Cancer Research Annual Meeting 2010 Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eads, C. A.
Right arrow Articles by Laird, P. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eads, C. A.
Right arrow Articles by Laird, P. W.
[Cancer Research 62, 1296-1299, March 1, 2002]
© 2002 American Association for Cancer Research

Advances in Brief

Complete Genetic Suppression of Polyp Formation and Reduction of CpG-Island Hypermethylation in ApcMin/+ Dnmt1-Hypomorphic Mice1

Cindy A. Eads, Andrea E. Nickel and Peter W. Laird2

Departments of Biochemistry and Molecular Biology [C. A. E., P. W. L.] and Surgery [A. E. N., P. W. L.], University of Southern California, Keck School of Medicine, Norris Comprehensive Cancer Center, Room 6418, Los Angeles, California 90089-9176


   ABSTRACT
Top
 ABSTRACT
Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Promoter CpG island hypermethylation of critical genes is thought to play an important role in human colorectal tumorigenesis. In this study, we show that low levels of CpG island methylation occur in the normal intestinal mucosa of ApcMin/+ mice and are increased in Multiple Intestinal Metaplasia (Min) polyps. We examined the interaction between CpG island hypermethylation and tumorigenesis by genetically modulating expression levels of the predominant DNA methyltransferase, Dnmt1, in ApcMin/+ mice. We show that a combination of Dnmt1 hypomorphic alleles results in the complete suppression of polyp formation and an accompanying reduction in the frequency of CpG island methylation in both the normal intestinal mucosa and intestinal adenomas. These results suggest that sufficient DNA methyltransferase expression is a prerequisite for polyp formation and that hypomorphic alleles of Dnmt1 are not merely genetic modifiers but the first identified true genetic suppressors of the Min phenotype.


   Introduction
Top
 ABSTRACT
 Introduction
Materials and Methods
 Results and Discussion
 REFERENCES
 
Promoter CpG island hypermethylation leading to transcriptional silencing of critical genes has been documented widely in many types of human cancer (1, 2, 3, 4) . Three functional DNA methyltransferases have been described in mammals, of which Dnmt1 appears to be the predominant enzyme (5 , 6) . Colorectal cancer is the second leading cause of death by cancer in the United States (7) . The APC tumor-suppressor gene is implicated in the majority of colorectal tumors (8) . Min3 mice carry a germ-line mutation in the murine Apc ortholog and are predisposed to the development of intestinal neoplasia (9 , 10) . We have shown previously that the combined effects of heterozygosity for a null mutation of the Dnmt1 gene and treatment with the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine could reduce polyp multiplicity in ApcMin/+ mice (11) . In this previous study, we could not rule out that the reduction in polyp number by 5-aza-2'-deoxycytidine was because of drug toxicity unrelated to its demethylating capability (12) . Here, we report that hypomorphic alleles of Dnmt1 lead to the complete suppression of intestinal polyp formation. Furthermore, we use the sensitive MethyLight assay to show that CpG island hypermethylation occurs at low frequency in the histologically normal mucosa of ApcMin/+ mice and is increased in intestinal polyps. Finally, we show that Dnmt1 hypomorphic alleles reduce the frequency of CpG island methylation in the normal mucosa and intestinal polyps.


   Materials and Methods
Top
 ABSTRACT
 Introduction
 Materials and Methods
Results and Discussion
 REFERENCES
 
Dnmt1-Hypomorphic Mice.
The Dnmt1N allele has been described previously (5 , 13) . The Dnmt1R allele was generated as follows. A 320-bp PvuII-EcoRV fragment from pL1–2LacO (14) was inserted into the unique EcoRV site in the same parent plasmid used for the Dnmt1N allele (5) to yield plasmid pPWL532. The parent plasmid of this cloning step was later named pBS(10.5) and contains a 10.5-kb fragment spanning exons 2–4 (previously thought to be exon1) cloned into a pSP72 (Promega) vector backbone (5) . The EcoRV site is located in the third intron of the murine Dnmt1 gene, 20 bp upstream of the splice acceptor site of the fourth exon. Subsequently, a PGK-TKNeo cassette was introduced adjacent to the vector backbone by ligation of a 12.1-kb partial XhoI, complete SpeI fragment of pPWL532 with a 3-kb partial SalI and complete XbaI fragment of pPGKTKNeo (15) resulting in an insertion-type targeting vector called pPWL540. This insertion-type vector was digested at the unique HindIII site and transfected by electroporation into J1 murine embryonic stem cells (5) . Gene-targeted clones were subjected subsequently to counterselection of the TKNeo gene by FIAU as described (15) . ES cell clones that had undergone excision of the vector backbone and TKNeo gene but had retained the LacO insertion were selected for injection into blastocysts. Chimeric mice with verified germ-line transmission capabilities were bred with 129/svJae animals to obtain pure 129/svJae mice carrying the LacO insertion. This allele was designated the Dnmt1R allele for the EcoRV insertion site in the third intron.

Genotype Analysis.
DNA was isolated from tail biopsies as described previously (16) . The genotypes of the Dnmt1 alleles were determined by multiplex-PCR analysis using primers OL106 (5'-GGGAACTTCCTGACTAGGGG-3'), OL168, (5'CCAACAAACCAGTATGTCTCGT-3'), OL173 (5'-CCCAGTTTCCAGAAAGCTACC-3'), and OL369 (5'-CAATTCCACACAACATACGAGC-3'). Reactions were carried out in a 15-µl volume with 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphates, 0.3 µM each primer, and 0.35 units of Taq polymerase using a cycling condition of 94°C for 4 min, followed by 35 cycles of 94°C for 50 s, 60°C for 50 s, and 72°C for 1 min 30 s, followed by 72°C for 5 min. OL168 and OL173 produced both a 342-bp wild-type-specific band and a 661-bp Dnmt1R allele-specific band. OL106 and OL173 produced a 430-bp Dnmt1N allele-specific band. OL173 and OL369 produced a second 211-bp Dnmt1R allele-specific band. The Apc genotype was performed by fluorescence-based, allelic discrimination-PCR (TaqMan; Refs. 17 and 18 ). The primer and probe sequences are listed below. Forward primer (5'-GCCCAGCTCTTCTTCCTC AAG-3'), Reverse primer (5'-GATGGTAAGCACTGAGGCCAATAC-3'), Apc+/+-specific probe (6FAM-TCTCTCTCCAAACTTCTGTCTTTCT-TAMRA), and ApcMin/+-specific probe (6VIC-TCTCTCTCCTAACTTCTGTCTTTCT-TAMRA). Both probes were synthesized as TurboTaq probes.

Intestinal Polyp Scoring and Size Determination.
The entire intestine was removed immediately after euthanasia, washed with 70% ethanol, and fixed in RNAlater (Ambion, Austin, TX). The entire length of the intestine was measured (cm) and subjected to a careful microscopic screen. Adenomas of at least the size of two villi were included in the counting. The investigator was blind to the genotype while counting. Adenomas and mucosal tissue samples selected for DNA analysis were microdissected from the middle third (cm) of the intestine of male mice. Polyp sizes were determined by measuring the maximum diameter of polyps found in the middle third (cm) of the intestine using calipers with an accuracy of 0.05 mm (MECHANIC Type 6901; Fine Science Tools, Inc., Foster City, CA). Male mice only were used for the size determinations to exclude gender-based differences in polyp size.

DNA Methylation Analysis.
Genomic DNA isolation and sodium bisulfite conversion were performed as described previously (16 , 19) . Agarose beads were incubated for 14 h at 50°C to ensure complete bisulfite conversion. Methylation analysis was performed using the MethyLight assay (20, 21, 22) . Parallel TaqMan PCR reactions were performed with primers specific for the bisulfite-converted methylated sequence for a particular locus and with two reference primers (Lhx1 and Guca2). The ratio between the values obtained using these two reference primers (GENE/Lhx1 and GENE/Guca2) was averaged. The PMR at a specific locus was calculated by dividing the GENE/REFERENCE-averaged ratio of a sample by the GENE/REFERENCE-averaged ratio for SssI-treated (SssI enzyme; New England Biolabs, Beverly, MA) control J1 ES cell DNA and multiplying by 100 (22) . CpG islands were defined as being methylated in a particular sample if the PMR value >1. The MethyLight primer and probe sequences are listed below. In all cases, the first primer listed is the forward PCR primer, the second is the TaqMan probe, and the third is the reverse PCR primer: Apc, GGGCGTAGGTATACGTGATCGA, 6FAM-AATAACACCCCGACAAACTACGCCAATACAA-TAMRA, CCATTTTCGAACCCGACAA; Itga4, CGAGGTGTAGATCGAGGTTTCG, 6FAM-ACAACATCACCGCTTCCCGAAAAACG-TAMRA, CCCGCCTCCTACTCACGTAA; Mgmt, CGACACCCTTACGTCACACACT, 6FAM-AACCACGCCCCGCGTACCAA-TAMRA, TAGTTCGAGGGTGTAAAGCGG; Timp3, GAGAGGCGGTGGGCGTAG, 6FAM-CGATATACGCTACAACGACGTCCCACGA-TAMRA, CGAAAATATAAACTAAACGCGTCCT; Lhx1, AGAGTGTTTGGAAGTTAGGTGAAGGT, 6FAM-CACAATCAACATCCCAAACATATTCACCCA-TAMRA, CACATTCATAAACACAAATTCACACAAC; and Guca2, GGTGTTGTGGTTTAGAAGGTTATGG, 6FAM-TCTCATCATCTTCTACAAACCAAAAC-TAMRA, ACCTTATCCTCAACTTCCAACATACC.

Northern and Southern Blot Analysis.
Total RNA (20 µg) was separated on a 0.03% formaldehyde-denaturing agarose gel buffered with 10 mM sodium phosphate (pH 6.8), blotted, and hybridized with an {alpha}-tubulin probe or a Dnmt1 cDNA probe. Genomic DNA (5 µg) isolated from mouse intestinal tissue was digested with the restriction enzymes HpaII and MspI in parallel reactions (New England Biolabs). Southern blot analysis was performed as described previously (11) . Filters were hybridized with a probe containing centromeric minor satellite repeat sequences derived from plasmid pMR150 (23) .


   Results and Discussion
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
REFERENCES
 
In previous work, we have shown that ApcMin/+ Dnmt1S/+ heterozygous mice treated with 5-azaCdR develop fewer intestinal polyps than untreated, Dnmt1+/+ ApcMin/+ mice (11) . This result was substantiated subsequently and expanded on by others (24) . One explanation for this suppression of polyp multiplicity by reduced levels of functional Dnmt1 expression could be that CpG island hypermethylation is an important step in polyp formation and requires sufficient Dnmt1 expression. However, CpG island hypermethylation, though widely studied in human colorectal tumors, has never been documented in mouse intestinal tumors. Therefore, we used the sensitive MethyLight assay (20, 21, 22) to investigate whether CpG island methylation occurs at all in the mouse intestine and whether it is increased in Min polyps. The high sensitivity of the MethyLight assay was crucial for our analysis because most of our samples had limiting amounts of DNA.

We first used a limited number of mucosal and polyp samples to prescreen 10 CpG islands associated with genes known to be methylated in human tumors or likely to influence intestinal tumorigenesis, if silenced (data not shown). Of the 10 CpG islands, only 3 showed a sufficiently frequent methylation in the samples analyzed and were consequently selected for further analysis. These were the CpG islands associated with the genes Itga4, Timp3, and Mgmt. The CpG island associated with Cdkn2a (p16) was hypermethylated in a single polyp sample but was not included for additional study because of its very low frequency of methylation. Subsequently, we screened nine normal mucosal samples and 10 intestinal polyps with each of these three MethyLight reactions.

Fig. 1ACitation shows an overview of the frequency of CpG island methylation for each of these genes in the 19 samples analyzed. Fig. 1BCitation shows the mean percentage of genes methylated for the mucosal samples versus the polyp samples. The percentage of these three CpG islands that were methylated in the normal mucosal tissue was 41%, whereas the polyp tissues showed an average of 77% methylation for these same genes. We found substantial variation among mice, e.g., mouse 3 was unmethylated, and mice 5 and 7 were methylated at all three genes in both mucosa and polyp. This is consistent with the variation in methylation profiles observed in human colorectal tumors (20) . It is interesting to note that CpG island methylation was detectable in the normal mucosa. This has also been reported for human colorectal tissue and has been shown to increase with age and predispose to subsequent tumorigenesis for some genes (25, 26, 27) . These results indicate that CpG island methylation occurs in normal mucosa and suggest that cells with an increased frequency of CpG island methylation may be predisposed to tumorigenesis.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. CpG island methylation in the intestinal mucosa and adenomas. Methylation of CpG islands associated with the Itga4, Mgmt, and Timp3 genes was analyzed by MethyLight as described in "Materials and Methods." A, schematic overview of all measurements. {blacksquare}, methylation; , lack of methylation. B, summary of the averages obtained for all genes in all mucosal or polyp tissues. Error bars, SE.

 
If a reduction in CpG island methylation is the molecular mechanism by which decreased functional expression of Dnmt1 suppresses polyp formation in Min mice (11 , 24) , then one would expect to see a reduced frequency of CpG island methylation in the normal mucosa or polyp tissue of Min mice with reduced Dnmt1 expression. To avoid the use of drug inhibitors, we developed a hypomorphic allele referred to as the Dnmt1R allele (see "Materials and Methods") and combined this allele with the previously described Dnmt1N allele (5) to generate mice with varying levels of Dnmt1 expression. Fig. 2ACitation shows a schematic representation of the three Dnmt1 alleles used in this study. Fig. 2BCitation shows the relative expression of these alleles in embryonic stem cells. The Dnmt1N allele does not show detectable levels of gene expression by Northern blot analysis (Fig. 2BCitation and Ref. 13 ) but has been shown to produce low levels of a truncated protein by alternative splicing (13) . Quantitation of the normalized RNA expression level of Dnmt1R/+ cells versus Dnmt1+/+ cells indicated that the Dnmt1R is expressed at ~60% of that of the wild-type allele (Fig. 2B)Citation . This intermediate level of expression is consistent with the observation that the Dnmt1R allele resulted in reduced viability in conjunction with the null Dnmt1S allele but was fully viable in combination with the previously described hypomorphic Dnmt1N allele (data not shown). We tested whether the combination of these two hypomorphic alleles resulted in detectable hypomethylation in vivo. Fig. 2CCitation shows that the centromeric minor satellite repeat sequence is significantly hypomethylated in the intestinal mucosa of Dnmt1N/R mice but not in that of any of the other three allelic combinations. Therefore, we conclude that both Dnmt1R and Dnmt1N are hypomorphic alleles with reduced functional expression of Dnmt1 and together result in significant hypomethylation in vivo. Nevertheless, the degree of hypomethylation achieved in these mice is not sufficient to cause an overt phenotype. Dnmt1N/R mice are comparable in size and weight to their wild-type littermates and are fertile.



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Structure and characterization of Dnmt1 hypomorphic alleles. A, schematic representation of the structure of the Dnmt1 hypomorphic alleles, which are described in detail in "Materials and Methods." B, Northern blot of total RNA extracted from embryonic stem cells with different hypomorphic alleles, as indicated above the lanes. Left panel, a hybridization with an {alpha}-Tubulin control probe; right panel, a hybridization with a Dnmt1 cDNA probe. C, Southern blot analysis of intestinal DNA derived from 180-day-old mice and from ES cells (Dnmt1C/C), hybridized with a centromeric minor satellite repeat probe (23) . Dnmt1C/C ES cells are homozygous for a mutation in the catalytic domain of the Dnmt1 gene and, thus, can be considered nullizygous for Dnmt1 (13) . The Dnmt1 genotypes and restriction digests are indicated above each corresponding lane.

 
ApcMin/+ Dnmt1 hypomorphs were generated from crosses between C57BL/6 ApcMin/+ Dnmt1N/+ males and 129/SvJae Apc+/+ Dnmt1R/+ females. Mice were euthanized at 180 days and analyzed for polyp multiplicity and polyp size as described in "Materials and Methods." Apc+/+ offspring were euthanized on weaning, because we had shown previously that Dnmt1 mutant mice do not develop intestinal tumors in an Apc+/+ background (11) . We found a gradual decline in polyp number with diminishing Dnmt1 expression levels with a drop to 0 in the ApcMin/+ Dnmt1N/R mice, which have the lowest levels of Dnmt1 expression (Fig. 3A)Citation . The number of polyps was reduced significantly in ApcMin/+ Dnmt1N/+ mice (P = 0.001) and ApcMin/+ Dnmt1N/R mice (P < 0.0001) compared with wild-type ApcMin/+ mice. We did not observe a single polyp in any of the 14 ApcMin/+ Dnmt1N/R mice that we analyzed. This suggests that Dnmt1 hypomorphic alleles act as genetic suppressors of the ApcMin/+ phenotype. Other studies have reported genetic modifiers of the Min phenotype that reduce the number of polyps (9 , 11 , 28, 29, 30, 31) , but this is the first documentation of complete genetic suppression, to our knowledge.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. The mean number and size of intestinal polyps in ApcMin/+ mice with different Dnmt1 genotypes. Mice were euthanized at 180 days of age, and polyps were counted and sized as described in "Materials and Methods." The Dnmt1 genotype is shown below each bar. Error bars, SE. In A, the mean number of polyps for each group is shown as a bar with the mean value indicated within the bar. Polyps were counted throughout the entire small intestine and colon. n, the number of mice in each genotype analyzed. In B, the mean polyp size (mm) for each genotype is shown as a bar with the mean value indicated within the bar. Polyps were measured from the middle third of the intestine of male mice. n, the number of polyps analyzed for each genotype.

 
We also examined the effect of reduced Dnmt1 expression on polyp size. Polyps from Dnmt1R/+ (P = 0.0021) and Dnmt1N/+ (P < 0.0001, unpaired t test) were significantly smaller than those from ApcMin/+ Dnmt+/+ siblings at 180 days (Fig. 3B)Citation , indicating that reduced Dnmt1 expression affects not only polyp formation but also the growth rate of the polyps. This is consistent with the findings of Cormier and Dove (24) , who reported a reduced net growth rate and multiplicity of intestinal adenomas in Dnmt1N/+ ApcMin/+ mice.

If CpG island hypermethylation is an essential feature to polyp formation, and if this is the basis for the suppressive effects of reduced levels of Dnmt1 expression, then we would expect to see a lower CpG island methylation frequency in tissues with reduced DNA methylation levels. The results shown in Fig. 4Citation show that this is indeed the case. The level (Fig. 4A)Citation and frequency (Fig. 4B)Citation of CpG island methylation in the intestinal mucosa is substantially diminished in Dnmt1 hypomorphic mice compared with Dnmt1+/+ mice. The most striking reduction is seen in Dnmt1N/R mucosa, where we did not observe a single instance of CpG island methylation >1 PMR threshold (P = 0.0057, unpaired t test). Dnmt1N/+ mice also showed a statistically significant reduction in the frequency of CpG island methylation in the normal mucosa (P = 0.025) and polyps (P = 0.0002; Fig. 4CCitation ). We could not measure the CpG island methylation frequency in Dnmt1N/R adenomas, because these mice did not develop any polyps.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. CpG island methylation in the intestinal mucosa and adenomas of mice with different Dnmt1 genotypes. Methylation of CpG islands associated with the Itga4, Mgmt, and Timp3 genes was analyzed by MethyLight as described in "Materials and Methods." A, mean methylation levels of each gene for each type of tissue by genotype. The values are given as PMR (see "Materials and Methods"). B, summary of the averages obtained for all genes in all mucosal tissues from each Dnmt1 genotype as indicated below the bar. C, summary of the averages obtained for all genes in all adenoma tissues from each Dnmt1 genotype as indicated below the bar. n, the number of mice analyzed for each genotype. Error bars, SE.

 
These results are consistent with a model in which CpG island methylation occurs in the normal intestinal mucosa in a small minority of cells, which then become predisposed to undergo neoplastic transformation. We do not suggest that the three individual genes that we analyzed are necessarily implicated in tumorigenesis but just that they are representative of CpG island hypermethylation occurring at many CpG islands throughout the genome. Presumably, some of these CpG island methylation events occur in growth-controlling genes and contribute to polyp formation and additional growth. This model is supported by the observation that substantially reduced expression of Dnmt1 in the intestinal mucosa results in the complete suppression of detectable polyp formation. One caveat to our results is that we used a binocular stereo microscope to scan the intestine for adenomas, rather than relying on serial sections analyzed with an upright microscope. Therefore, microadenomas or aberrant crypt foci in DnmtN/R mice may have been missed. Nevertheless, if such early stage adenomas did arise in these mice, they did not progress further to a stage at which they would be detectable using a dissecting microscope. We found that the RNAlater fixative that we used to allow for subsequent nucleic acid analysis rendered the intestines too fragile for subsequent embedding and analysis at high magnification. With these caveats in mind, we tentatively conclude that CpG island hypermethylation, mediated at least in part by Dnmt1, is an essential and rate-limiting step in intestinal adenoma formation in ApcMin/+ mice and that Dnmt1 hypomorphic alleles are the first identified true genetic suppressors of the ApcMin/+ phenotype.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH/National Cancer Institute Grant R01 CA 75090 (to P. W. L.). Back

2 To whom requests for reprints should be addressed, at USC/Norris Comprehensive Cancer Center, Room 6418, 1441 Eastlake Ave, Los Angeles, CA 90089-9176. Phone: (323) 865-0650; Fax: (323) 865-0158; E-mail: plaird{at}hsc.usc.edu. Back

3 The abbreviations used are: Min, multiple intestinal metaplasia; PMR, percentage of methylated reference; Lhx1, Lim1 homeobox protein; Guca2, guanylate cyclase activator 2; Timp3, tissue inhibitor of metalloproteinase 3; Mgmt, O6-methylguanine methyltransferase; Itga4, {alpha}-4-Integrin; FIAU, 1-(2-deoxy-2-fluoro-ß-D-arabinofuranosyl)-5-iodouracil. Back

Received 11/ 1/01. Accepted 1/18/02.


   REFERENCES
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Baylin S. B., Herman J. G. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet., 16: 168-174, 2000.[Medline]
  2. Herman J. G., Baylin S. B. Promoter-region hypermethylation and gene silencing in human cancer. Curr. Top. Microbiol. Immunol., 249: 35-54, 2000.[Medline]
  3. Costello J. F., Plass C. Methylation matters. J. Med. Genet., 38: 285-303, 2001.[Abstract/Free Full Text]
  4. Jones P. A., Laird P. W. Cancer epigenetics comes of age. Nat. Genet., 21: 163-167, 1999.[Medline]
  5. Li E., Bestor T. H., Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell, 69: 915-926, 1992.[Medline]
  6. Okano M., Bell D. W., Haber D. A., Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell, 99: 247-257, 1999.[Medline]
  7. Ries L. A., Wingo P. A., Miller D. S., Howe H. L., Weir H. K., Rosenberg H. M., Vernon S. W., Cronin K., Edwards B. K. The annual report to the nation on the status of cancer, 1973–1997, with a special section on colorectal cancer. Cancer (Phila.), 88: 2398-2424, 2000.[Medline]
  8. Fearnhead N. S., Britton M. P., Bodmer W. F. The ABC of APC. Hum. Mol. Genet., 10: 721-733, 2001.[Abstract/Free Full Text]
  9. Moser A. R., Dove W. F., Roth K. A., Gordon J. I. The Min (multiple intestinal neoplasia) mutation: its effect on gut epithelial cell differentiation and interaction with a modifier system. J. Cell Biol., 116: 1517-1526, 1992.[Abstract/Free Full Text]
  10. Su L. K., Kinzler K. W., Vogelstein B., Preisinger A. C., Moser A. R., Luongo C., Gould K. A., Dove W. F. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene[Published erratum in Science (Wash. DC), 256: 1114, 1992]. Science (Wash. DC), 256: 668-670, 1992.[Abstract/Free Full Text]
  11. Laird P. W., Jackson-Grusby L., Fazeli A., Dickinson S. L., Jung W. E., Li E., Weinberg R. A., Jaenisch R. Suppression of intestinal neoplasia by DNA hypomethylation. Cell, 81: 197-205, 1995.[Medline]
  12. Juttermann R., Li E., Jaenisch R. Toxicity of 5-aza-2'-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation. Proc. Natl. Acad. Sci. USA, 91: 11797-11801, 1994.[Abstract/Free Full Text]
  13. Lei H., Oh S. P., Okano M., Juttermann R., Goss K. A., Jaenisch R., Li E. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development, 122: 3195-3205, 1996.[Abstract]
  14. Labow M. A., Baim S. B., Shenk T., Levine A. J. Conversion of the lac repressor into an allosterically regulated transcriptional activator for mammalian cells. Mol. Cell. Biol., 10: 3343-3356, 1990.[Abstract/Free Full Text]
  15. Chan M. F., van Amerongen R., Nijjar T., Cuppen E., Jones P. A., Laird P. W. Reduced rates of gene loss, gene silencing, and gene mutation in dnmt1-deficient embryonic stem cells. Mol. Cell. Biol., 21: 7587-7600, 2001.[Abstract/Free Full Text]
  16. Laird P. W., Zijderveld A., Linders K., Rudnicki M. A., Jaenisch R., Berns A. Simplified mammalian DNA isolation procedure. Nucleic Acids Res, 19: 4293 1991.[Free Full Text]
  17. Gibson U. E., Heid C. A., Williams P. M. A novel method for real time quantitative RT-PCR. Genome Res., 6: 995-1001, 1996.[Abstract/Free Full Text]
  18. Heid C. A., Stevens J., Livak K. J., Williams P. M. Real time quantitative PCR. Genome Res., 6: 986-994, 1996.[Abstract/Free Full Text]
  19. Olek A., Oswald J., Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res., 24: 5064-5066, 1996.[Abstract/Free Full Text]
  20. Eads C. A., Danenberg K. D., Kawakami K., Saltz L. B., Danenberg P. V., Laird P. W. CpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpression(Published erratum appears in Cancer Res., 59: 5860, 1999). Cancer Res., 59: 2302-2306, 1999.[Abstract/Free Full Text]
  21. Eads C. A., Danenberg K. D., Kawakami K., Saltz L. B., Blake C., Shibata D., Danenberg P. V., Laird P. W. MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res., 28: E32 2000.
  22. Eads C. A., Lord R. V., Wickramasinghe K., Long T. I., Kurumboor S. K., Bernstein L., Peters J. H., DeMeester S. R., DeMeester T. R., Skinner K. A., Laird P. W. Epigenetic patterns in the progression of esophageal adenocarcinoma. Cancer Res., 61: 3410-3418, 2001.[Abstract/Free Full Text]
  23. Chapman V., Forrester L., Sanford J., Hastie N., Rossant J. Cell lineage-specific undermethylation of mouse repetitive DNA. Nature (Lond.), 307: 284-286, 1984.[Medline]
  24. Cormier R. T., Dove W. F. Dnmt1N/+ reduces the net growth rate and multiplicity of intestinal adenomas in C57BL/6-multiple intestinal neoplasia (Min)/+ mice independently of p53 but demonstrates strong synergy with the modifier of Min 1(AKR) resistance allele. Cancer Res., 60: 3965-3970, 2000.[Abstract/Free Full Text]
  25. Issa J. P., Ottaviano Y. L., Celano P., Hamilton S. R., Davidson N. E., Baylin S. B. Methylation of the oestrogen receptor CpG island links aging and neoplasia in human colon. Nat. Genet., 7: 536-540, 1994.[Medline]
  26. Nakagawa H., Nuovo G. J., Zervos E. E., Martin E. W., Jr., Salovaara R., Aaltonen L. A., de la Chapelle A. Age-related hypermethylation of the 5' region of MLH1 in normal colonic mucosa is associated with microsatellite-unstable colorectal cancer development. Cancer Res., 61: 6991-6995, 2001.[Abstract/Free Full Text]
  27. Issa J. P. CpG-island methylation in aging and cancer. Curr. Top. Microbiol. Immunol., 249: 101-118, 2000.[Medline]
  28. Dietrich W. F., Lander E. S., Smith J. S., Moser A. R., Gould K. A., Luongo C., Borenstein N., Dove W. Genetic identification of Mom-1, a major modifier locus affecting Min-induced intestinal neoplasia in the mouse. Cell, 75: 631-639, 1993.[Medline]
  29. Shoemaker A. R., Moser A. R., Midgley C. A., Clipson L., Newton M. A., Dove W. F. A resistant genetic background leading to incomplete penetrance of intestinal neoplasia and reduced loss of heterozygosity in ApcMin/+ mice. Proc. Natl. Acad. Sci. USA, 95: 10826-10831, 1998.[Abstract/Free Full Text]
  30. Shoemaker A. R., Gould K. A., Luongo C., Moser A. R., Dove W. F. Studies of neoplasia in the Min mouse. Biochim. Biophys. Acta, 1332: F25-F48, 1997.[Medline]
  31. Bilger A., Shoemaker A. R., Gould K. A., Dove W. F. Manipulation of the mouse germline in the study of Min-induced neoplasia. Semin. Cancer Biol., 7: 249-260, 1996.[Medline]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
W. G. Nelson, A. M. De Marzo, and S. Yegnasubramanian
Epigenetic Alterations in Human Prostate Cancers
Endocrinology, September 1, 2009; 150(9): 3991 - 4002.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
S. Majid, A. A. Dar, A. E. Ahmad, H. Hirata, K. Kawakami, V. Shahryari, S. Saini, Y. Tanaka, A. V. Dahiya, G. Khatri, et al.
BTG3 tumor suppressor gene promoter demethylation, histone modification and cell cycle arrest by genistein in renal cancer
Carcinogenesis, April 1, 2009; 30(4): 662 - 670.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
T. J. Phesse, L. Parry, K. R. Reed, K. B. Ewan, T. C. Dale, O. J. Sansom, and A. R. Clarke
Deficiency of Mbd2 Attenuates Wnt Signaling
Mol. Cell. Biol., October 1, 2008; 28(19): 6094 - 6103.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Prevention ResearchHome page
C. B. Yoo, J. C. Chuang, H.-M. Byun, G. Egger, A. S. Yang, L. Dubeau, T. Long, P. W. Laird, V. E. Marquez, and P. A. Jones
Long-term Epigenetic Therapy with Oral Zebularine Has Minimal Side Effects and Prevents Intestinal Tumors in Mice
Cancer Prevention Research, September 1, 2008; 1(4): 233 - 240.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Prevention ResearchHome page
J.-P. Issa
Cancer Prevention: Epigenetics Steps Up to the Plate
Cancer Prevention Research, September 1, 2008; 1(4): 219 - 222.
[Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
N. Shivapurkar, V. Stastny, Y. Xie, C. Prinsen, E. Frenkel, B. Czerniak, F. B. Thunnissen, J. D. Minna, and A. F. Gazdar
Differential Methylation of a Short CpG-Rich Sequence within Exon 1 of TCF21 Gene: A Promising Cancer Biomarker Assay
Cancer Epidemiol. Biomarkers Prev., April 1, 2008; 17(4): 995 - 1000.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
Z. Liu, S.-W. Choi, J. W. Crott, M. K. Keyes, H. Jang, D. E. Smith, M. Kim, P. W. Laird, R. Bronson, and J. B. Mason
Mild Depletion of Dietary Folate Combined with Other B Vitamins Alters Multiple Components of the Wnt Pathway in Mouse Colon
J. Nutr., December 1, 2007; 137(12): 2701 - 2708.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
A. Gregorieff and H. Clevers
Giving APCmin tumours a SPARC
Gut, October 1, 2007; 56(10): 1341 - 1343.
[Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
A. T. Agoston, P. Argani, A. M. De Marzo, J. L. Hicks, and W. G. Nelson
Retinoblastoma Pathway Dysregulation Causes DNA Methyltransferase 1 Overexpression in Cancer via MAD2-Mediated Inhibition of the Anaphase-Promoting Complex
Am. J. Pathol., May 1, 2007; 170(5): 1585 - 1593.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Miremadi, M. Z. Oestergaard, P. D.P. Pharoah, and C. Caldas
Cancer genetics of epigenetic genes
Hum. Mol. Genet., April 15, 2007; 16(R1): R28 - R49.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
V. Muthusamy, S. Duraisamy, C. M. Bradbury, C. Hobbs, D. P. Curley, B. Nelson, and M. Bosenberg
Epigenetic Silencing of Novel Tumor Suppressors in Malignant Melanoma
Cancer Res., December 1, 2006; 66(23): 11187 - 11193.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
H. Lin, Y. Yamada, S. Nguyen, H. Linhart, L. Jackson-Grusby, A. Meissner, K. Meletis, G. Lo, and R. Jaenisch
Suppression of Intestinal Neoplasia by Deletion of Dnmt3b
Mol. Cell. Biol., April 15, 2006; 26(8): 2976 - 2983.
[Abstract] [Full Text] [PDF]

Home page
 Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
D. Ray, A. Wu, J. E. Wilkinson, H. S. Murphy, Q. Lu, B. Kluve-Beckerman, J. J. Liepnieks, M. Benson, R. Yung, and B. Richardson
Aging in heterozygous dnmt1-deficient mice: effects on survival, the DNA methylation genes, and the development of amyloidosis.
J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2006; 61(2): 115 - 124.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Prokhortchouk, O. Sansom, J. Selfridge, I. M. Caballero, S. Salozhin, D. Aithozhina, L. Cerchietti, F. G. Meng, L. H. Augenlicht, J. M. Mariadason, et al.
Kaiso-Deficient Mice Show Resistance to Intestinal Cancer
Mol. Cell. Biol., January 1, 2006; 26(1): 199 - 208.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. T. McCabe, J. A. Low, S. Daignault, M. J. Imperiale, K. J. Wojno, and M. L. Day
Inhibition of DNA Methyltransferase Activity Prevents Tumorigenesis in a Mouse Model of Prostate Cancer
Cancer Res., January 1, 2006; 66(1): 385 - 392.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. Kaneda and A. P. Feinberg
Loss of Imprinting of IGF2: A Common Epigenetic Modifier of Intestinal Tumor Risk
Cancer Res., December 15, 2005; 65(24): 11236 - 11240.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. H. Lee, S. Yegnasubramanian, X. Lin, and W. G. Nelson
Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1
J. Biol. Chem., December 9, 2005; 280(49): 40749 - 40756.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
S. R. Payne and C. J. Kemp
Tumor suppressor genetics
Carcinogenesis, December 1, 2005; 26(12): 2031 - 2045.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
W. J. Lee, J.-Y. Shim, and B. T. Zhu
Mechanisms for the Inhibition of DNA Methyltransferases by Tea Catechins and Bioflavonoids
Mol. Pharmacol., October 1, 2005; 68(4): 1018 - 1030.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Y. Yamada, L. Jackson-Grusby, H. Linhart, A. Meissner, A. Eden, H. Lin, and R. Jaenisch
Opposing effects of DNA hypomethylation on intestinal and liver carcinogenesis
PNAS, September 20, 2005; 102(38): 13580 - 13585.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. M. Tucker, J. T. Murphy, N. Kisiel, P. Diegelman, K. W. Barbour, C. Davis, M. Medda, L. Alhonen, J. Janne, D. L. Kramer, et al.
Potent Modulation of Intestinal Tumorigenesis in Apcmin/+ Mice by the Polyamine Catabolic Enzyme Spermidine/Spermine N1-acetyltransferase
Cancer Res., June 15, 2005; 65(12): 5390 - 5398.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
A. M. Melnick, K. Adelson, and J. D. Licht
The Theoretical Basis of Transcriptional Therapy of Cancer: Can It Be Put Into Practice?
J. Clin. Oncol., June 10, 2005; 23(17): 3957 - 3970.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. T. Agoston, P. Argani, S. Yegnasubramanian, A. M. De Marzo, M. A. Ansari-Lari, J. L. Hicks, N. E. Davidson, and W. G. Nelson
Increased Protein Stability Causes DNA Methyltransferase 1 Dysregulation in Breast Cancer
J. Biol. Chem., May 6, 2005; 280(18): 18302 - 18310.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. T. McCabe, J. N. Davis, and M. L. Day
Regulation of DNA Methyltransferase 1 by the pRb/E2F1 Pathway
Cancer Res., May 1, 2005; 65(9): 3624 - 3632.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
P. W. Laird
Cancer epigenetics
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R65 - R76.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. L. Ward, R. Williams, M. Law, and N. J. Hawkins
The CpG Island Methylator Phenotype Is Not Associated with a Personal or Family History of Cancer
Cancer Res., October 15, 2004; 64(20): 7618 - 7621.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. Gilbert, S. D. Gore, J. G. Herman, and M. A. Carducci
The Clinical Application of Targeting Cancer through Histone Acetylation and Hypomethylation
Clin. Cancer Res., July 15, 2004; 10(14): 4589 - 4596.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Yegnasubramanian, J. Kowalski, M. L. Gonzalgo, M. Zahurak, S. Piantadosi, P. C. Walsh, G. S. Bova, A. M. De Marzo, W. B. Isaacs, and W. G. Nelson
Hypermethylation of CpG Islands in Primary and Metastatic Human Prostate Cancer
Cancer Res., March 15, 2004; 64(6): 1975 - 1986.
[Abstract] [Full Text] [PDF]

Home page
 Cold Spring Harb Symp Quant BiolHome page
A. BIRD and D. MACLEOD
Reading the DNA Methylation Signal
Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 113 - 118.
[Abstract] [PDF]

Home page
 Mol. Pharmacol.Home page
A. R. Karpf, A. W. Lasek, T. O. Ririe, A. N. Hanks, D. Grossman, and D. A. Jones
Limited Gene Activation in Tumor and Normal Epithelial Cells Treated with the DNA Methyltransferase Inhibitor 5-Aza-2'-deoxycytidine
Mol. Pharmacol., January 1, 2004; 65(1): 18 - 27.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
L. Kopelovich, J. A. Crowell, and J. R. Fay
The Epigenome as a Target for Cancer Chemoprevention
J Natl Cancer Inst, December 3, 2003; 95(23): 1747 - 1757.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
J. G. Herman and S. B. Baylin
Gene Silencing in Cancer in Association with Promoter Hypermethylation
N. Engl. J. Med., November 20, 2003; 349(21): 2042 - 2054.
[Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Z. Fang, Y. Wang, N. Ai, Z. Hou, Y. Sun, H. Lu, W. Welsh, and C. S. Yang
Tea Polyphenol (-)-Epigallocatechin-3-Gallate Inhibits DNA Methyltransferase and Reactivates Methylation-Silenced Genes in Cancer Cell Lines
Cancer Res., November 15, 2003; 63(22): 7563 - 7570.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. A. Belinsky, D. M. Klinge, C. A. Stidley, J.-P. Issa, J. G. Herman, T. H. March, and S. B. Baylin
Inhibition of DNA Methylation and Histone Deacetylation Prevents Murine Lung Cancer
Cancer Res., November 1, 2003; 63(21): 7089 - 7093.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. A. Feltus, E. K. Lee, J. F. Costello, C. Plass, and P. M. Vertino
Predicting aberrant CpG island methylation
PNAS, October 14, 2003; 100(21): 12253 - 12258.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Fan, Q. Yan, J. Huang, S. Austin, E. Cho, D. Ferris, and K. Muegge
Lsh-deficient Murine Embryonal Fibroblasts Show Reduced Proliferation with Signs of Abnormal Mitosis
Cancer Res., August 1, 2003; 63(15): 4677 - 4683.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
P. Klatt and M. Serrano
Engineering cancer resistance in mice
Carcinogenesis, May 1, 2003; 24(5): 817 - 826.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
P. M. Campbell and M. Szyf
Human DNA methyltransferase gene DNMT1 is regulated by the APC pathway
Carcinogenesis, January 1, 2003; 24(1): 17 - 24.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
J. Trasler, L. Deng, S. Melnyk, I. Pogribny, F. Hiou-Tim, S. Sibani, C. Oakes, E. Li, S. J. James, and R. Rozen
Impact of Dnmt1 deficiency, with and without low folate diets, on tumor numbers and DNA methylation in Min mice
Carcinogenesis, January 1, 2003; 24(1): 39 - 45.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. Koratkar, E. Pequignot, W. W. Hauck, and L. D. Siracusa
The CAST/Ei Strain Confers Significant Protection against ApcMin Intestinal Polyps, Independent of the Resistant Modifier of Min 1 (Mom1R) Locus
Cancer Res., October 1, 2002; 62(19): 5413 - 5417.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eads, C. A.
Right arrow Articles by Laird, P. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eads, C. A.
Right arrow Articles by Laird, P. W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online