT45-P1 cells treated with etoposide for 8 h followed by the addition of recombinant IL-1ß (1 ng/ml) for the time indicated periods; ß-tubulin was used as internal control.

 
Distinct DNA Damage Characteristics in A818-4, PancTu-1, and PT45-P1 Cells.
Because treatment with topo II{alpha} inhibitors like etoposide causes a rapid accumulation of DNA damage that finally leads to apoptosis, we analyzed the kinetics of DNA damage after etoposide treatment using the EtBr comet assay. A significant portion of chemosensitive PT45-P1 cells displayed rapid (3 h) signs of DNA damage (Fig. 5A)Citation , indicated by EtBr-stained nuclear material exhibiting higher mobility in the electrical field and thus coming up as "comets." Thereafter, the number of cells displaying these signs of DNA damage decreased to an apparent minimum within 9 h after etoposide administration. After longer time periods (15–24 h), the extent of DNA damage (estimated as comet length) as well as the number of affected cells strongly and irreversibly increased again and was accompanied by the onset of apoptosis, as indicated by complete disintegration of nuclei. By comparison, chemoresistant A818-4 and PancTu-1 cells exhibited the first signs of DNA damage of a similar extent in a delayed fashion, reaching a maximum after 9–15 h. This was followed by a continuous decrease in the damage intensity and in the number of affected cells, and no significant onset of apoptosis was noted. Incubation of PT45-P1 cells with 1 ng/ml IL-1ß 8 h after etoposide administration led to a conversion toward attenuated and reversible kinetics of DNA damage (Fig. 5B)Citation , and the degree of apoptotic nuclear disintegration also decreased. On the other hand, in the presence of the proteasome inhibitor MG132 (10 µM; 2 h before etoposide administration), which blocks NF-{kappa}B activation, the course of DNA damage exhibited by A818-4 and PancTu-1 cells became similarly progressive and irreversible compared with that seen in the chemosensitive cell line (Fig. 5C)Citation , and increased apoptosis was detected by the comet assay.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. Distinct kinetics of etoposide-induced DNA damage in chemoresistant and chemosensitive cells are related to activation of NF-{kappa}B. A, cells were cultured for 24 h in normal RPMI 1640 (5% FCS), followed by administration of etoposide (20 µM). At various time points, cell were prepared for the comet assay. B, PT45-P1 cells were treated with etoposide (20 µM), followed by the addition of 1 ng/ml IL-1ß 8 h later. At various time points, cells were analyzed by comet assay. C, A818-4 and PancTu-1 cells were preincubated with the proteasome inhibitor MG132 (10 µM) 2 h before administration of etoposide (20 µM). At various time points, cells were prepared for the comet assay. Data express the percentage of cells (40–50 analyzed cells) exhibiting DNA damage scores of 3 and 4 (length of extruded DNA = 3 x and 4 x the nuclear diameter, respectively) and represent the mean of two independent experiments; the columns indicate percentage of apoptotic cells with disintegrated nuclei.

 
NF-{kappa}B Inhibition Abolishes the Desensitizing IL-1ß Effect as well as Its Expression in A818-4 and PancTu-1 Cells.
To elucidate whether the desensitizing effect of IL-1ß depends on NF-{kappa}B activation, we transfected PT45-P1 cells with the I{kappa}B{alpha} superrepressor (pcDNA6-{Delta}NI{kappa}B{alpha}), which efficiently inhibits NF-{kappa}B activation in these and other pancreatic carcinoma cells (10) , or with a control vector (pCMV-lacZ). As shown in Fig. 6Citation , incubation with supernatants from A818-4 or PancTu-1 cells 10 h after etoposide administration did not decrease etoposide-induced apoptosis in PT45-P1 cells (46 ± 12% and 40 ± 9% apoptotic cells, respectively) expressing the I{kappa}B{alpha} superrepressor, but it still decreased etoposide-induced apoptosis in lacZ-transfected PT45-P1 cells (22 ± 4% and 23 ± 3% apoptotic cells, respectively). Similarly, PT45-P1 cells transfected with {Delta}NI{kappa}B{alpha} became significantly less resistant to etoposide treatment on incubation with IL-1ß 10 h after etoposide administration (41 ± 3% apoptotic cells) compared with mock (lacZ)-transfected cells (23 ± 2% apoptotic cells).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. PT45-P1 cells transfected with the I{kappa}B{alpha} superrepressor do not respond to cell culture supernatants from A818-4 and PancTu-1 cells or to IL-1ß. PT45-P1 cells were transfected with the I{kappa}B{alpha} superrepressor ({Delta}NI{kappa}B{alpha}) or with lacZ as control. Ten h after etoposide (20 µM) administration to the transfectants, we added cell culture supernatants (36 h) from A818-4 or PancTu-1 cells, RPMI 1640 alone, or RPMI 1640 plus IL-1ß (1 ng/ml). After 24 h of treatment with etoposide, cells were prepared for annexin V staining, followed by FACS analysis. Data represent the mean ± SD of four independent experiments.

 
Furthermore, supernatants from A818-4 and PancTu-1 cells transfected with the I{kappa}B{alpha} superrepressor (10) , but not supernatants from mock-transfected A1818-4 and PancTu-1 cells, failed to protect PT45-P1 cells from etoposide-induced apoptosis (Fig. 7A)Citation . To explore whether NF-{kappa}B inhibition decreased IL-1ß secretion, supernatants of {Delta}NI{kappa}B{alpha}- or lacZ-transfected A818-4 and PancTu-1 cells were analyzed for IL-1ß expression. As shown by ELISA (Fig. 7B)Citation , both cell lines expressing {Delta}NI{kappa}B{alpha} secreted significantly reduced levels of IL-1ß compared with cell lines expressing lacZ. Similarly, pharmacological inhibition of NF-{kappa}B activation by MG132 and sulfasalazine significantly inhibited secretion of IL-1ß by A818-4 and PancTu-1 cells.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 7. NF-{kappa}B inhibition decreases secretion and synthesis of IL-1ß by A818-4 and PancTu-1 cells. A818-4 and PancTu-1 cells were transfected with the I{kappa}B{alpha} superrepressor ({Delta}NI{kappa}B{alpha}) or with lacZ as control. A, supernatants of the transfectants were added to PT45-P1 cells treated with etoposide (20 µM) for 10 h. After 24 h of etoposide treatment, cells were prepared for annexin V staining, followed by FACS analysis. B, supernatants from {Delta}NI{kappa}B{alpha}- or lacZ-transfected A818-4 and PancTu-1 cells cultured for 36 h were subjected to a commercial IL-1ß immunoassay (Quantikine HS; R&D Systems). The amount of IL-1ß was normalized to equal cell number (expressed as pg IL-1ß/106 cells). In addition, supernatants from cells treated with the proteasome inhibitor MG132 (10 µM) and the IKK inhibitor sulfasalazine (0.2 mM) were analyzed. Data (A and B) represent the mean ± SD of four independent experiments.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We recently identified various pancreatic carcinoma cell lines exhibiting distinct sensitivities to treatment with anticancer drugs, particularly to the topo II{alpha} inhibitor etoposide (10) . In certain cell lines, including A818-4 and PancTu-1 cells, high constitutive NF-{kappa}B activity was identified, which accounted for their chemoresistance. In contrast, those cell lines that were highly sensitive to etoposide, represented here by PT45-P1 cells, lacked persistent NF-{kappa}B activation. Interestingly, the sensitivity to death ligand-induced apoptosis did not correlate with the elevated NF-{kappa}B status in these cell lines, underlining the view that constitutive NF-{kappa}B activity confers particular protection from DNA damage-initiated programmed cell death.

In search of potential mechanisms accounting for the elevated NF-{kappa}B activity in A818-4 and PancTu-1 cells, we found no correlation with the degree of Akt phosphorylation or with known I{kappa}B{alpha} mutations. Furthermore, ras mutations that may have the potential to induce NF-{kappa}B (8 , 34 , 35) are equally present in chemoresistant and chemosensitive cell lines, i.e., in A818-4, PancTu-1, and PT45-P1 cells (36) . Therefore, we next examined cytokine-maintained autocrine loops that may account for the constitutive NF-{kappa}B activity in chemoresistant A818-4 and PancTu-1 cells.

Hereby, we identified IL-1ß as a crucial mediator inducing constitutive NF-{kappa}B activity in the chemoresistant cell lines. We showed that supernatants of both chemoresistant cell lines conferred elevated NF-{kappa}B activity in PT45-P1 cells and protected this highly chemosensitive cell line from etoposide-induced apoptosis. The involvement of IL-1ß in this pathway was confirmed by the following experimental data: (a) a blocking anti-IL-1R(I) antibody decreased NF-{kappa}B activity in A818-4 and PancTu-1 cells and abolished their resistance to etoposide, as it has been observed with NF-{kappa}B inhibitors; (b) the induction of NF-{kappa}B-dependent chemoresistance in PT45-P1 cells by supernatants from A818-4 and PancTu-1 cells was also prevented by the blocking anti-IL-1R(I) antibody; (c) the addition of recombinant IL-1ß to PT45-P1 cells could mimic the NF-{kappa}B- and resistance-inducing effect of the supernatants; and (d) significant expression levels of IL-ß were detected in A818-4 and PancTu-1 cells, but not in PT45-P1 cells.

For survival of etoposide treatment, NF-{kappa}B activity is obviously required at a certain period between 8 and 12 h after drug administration because the highest rescuing effect during this period was similarly observed in desensitization experiments with supernatants from A181-4 or PancTu-1 cells as well as with exogenous IL-1ß. At exactly the same time point, DNA damage kinetics were shifted from a biphasic and irreversible course toward a rather monophasic and reversible course. In chemosensitive PT45-P1 cells, early signs of DNA damage were noted that probably arose from rapidly formed cleavable complexes of topo II{alpha} and etoposide. As long as these complexes do not interfere with the replication process, DNA damage remained reversible (37) , presumably due to the action of cellular DNA repair mechanisms. After this period of recovery, DNA damage increased again in a continuous and irreversible fashion, probably due to the formation of topo II{alpha} cleavage complexes along with DNA replication (33) . In contrast, the chemoresistant cell lines A818-4 and PancTu-1 exhibited a delayed progression of DNA damage that continuously decreased after a while, and no second onset of irreversible DNA damage occurred. Addition of IL-1ß 8 h after etoposide administration protected sensitive PT45-P1 cells from the onset of the irreversible DNA damage and led to a similar reversible time course without subsequent apoptosis, as seen in the chemoresistant cell lines A818-4 and PancTu-1. Because cell cycle analysis did not reveal an alteration in the cell cycle in response to IL-1ß (result not shown), the protective effect of IL-1ß seems to be independent of the speed of replication. On the other hand, inhibition of NF-{kappa}B in the chemoresistant cell lines A818-4 and PancTu-1 by MG132 led to a similar irreversible course of DNA damage compared with the chemosensitive cell lines and led to micronucleation along with apoptosis. It will be interesting to elucidate how NF-{kappa}B interferes with the DNA damage induced by topo II{alpha} cleavage complexes. This interference may include increased expression and activity of topo IIß, modulation of topo II{alpha}, or the regulation of DNA repair mechanisms.

Taken together, our findings indicate that in certain pancreatic carcinoma cell lines, an autocrine IL-1ß loop exists that not only favors autonomous growth, as described previously for various other tumors (27 , 38, 39, 40, 41, 42) , but also induces resistance to apoptosis by establishing constitutive NF-{kappa}B activity. Similar observations have been made recently for keratinocytes and certain skin cancer cell lines, in which IL-1ß led to NF-{kappa}B-dependent resistance against tumor necrosis factor-related apoptosis-inducing ligand- and Fas ligand-induced apoptosis (26) . In pancreatic carcinoma cells like A818-4 and PancTu-1, the autocrine action of IL-1ß confers resistance to anticancer drugs such as etoposide that can be overcome by inhibition of IL-1ß to a similar extent as by NF-{kappa}B inhibition. Interestingly, this IL-1ß-dependent pathway seems to be less efficient for protection from death receptor-induced apoptosis,5 implying distinct mechanisms that account for resistance against death ligands and DNA-damaging insults (see above), the latter of which substantially involves IL-1ß-mediated NF-{kappa}B activation. Likewise, a discrepant correlation of NF-{kappa}B activity with the sensitivity of squamous carcinoma cells to radiation or cisplatin has been described recently (43) . As a conclusion from our results, it is worth paying more attention to IL-1ß as a molecular target in anticancer therapy. A combination of neutralizing anti-IL-1R antibodies, soluble IL-1R equivalents, or the IL-1{alpha} receptor antagonist (29 , 44) together with anticancer drugs may be of great benefit for a more successful therapeutic intervention in pancreatic carcinoma. In recent clinical trials, IL-1ß blockade has already been used for treatment of leukemic diseases (45) , although with limited success. In fact, this problem may be overcome using anti-IL-1ß treatment in combination with established anticancer drugs. Novel anti-IL-1 drugs used for the treatment of rheumatoid arthritis will be of potential interest for combined anticancer chemotherapy.


   ACKNOWLEDGMENTS
 
We thank M. Breitenbroich and M. Witt for excellent technical support. We thank M. Clark for assistance with the comet assay and Prof. H. Kalthoff and Dr. C. Roeder for helpful expert discussions.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the German Research Society (DFG Scha 677/7-1) and the Interdisciplinary Cancer Research Center (IZKF) Kiel. This work is part of an M.D. thesis (J. V.) Back

2 A. A. and J. V. contributed equally to this work. Back

3 To whom requests for reprints should be addressed, at Laboratory of Molecular Gastroenterology, Department of Medicine, University of Kiel, Schittenhelmstrasse 12, D-24105 Kiel, Germany. Phone: 49-431-597-1443; Fax: 49-431-597-1302; E-mail: hschaef{at}1med.uni-kiel.de Back

4 The abbreviations used are: NF-{kappa}B, nuclear factor {kappa}B; I{kappa}B, inhibitor {kappa}B; IKK, I{kappa}B kinase; topo, topoisomerase; IL, interleukin; RT-PCR, reverse transcription-PCR; IL-1R, interleukin 1 receptor; EMSA, electrophoretic mobility shift assay; EtBr, ethidium bromide; FACS, fluorescence-activated cell-sorting. Back

5 C. Roeder, personal communication. Back

Received 9/14/01. Accepted 11/29/01.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Barkett M., Gilmore T. D. Control of apoptosis by Rel/NF-{kappa}B transcription factors. Oncogene, 18: 6910-6924, 1999.[Medline]
  2. Liu Z. G., Hsu H., Goeddel D. V., Karin M. Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-{kappa}B activation prevents cell death. Cell, 87: 565-576, 1996.[Medline]
  3. Zong W. X., Bash J., Gelinas C. Rel blocks both anti-Fas- and TNF-{alpha}-induced apoptosis and an intact Rel transactivation domain is essential for this effect. Cell Death Differ., 5: 963-972, 1998.[Medline]
  4. Wang C. Y., Mayo M. W., Baldwin A. S., Jr. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-{kappa}B. Science (Wash. DC), 274: 784-787, 1996.[Abstract/Free Full Text]
  5. Jeremias I., Kupatt C., Baumann B., Herr I., Wirth T., Debatin K. M. Inhibition of nuclear factor {kappa}B activation attenuates apoptosis resistance in lymphoid cells. Blood, 91: 4624-4631, 1998.[Abstract/Free Full Text]
  6. McDade T. P., Perugini R. A., Vittimberga F. J., Jr., Carrigan R. C., Callery M. P. Salicylates inhibit NF-{kappa}B activation and enhance TNF-{alpha}-induced apoptosis in human pancreatic cancer cells. J. Surg. Res., 83: 56-61, 1999.[Medline]
  7. Wang C. Y., Cusack J. C., Jr., Liu R., Baldwin A. S., Jr. Control of inducible chemoresistance: enhanced anti-tumor therapy through increased apoptosis by inhibition of NF-{kappa}B. Nat. Med., 5: 412-417, 1999.[Medline]
  8. Wang W., Abbruzzese J. L., Evans D. B., Larry L., Cleary K. R., Chiao P. J. The nuclear factor-{kappa}B RelA transcription factor is constitutively activated in human pancreatic adenocarcinoma cells. Clin. Cancer Res., 5: 119-127, 1999.[Abstract/Free Full Text]
  9. Baldwin A. S. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-{kappa}B. J. Clin. Investig., 107: 241-246, 2001.[Medline]
  10. Arlt A., Vorndamm J., Breitenbroich M., Fölsch U. R., Kalthoff H., Schmidt W. E., Schäfer H. Inhibition of NF-{kappa}B sensitizes human pancreatic carcinoma cells to apoptosis induced by etoposide (VP16) or doxorubicin. Oncogene, 20: 859-868, 2001.[Medline]
  11. Ghosh S., May M. J., Kopp E. B. NF-{kappa}B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol., 16: 225-260, 1998.[Medline]
  12. Karin M. How NF-{kappa}B is activated: the role of the I{kappa}B kinase (IKK) complex. Oncogene, 18: 6867-6874, 1999.[Medline]
  13. Sovak M. A., Bellas R. E., Kim D. W., Zanieski G. J., Rogers A. E., Traish A. M., Sonenshein G. E. Aberrant nuclear factor-{kappa}B/Rel expression and the pathogenesis of breast cancer. J. Clin. Investig., 100: 2952-2960, 1997.[Medline]
  14. Bargou R. C., Emmerich F., Krappmann D., Bommert K., Mapara M. Y., Arnold W., Royer H. D., Grinstein E., Greiner A., Scheidereit C., Dorken B. Constitutive nuclear factor-{kappa}B-RelA activation is required for proliferation and survival of Hodgkin’s disease tumor cells. J. Clin. Investig., 100: 2961-2969, 1997.[Medline]
  15. Krappmann D., Emmerich F., Kordes U., Scharschmidt E., Dörken B., Scheidereit C. Molecular mechanisms of constitutive NF-{kappa}B/Rel activation in Hodgkin/Reed-Sternberg cells. Oncogene, 18: 943-953, 1999.[Medline]
  16. Reuther J. Y., Reuther G. W., Cortez D., Pendergast A. M., Baldwin A. S., Jr. AA requirement for NF-{kappa}B activation in Bcr-Abl-mediated transformation. Genes Dev., 12: 968-981, 1998.[Abstract/Free Full Text]
  17. Dejardin E., Deregowski V., Chapelier M., Jacobs N., Gielen J., Merville M. P., Bours V. Regulation of NF-{kappa}B activity by I{kappa}B-related proteins in adenocarcinoma cells. Oncogene, 18: 2567-2577, 1999.[Medline]
  18. Ludwig L., Kessler H., Wagner M., Hoang-Vu C., Dralle H., Adler G., Bohm B. O., Schmid R. M. Nuclear factor-{kappa}B is constitutively active in C-cell carcinoma and required for RET-induced transformation. Cancer Res., 61: 4526-4535, 2001.[Abstract/Free Full Text]
  19. Jones D. R., Broad R. M., Madrid L. V., Baldwin A. S., Jr., Mayo M. W. Inhibition of NF-{kappa}B sensitizes non-small cell lung cancer cells to chemotherapy-induced apoptosis. Ann. Thorac. Surg., 70: 930-936, discussion, 936–937 2000.[Abstract/Free Full Text]
  20. Mayo M. W., Baldwin A. S. The transcription factor NF-{kappa}B: control of oncogenesis and cancer therapy resistance. Biochim. Biophys. Acta, 1470: M55-M62, 2000.[Medline]
  21. Beraud C., Henzel W. J., Baeuerle P. A. Involvement of regulatory and catalytic subunits of phosphoinositide 3-kinase in NF-{kappa}B activation. Proc. Natl. Acad. Sci. USA, 96: 429-434, 1999.[Abstract/Free Full Text]
  22. Emmerich F., Meiser M., Hummel M., Demel G., Foss H. D., Jundt F., Mathas S., Krappmann D., Scheidereit C., Stein H., Dorken B. Overexpression of I{kappa}B{alpha} without inhibition of NF-{kappa}B activity and mutations in the I{kappa}B{alpha} gene in Reed-Sternberg cells. Blood, 94: 3129-3134, 1999.[Abstract/Free Full Text]
  23. Madrid L. V., Mayo M. W., Reuther J. Y., Baldwin A. S., Jr. Akt stimulates the transactivation potential of the RelA/p65 subunit of NF-{kappa}B through utilization of the I{kappa}B kinase and activation of the mitogen-activated protein kinase p38. J. Biol. Chem., 276: 18934-18940, 2001.[Abstract/Free Full Text]
  24. Rayet B., Gelinas C. Aberrant rel/nfkb genes and activity in human cancer. Oncogene, 18: 6938-6947, 1999.[Medline]
  25. Giri D. K., Aggarwal B. B. Constitutive activation of NF-{kappa}B causes resistance to apoptosis in human cutaneous T cell lymphoma HuT-78 cells. Autocrine role of tumor necrosis factor and reactive oxygen intermediates. J. Biol. Chem., 273: 14008-14014, 1998.[Abstract/Free Full Text]
  26. Kothny-Wilkes G., Kulms D., Poppelmann B., Luger T. A., Kubin M., Schwarz T. Interleukin-1 protects transformed keratinocytes from tumor necrosis factor-related apoptosis-inducing ligand. J. Biol. Chem., 273: 29247-29253, 1998.[Abstract/Free Full Text]
  27. Vale T., Ngo T. T., White M. A., Lipsky P. E. Raf-induced transformation requires an interleukin 1 autocrine loop. Cancer Res., 61: 602-607, 2001.[Abstract/Free Full Text]
  28. Yang J., Richmond A. Constitutive I{kappa}B kinase activity correlates with nuclear factor-{kappa}B activation in human melanoma cells. Cancer Res., 61: 4901-4909, 2001.[Abstract/Free Full Text]
  29. Wolf J. S., Chen Z., Dong G., Sunwoo J. B., Bancroft C. C., Capo D. E., Yeh N. T., Mukaida N., Van Waes C. IL-1{alpha} promotes NF-{kappa}B and AP-1-induced IL-8 expression, cell survival and proliferation in head and neck squamous cell carcinomas. Clin. Cancer Res., 7: 1812-1820, 2001.[Abstract/Free Full Text]
  30. Kalthoff H., Schmiegel W., Roeder C., Kasche D., Schmidt A., Lauer G., Thiele H. G., Honold G., Pantel K., Riethmüller G., et al p53 and K-RAS alterations in pancreatic epithelial cell lesions. Oncogene, 8: 289-298, 1993.[Medline]
  31. Schäfer H., Arlt A., Trauzold A., Hünermann-Jansen A., Schmidt W. E. The putative apoptosis inhibitor IEX-1L is a mutant nonspliced variant of p22(PRG1/IEX-1) and is not expressed in vivo. Biochem. Biophys. Res. Commun., 262: 139-145, 1999.[Medline]
  32. Schäfer H., Diebel J., Arlt A., Trauzold A., Schmidt W. E. The promoter of human p22/PACAP response gene 1 (PRG1) contains functional binding sites for the p53 tumor suppressor and for NF{kappa}B. FEBS Lett., 436: 139-143, 1998.[Medline]
  33. Gieseler F., Bauer E., Nuessler V., Clark M., Valsamas S. Molecular effects of topoisomerase II inhibitors in AML cell lines: correlation of apoptosis with topoisomerase II activity but not with DNA damage. Leukemia (Baltimore), 13: 1859-1863, 1999.[Medline]
  34. Arsura M., Mercurio F., Oliver A. L., Thorgeirsson S. S., Sonenshein G. E. Role of the I{kappa}B kinase complex in oncogenic Ras- and Raf-mediated transformation of rat liver epithelial cells. Mol. Cell. Biol., 20: 5381-5391, 2000.[Abstract/Free Full Text]
  35. Norris J. L., Baldwin A. S., Jr. Oncogenic Ras enhances NF-{kappa}B transcriptional activity through Raf-dependent and Raf-independent mitogen-activated protein kinase signaling pathways. J. Biol. Chem., 274: 13841-13846, 1999.[Abstract/Free Full Text]
  36. Moore, P. S., Sipos, B., Orlandini, S., Sorio, C., Real, F. X., Lemoine, N. R., Gress, T., Bassi, C., Klöppel, G., Kalthoff, H., Ungefroren, H., Löhr, M., and Scarpa, A. Genetic profile of 22 pancreatic carcinoma cell lines. Virchows Arch., in press, 2002.
  37. Beere H. M., Chresta C. M., Alejo-Herberg A., Skladanowski A., Dive C., Larsen A. K., Hickman J. A. Investigation of the mechanism of higher order chromatin fragmentation observed in drug-induced apoptosis. Mol. Pharmacol., 47: 986-996, 1995.[Abstract]
  38. Attias D., Grunberger T., Vanek W., Estrov Z., Cohen A., Lau R., Freedman M. H. B-lineage lymphoid blast crisis in juvenile chronic myelogenous leukemia. II. Interleukin-1-mediated autocrine growth regulation of the lymphoblasts. Leukemia (Baltimore), 9: 884-888, 1995.[Medline]
  39. Giavazzi R., Di Berardino C., Garofalo A., Motta T., Gobbi A., Scanziani E., Giudici G., Galli M., Mayo J. G., Barbui T., et al Establishment of human acute myelogenous leukemia lines secreting interleukin-1ß in SCID mice. Int. J. Cancer, 61: 280-285, 1995.[Medline]
  40. Huleihel M., Maymon E., Piura B., Prinsloo I., Benharroch D., Yanai-Inbar I., Glezerman M. Distinct patterns of expression of interleukin-1 {alpha} and ß by normal and cancerous human ovarian tissues. Eur. Cytokine Netw., 8: 179-187, 1997.[Medline]
  41. Chiao J. W., Hsieh T. C., Xu W., Sklarew R. J., Kancherla R. Development of human prostate cancer cells to neuroendocrine-like cells by interleukin-1. Int. J. Oncol., 15: 1033-1037, 1999.[Medline]
  42. Beaupre D. M., Talpaz M., Marini F. C., III, Cristiano R. J., Roth J. A., Estrov Z., Albitar M., Freedman M. H., Kurzrock R. Autocrine interleukin-1ß production in leukemia: evidence for the involvement of mutated RAS. Cancer Res., 59: 2971-2980, 1999.[Abstract/Free Full Text]
  43. Chen Z., Colon I., Ortiz N., Callister M., Dong G., Pegram M. Y., Arosarena O., Strome S., Nicholson S., Van Waes C. Effects of IL1-{alpha}, IL-1 receptor antagonist and neutralizing antibody on proinflammatory cytokine expression by human squamous carcinoma lines. Cancer Res., 58: 3668-3676, 1998.[Abstract/Free Full Text]
  44. Kato T., Duffey D. C., Ondrey F. G., Dong G., Chen Z., Cook J. A., Mitchell J. B., Van Waes C. Cisplatin and radiation sensitivity in human head and neck squamous carcinomas are independently modulated by glutathione and transcription factor NF-{kappa}B. Head Neck, 22: 748-759, 2000.[Medline]
  45. Bernstein S. H., Fay J., Frankel S., Christiansen N., Baer M. R., Jacobs C., Blosch C., Hanna R., Herzig G. A Phase I study of recombinant human soluble interleukin-1 receptor (rhu IL-1R) in patients with relapsed and refractory acute myeloid leukemia. Cancer Chemother. Pharmacol., 43: 141-144, 1999.[Medline]



This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
T. Copetti, C. Bertoli, E. Dalla, F. Demarchi, and C. Schneider
p65/RelA Modulates BECN1 Transcription and Autophagy
Mol. Cell. Biol., May 15, 2009; 29(10): 2594 - 2608.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
S. Shin, T. Asano, Y. Yao, R. Zhang, F.-X. Claret, M. Korc, K. Sabapathy, D. G. Menter, J. L. Abbruzzese, and S. A.G. Reddy
Activator Protein-1 Has an Essential Role in Pancreatic Cancer Cells and Is Regulated by a Novel Akt-Mediated Mechanism
Mol. Cancer Res., May 1, 2009; 7(5): 745 - 754.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J.-D. Lay, C.-C. Hong, J.-S. Huang, Y.-Y. Yang, C.-Y. Pao, C.-H. Liu, Y.-P. Lai, G.-M. Lai, A.-L. Cheng, I.-J. Su, et al.
Sulfasalazine Suppresses Drug Resistance and Invasiveness of Lung Adenocarcinoma Cells Expressing AXL
Cancer Res., April 15, 2007; 67(8): 3878 - 3887.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. Nakashima, M. Nakamura, H. Yamaguchi, N. Yamanaka, T. Akiyoshi, K. Koga, K. Yamaguchi, M. Tsuneyoshi, M. Tanaka, and M. Katano
Nuclear Factor-{kappa}B Contributes to Hedgehog Signaling Pathway Activation through Sonic Hedgehog Induction in Pancreatic Cancer.
Cancer Res., July 15, 2006; 66(14): 7041 - 7049.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
M.-T. Lin, C.-Y. Zuon, C.-C. Chang, S.-T. Chen, C.-P. Chen, B.-R. Lin, M.-Y. Wang, Y.-M. Jeng, K.-J. Chang, P.-H. Lee, et al.
Cyr61 Induces Gastric Cancer Cell Motility/Invasion via Activation of the Integrin/Nuclear Factor-{kappa}B/Cyclooxygenase-2 Signaling Pathway
Clin. Cancer Res., August 15, 2005; 11(16): 5809 - 5820.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
N. Takahashi, S. Kobayashi, S. Kajino, K. Imai, K. Tomoda, S. Shimizu, and T. Okamoto
Inhibition of the 53BP2S-mediated apoptosis by nuclear factor {kappa}B and Bcl-2 family proteins
Genes Cells, August 1, 2005; 10(8): 803 - 811.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Till, P. Rosenstiel, A. Krippner-Heidenreich, S. Mascheretti-Croucher, P. J. P. Croucher, H. Schafer, P. Scheurich, D. Seegert, and S. Schreiber
The Met-196 -> Arg Variation of Human Tumor Necrosis Factor Receptor 2 (TNFR2) Affects TNF-{alpha}-induced Apoptosis by Impaired NF-{kappa}B Signaling and Target Gene Expression
J. Biol. Chem., February 18, 2005; 280(7): 5994 - 6004.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Muerkoster, A. Arlt, B. Sipos, M. Witt, M. Grossmann, G. Kloppel, H. Kalthoff, U. R. Folsch, and H. Schafer
Increased Expression of the E3-Ubiquitin Ligase Receptor Subunit {beta}TRCP1 Relates to Constitutive Nuclear Factor-{kappa}B Activation and Chemoresistance in Pancreatic Carcinoma Cells
Cancer Res., February 15, 2005; 65(4): 1316 - 1324.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
P. A. Robe, M. Bentires-Alj, M. Bonif, B. Rogister, M. Deprez, H. Haddada, M.-T. N. Khac, O. Jolois, K. Erkmen, M.-P. Merville, et al.
In vitro and In vivo Activity of the Nuclear Factor-{kappa}B Inhibitor Sulfasalazine in Human Glioblastomas
Clin. Cancer Res., August 15, 2004; 10(16): 5595 - 5603.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Niu, Z. Li, B. Peng, and P. J. Chiao
Identification of an Autoregulatory Feedback Pathway Involving Interleukin-1{alpha} in Induction of Constitutive NF-{kappa}B Activation in Pancreatic Cancer Cells
J. Biol. Chem., April 16, 2004; 279(16): 16452 - 16462.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
N. Yamanaka, T. Morisaki, H. Nakashima, A. Tasaki, M. Kubo, H. Kuga, C. Nakahara, K. Nakamura, H. Noshiro, T. Yao, et al.
Interleukin 1{beta} Enhances Invasive Ability of Gastric Carcinoma through Nuclear Factor-{kappa}B Activation
Clin. Cancer Res., March 1, 2004; 10(5): 1853 - 1859.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Muerkoster, K. Wegehenkel, A. Arlt, M. Witt, B. Sipos, M.-L. Kruse, T. Sebens, G. Kloppel, H. Kalthoff, U. R. Folsch, et al.
Tumor Stroma Interactions Induce Chemoresistance in Pancreatic Ductal Carcinoma Cells Involving Increased Secretion and Paracrine Effects of Nitric Oxide and Interleukin-1{beta}
Cancer Res., February 15, 2004; 64(4): 1331 - 1337.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. S. Sathe, N. Sizemore, X. Li, K. Vithalani, M. Commane, S. M. Swiatkowski, and G. R. Stark
Mutant human cells with constitutive activation of NF-{kappa}B
PNAS, January 6, 2004; 101(1): 192 - 197.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. Monti, B. E. Leone, F. Marchesi, G. Balzano, A. Zerbi, F. Scaltrini, C. Pasquali, G. Calori, F. Pessi, C. Sperti, et al.
The CC Chemokine MCP-1/CCL2 in Pancreatic Cancer Progression: Regulation of Expression and Potential Mechanisms of Antimalignant Activity
Cancer Res., November 1, 2003; 63(21): 7451 - 7461.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. F. Zerbini, Y. Wang, J.-Y. Cho, and T. A Libermann
Constitutive Activation of Nuclear Factor {kappa}B p50/p65 and Fra-1 and JunD Is Essential for Deregulated Interleukin 6 Expression in Prostate Cancer
Cancer Res., May 1, 2003; 63(9): 2206 - 2215.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. Bayon, M. A. Ortiz, F. J. Lopez-Hernandez, F. Gao, M. Karin, M. Pfahl, and F. J. Piedrafita
Inhibition of I{kappa}B Kinase by a New Class of Retinoid-Related Anticancer Agents That Induce Apoptosis
Mol. Cell. Biol., February 1, 2003; 23(3): 1061 - 1074.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arlt, A.
Right arrow Articles by Schäfer, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arlt, A.
Right arrow Articles by Schäfer, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online