Cancer Research Annual Meeting 2010  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mambo, E.
Right arrow Articles by Evans, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mambo, E.
Right arrow Articles by Evans, M. K.
[Cancer Research 62, 1349-1355, March 1, 2002]
© 2002 American Association for Cancer Research


Carcinogenesis

Defective Repair of 8-Hydroxyguanine in Mitochondria of MCF-7 and MDA-MB-468 Human Breast Cancer Cell Lines

Elizabeth Mambo1, Simon G. Nyaga1, Vilhelm A. Bohr and Michele K. Evans2

Laboratories of Cellular and Molecular Biology [E. M., M. K. E.] and Molecular Gerontology [S. G. N., V. A. B.], National Institute on Aging National Institutes of Health, Baltimore, Maryland 21224


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Breast cancer is one of the major causes of mortality among women in the United States. Although the causes of breast cancer remain unclear, it has been speculated that DNA base damage may lead to mutations that subsequently can be carcinogenic. Recently, defective oxidative DNA damage repair has been implicated in breast tumorigenesis. The major oxidative DNA lesion, 8-hydroxyguanine (8-oxoG), is increased in breast cancer, suggesting that this lesion may play a crucial role in the etiology of breast cancer. However, it is not known whether the repair of 8-oxoG or other oxidative base lesions is altered during breast carcinogenesis. We examined the ability of nuclear and mitochondrial extracts of two human breast cancer cell lines, MCF-7 and MDA-MB-468, to repair 8-oxoG lesion. We report that mitochondrial extracts from the two breast cancer cell lines are defective in the base excision repair of 8-oxoG relative to two noncancer cell lines. We also show that the incision activity of 8-oxoG was significantly lower in mitochondrial than in nuclear extracts in the breast cancer cell lines. The defective mitochondrial repair activity was not attributable to lower levels of human 8-hydroxyguanine DNA glycosylase, the base excision repair enzyme known to incise 8-oxoG in DNA. The repair of thymine glycol, another major oxidative DNA base lesion that blocks transcription and causes cell death, was similar in cancer and noncancer cells. Furthermore, nuclear extracts incised thymine glycol with a much higher efficiency than 8-oxoG. These data provide evidence for defective repair of 8-oxoG in mitochondria of MCF-7 and MDA-MB-468 breast cancer cell lines. These results may implicate 8-oxoG repair mechanisms in mitochondria of certain breast cancers.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Breast cancer accounts for 15–18% of all deaths among women every year, with ~180,000 new cases being diagnosed every year (1) . Although the causes of breast cancer remain unknown, it has been speculated that DNA base damage may lead to mutations that subsequently can be carcinogenic. Of primary importance are the base lesions caused by ROS3 . Cellular DNA is exposed to ROS either endogenously by cellular metabolism or through exogenous exposure to environmental mutagens. ROS induce a wide range of DNA lesions, including DNA strand breaks, apurinic AP sites, and oxidized bases (2) . Tg and 8-oxoG are some of the most deleterious oxidative base lesions. Thymine glycol (Tg) is a toxic lesion that blocks both DNA replication (3) and transcription (4) , causing cell death. Conversely, 8-oxoG is a premutagenic lesion that results in GC to TA transversions (5) . Indeed, spontaneous transversion mutations have been observed in proto-oncogenes and the tumor suppressor gene, p53 (6 , 7) , a commonly mutated gene in various forms of cancer. To avoid the harmful effects of 8-oxoG, organisms have developed efficient mechanisms for repairing this damage. In Esherichia coli, these mechanisms include the MutT, MutM, and MutY pathways (8) . MutT (and its human homologue hMTH) is an 8-oxoGTPase that hydrolyzes 8-oxoGTP in the nucleotide pool to 8-oxoGMP, thus preventing incorporation of 8-oxoGTP during DNA replication. MutY (and its human homologue hMYH) is a DNA glycosylase that removes adenine opposite 8-oxoG (8) . MutM, otherwise known as Fpg, is an E. coli DNA glycosylase/AP lyase that preferentially removes 8-oxoG opposite cytosine. To date, mammalian structural homologues of Fpg have not been identified, but functional homologues do exist. In yeast, the Ogg1 gene encodes a DNA glycosylase that removes 8-oxoG opposite cytosine (9) . The human homologue of yeast, Ogg1(hOGG1), has been characterized extensively and shown to be the primary enzyme that preferentially repairs 8-oxoG opposite cytosine in human cells (9, 10, 11) . It has also been shown both in E. coli and yeast that inactivation of Fpg, MutT, and Ogg1 results in increased 8-oxoG levels both in the DNA and the nucleotide pool, ultimately culminating in the expression of a mutator phenotype (12 , 13) . By analogy to the mutator phenotype observed in the bacterial and yeast systems, it has been hypothesized that lack of repair of 8-oxoG in humans could be highly mutagenic and may lead to a mutator phenotype as well.

Studies using high-performance liquid chromatography and gas chromatography-mass spectroscopy have revealed increased levels of 8-oxoG, 8oxoA, and ring-opened FapyG in nuclear DNA from invasive ductal breast carcinomas relative to normal breast tissue (14, 15, 16) , implicating oxidative DNA base lesions in the etiology of breast cancer. It has been shown that 8-oxoG is repaired via the BER pathway (17) . To date, there are no reports on the removal of 8-oxoG or other oxidative DNA base lesions from nuclear or mtDNA in breast cancer cells. Therefore, it remains to be established whether BER of oxidative lesions is altered during breast carcinogenesis. Other studies have led to the suggestion that NER may be defective in breast cancer patients. Specifically, phytohemagglutinin-stimulated lymphocytes from patients with invasive breast cancer have been determined to have reduced capacity to repair of UV-induced nuclear DNA lesions (18 , 19) . In addition, Parshad et al. (20) also showed that women at high risk of developing breast cancer had increased nuclear DNA strand breaks after X-irradiation. Recent studies by Gowen et al. (21) showed that BRCA1 is involved in transcription-coupled repair of hydrogen peroxide-induced lesions in cellular DNA. Because BRCA1 is a gene that when mutated confers breast cancer susceptibility, this finding leads to the notion that repair of oxidative lesions may be altered during breast carcinogenesis.

The studies discussed above provide evidence for decreased NER in lymphocytes from breast cancer patients and increased oxidative DNA damage levels in nuclear DNA from breast cancer patients. Although both NER and BER are likely important in preventing genomic instability that may lead to cancer, oxidative DNA damage may play a pivotal role in carcinogenesis (22 , 23) . We hypothesize that some breast cancer cells may have defects in some steps of the BER pathway. The presence or accumulation of oxidative damage in nuclear DNA may not account for the potential effects of cellular oxidative damage. Furthermore, mtDNA has relatively higher levels of oxidative DNA base damage than nuclear DNA (24 , 25) . It has been proposed that mitochondria of aerobic organisms are subject to more oxidative damage relative to the nucleus because of a lack of protective histones and ROS produced during high metabolic activities, such as oxidative phosphorylation (26) . This increased oxidative damage may be attributable to inefficient DNA repair or to increased damage induction in mitochondria. However, very little is known about mtDNA repair. Elevated oxidative DNA damage may lead to an increased mutation rate in mtDNA that may lead to dysfunctional mitochondria, resulting in degenerative diseases, aging, and cancer (27) . Although increased oxidative damage has been demonstrated in nuclear DNA from breast cancer tissue, there are no studies addressing mtDNA repair in breast cancer cells. To address the hypothesis that oxidative DNA damage repair may be defective in mitochondria of some breast cancer cell lines, we examined the ability of mitochondrial extracts from MCF-7 and MDA-MB-468 to repair 8-oxoG and Tg.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Culture Conditions.
The breast cancer cell lines MCF-7 and MDA-MB-468 were obtained from American Type Culture Collection (Manassas, VA). The MDA-MB-468 cells were grown in 1 x MEM and supplemented with 10% FBS and 2 mM glutamine, 1 x each of nonessential amino acids, essential amino acids, and vitamins. All media components were obtained from Life Technologies, Inc. (Rockville, MD). The MCF-7 cell line was grown in 1 x MEM supplemented with 2 mM glutamine, 10% FBS, 1.75 µM insulin, 1 x nonessential amino acids, and 1 mM sodium pyruvate. CRL 2337 cells were grown in RPMI medium (American Type Culture Collection) supplemented with 10% FBS. The normal human mammary epithelial cells AG11134 were obtained from the Aging Cell Repository (National Institute of General Medical Sciences Coriell) and cultured in Clonetics (Walkersville, MD) serum-free mammary epithelial growth media supplemented with 0.052 mg/ml bovine pituitary extract, 10 ng/ml human epidermal growth factor, 5 µg/ml insulin, 0.5 µg/ml hydrocortisone, gentamicin, and amphotericin-B. All cells were grown at 37°C, 5% CO2, and 95% relative humidity.

Mitochondrial Extract Preparation.
About 10 x 109 cells were harvested and washed with 1 x PBS. Mitochondria were isolated as described (28 , 29) with minor modifications. Briefly, cells were homogenized in 1 x MSHE buffer [0.21 M Mannitol, 0.07 M sucrose, 0.15 mM spermine, 1 mM EGTA, 0.75 mM spermidine, 1 mM EDTA, and 10 mM HEPES buffer (pH 7.4)] containing protease inhibitors and 5 mM DTT. The homogenate was spun at 500 x g for 7 min at 4°C, and the supernatant was transferred to a fresh tube. The nuclear pellet was stored at -80°C. The supernatant was spun at 10,000 x g for 7 min at 4°C. The resulting crude mitochondrial pellet was resuspended in 1 x MSHE buffer and centrifuged through a 50% percoll gradient at 50,000 x g under vacuum for 1 h at 4°C. The mitochondrial band was aspirated, pelleted, and washed with 1 x MSHE buffer. The mitochondria were lysed in 20 mM HEPES buffer (pH 7.4) containing 5 mM DTT, 1 mM EDTA, 5% glycerol, protease inhibitors, and 0.05% Triton X-100. Protein yield was quantified using the Bradford Assay (Bio-Rad, Hercules, CA). The extracts were stored at -80°C.

Cytochrome c Oxidase Activity.
To determine the viability of the mitochondria, cytochrome c oxidase activity was measured polarographically using a Clark-type electrode. The reactions were performed using 250 µg of mitochondrial extracts in 1.2 ml of buffer containing 0.05 M K2HPO4 (pH 7.4), 0.04 mM cytochrome c (Sigma Chemical Co.), 12.5 mM L-ascorbic acid (Sigma Chemical Co.), 0.63 mM N, N, N', N'-tetramethyl-p-phenyl enediamnine (Sigma Chemical Co.), and 0.05% Triton X-100. The cytochrome c oxidase activity was calculated from the slopes of the polarographic charts and expressed in µM of cytochrome c consumed/min/microgram protein.

Nuclear Extract Preparation.
Nuclear extracts were prepared according to Lin et al. (30) with minor modifications. Cells were harvested, washed with 1 x PBS, and homogenized in 1 x MSHE buffer (pH 7.4) containing 0.5 mM DTT and protease inhibitors. The homogenate was spun at 500 x g for 7 min at 4°C, and the resulting pellet was sonicated for 3 x 5 s in buffer A containing 20 mM HEPES buffer (pH 7.9), 25% glycerol, 0.2 mM EDTA, 0.5 mM DTT, and 0.2 mM phenylmethylsulfonyl fluoride. Half volume of buffer A was added to the crude nuclear extract and incubated for 30 min on ice. The samples were spun at 25,000 x g for 30 min at 4°C, and the supernatant was saved as a nuclear extract for later use. Protein yield was quantified as described above.

Oligonucleotides and 5' End-Labeling.
Oligonucleotides containing either a single 8-oxoG lesion or thymine were obtained from Midland Certified Reagent Co. (Midland, TX). The oligonucleotides had the following sequences: 5' GAACGACAGAtgGACACGACAGACAAGCA 3' and 5' ATATACCGCGXCCGGCCGATCAAGCTTATA 3', where tg and X represents Tg and 8-oxoG, respectively. Tg-containing oligonucleotide was prepared by oxidation with osmium tetraoxide in the presence of pyridine as described (31) . Oligonucleotides (100 ng each) were 5' end-labeled using 30 µCi of [{gamma}- 32P] ATP 3000 Ci/mmol (Amersham, Piscataway, NJ) and T4 polynucleotide kinase (New England Biolabs, Beverly, MA). To each labeled oligonucleotide, a 6-fold excess of the complementary oligonucleotide was added. The oligonucleotides were denatured at 95°C for 5 min and allowed to anneal by gradual cooling to room temperature. The efficiency of the annealing reaction was confirmed by electrophoresis through a 20% nondenaturing polyacrylamide gel. This method revealed that 100% of the single-stranded oligonucleotide was converted to double-stranded form.

8-oxoG Incision Assay.
Protein extracts were incubated at 37°C with 0.2 ng of labeled duplex oligonucleotide in 20 mM HEPES buffer (pH 7.4) containing 5 mM EDTA, 5% glycerol, 5 mM DTT, and 100 mM KCl. For concentration dependence analyses, reactions were performed using increasing amounts of extracts ranging from 10 to 150 µg. All reactions were incubated at 37°C for 4 h. For the kinetic analyses, 10 µg of protein extracts were used for Tg incision, whereas 50 µg were used for the 8-oxoG incision. Kinetic analyses for Tg and 8-oxoG incision were performed at 1–4, 6, 8, and 24 h. Control reactions were performed by incubating labeled oligonucleotides with either Fpg or bacterial endonuclease III, a glycosylase/AP lyase known to cleave Tg (32) . To test for the specificity of the incision activity that was observed in the presence of protein extracts, two other controls were included: (a) incubation of all reagents in the absence of extracts; and (b) incubation of extracts with an undamaged duplex oligonucleotide of the same sequence. All reactions were terminated by incubation at 55°C for 15 min in the presence of 0.1% SDS and 0.05 mg/ml Proteinase K. Proteins were removed by phenol/chloroform extraction. An equal volume of loading dye (95% formamide, 5% glycerol, 0.02% bromphenol blue, and 0.02% xylene cyanole) was added before separating the samples on a 20% polyacrylamide/7 M urea gel. The gels were exposed in PhosphorImager cassettes, and band images were quantified using ImageQuant version 5.1 (Molecular Dynamics, Sunnyvale, CA).

Western Blot Analyses.
Nuclear and mitochondrial extracts (15 µg) were denatured by heating at 95°C for 3 min, loaded on a 4–20% Tris-Glycine gel (Novex, Carlsbad, CA), and electrophoresed in 1 x Tris-Glycine SDS buffer. After electrophoresis, the proteins were transferred to nitrocellulose membranes (Novex). The membranes were blocked for 1 h in 5% dry milk in PBS-Tween (0.2%) and then hybridized with hOgg1 antibody (Novus Biologicals, Littleton, CO) at a final concentration of 1.8 µg/ml. The membranes were washed and reacted with the antirabbit horseradish peroxidase-conjugated antibody (1:2000 dilution) for 20 min. For detection, the membranes were developed using enhanced chemiluminescence plus Western detection kit (Amersham Pharmacia BioTech). The membranes were stripped at 50°C for 30 min in a buffer containing 62.5 mM Tris-HCl (pH 7.4), 100 mM ß-mercaptoethanol, and 2% SDS and reprobed with ß-actin antibody (0.4 µg/ml; Santa Cruz Biotechnology, Santa Cruz, CA). The protein signals were quantified using Molecular Dynamics ImageQuant software Version 4.2.

Analyses of mRNA by RT-PCR.
Total RNA was isolated using RNA STAT (Tel-Test, Inc., Friendswood, TX) according to the manufacturer’s instructions. First-strand synthesis was performed using the Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc., Grand Island, NY). Using the following primers: 5' to 3' CCTACACCTCAGGAAAGCC and 3' to 5' GATTCCTACCAAAATAGAAGGG, the hOGG1 cDNA was amplified by PCR for 30 cycles, giving two major products of ~1.8 and 2.3 kb. ß-actin primers (Clontech Laboratories, Inc., Palo Alto, CA) were used as controls.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Concentration Dependence Analyses of Tg and 8-oxoG Incision Activities in Nuclear Extracts of MCF7 and MDA-MB-468 Breast Cancer Cells.
To determine whether these breast cancer cell lines are proficient in oxidative damage repair, we examined the ability of nuclear extracts prepared from untreated MCF-7 and MDA-MB-468 breast cancer cells to incise Tg- and 8-oxoG-containing oligonucleotides. The nuclear extracts incised Tg, producing the expected 10-mer product (Fig. 1A)Citation . Endonuclease III incised Tg resulting in a 10-mer product with similar mobility (Fig. 1ACitation , Lane E). No incision was observed when the control oligonucleotide containing an undamaged thymine was incubated with either endonuclease III or the nuclear extracts from the breast cancer cells (Fig. 1ACitation , Lanes C and EC). In addition, no incision product was observed in the absence of the extract (Fig. 1ACitation , Lane 0), indicating the specificity of the incision for the lesion. The control oligonucleotide had a slightly higher mobility because it was two bases longer (30 mer) than the Tg-containing oligonucleotide (28 mer). The incision activity of 8-oxoG by nuclear extracts from MCF-7 cells is shown in Fig. 1BCitation . The mobility of the cleavage product of the 8-oxoG-containing oligonucleotide was slightly slower than that generated by the bacterial Fpg glycosylase, suggesting a different cleavage mechanism (Fig. 1B)Citation . No incision products were observed when the 8-oxoG-containing oligonucleotide was incubated with buffer without the nuclear extract or when the control oligonucleotide containing undamaged guanine was incubated with the Fpg enzyme (Fig. 1B)Citation . The data suggested that the incision activity observed in the lanes with extracts was specific for 8-oxoG. Fig. 1, C–ECitation shows that nuclear extracts from the MCF-7, MDA-MB-468, and CRL 2337 cell lines were proficient in the removal of both Tg and 8-oxoG; however, analyses of the initial rate of reaction show that Tg was removed more efficiently than the 8-oxoG lesion. Additional analyses of the repair kinetics reveal that the repair of 8-oxoG by MCF-7 and MDA-MB-468 was achieved at a relatively slower rate than the noncancer cell line CRL 2337 (Fig. 1, C–E)Citation .



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Incision of 8-oxoG and Tg by nuclear extracts. A 5' end-labeled duplex oligonucleotide (0.2 ng) containing either a single Tg or 8-oxoG was incubated at 37°C with increasing amounts of nuclear extracts with the indicated amounts (µg) for 4 h. Lanes are designated as M for oligonucleotide-sizing markers (8–32 bp). A, a representative gel showing incision of Tg by MDA-MB-468 cells. Lanes: C, 50 µg of extracts incubated with control oligonucleotide; E, Tg-containing oligonucleotide incubated with endonuclease III; and EC, endonuclease III incubated with control oligonucleotide. B, incision of 8-oxoG by nuclear extracts from MCF-7 cells. Lanes: F, 2 ng of Fpg incubated with 8-oxoG-containing oligonucleotide; FC, Fpg incubated with control oligonucleotide. Panels C—E, quantified results of the incision products of 8-oxoG and Tg in MDA-MB-468, MCF-7, and CRL 2337, respectively.

 
Kinetic Analyses of 8-oxoG Incision by Nuclear and Mitochondrial Extracts from MCF-7 and MDA-MB-468 Breast Cancer Cells.
Having shown that nuclei of MCF-7 and MDA-MB-468 breast cancer cells harbored an enzymatic activity specific for 8-oxoG, we examined the kinetics of the incision of 8-oxoG in nuclear and mitochondrial extracts of MCF-7 and MDA-MB-468 cells. On the basis of the experiment in Fig. 1, C–ECitation , 50 µg of extracts were incubated with the labeled duplex oligonucleotide containing 8-oxoG and incubated for 1, 2, 4, 6, 8, and 24 h. A comparison of the repair activity by MCF-7 and MDA-MB-468 showed that mitochondrial extracts incised 8-oxoG less efficiently than the nuclear extracts from the same cell harvest. Mitochondrial extracts from MCF-7 and MDA-MB-468 cells had ~20% maximum incision that was attained at 6 h (Fig. 2, A and BCitation , clear bars), whereas the nuclear extracts showed ~60% incision at 8 h (Fig. 2Citation , black bars). The highest mitochondrial 8-oxoG incision activity of CRL 2337 was 3-fold higher than that of the two breast cancer cell lines (compare Fig. 2CCitation with Fig. 2, A and BCitation , clear bars). The observed defective repair of 8-oxoG by mitochondrial extracts of the two cancer cell lines was not attributable to compromised or inactive mitochondria as evidenced by similar cytochrome c oxidase activity relative to the noncancer cell lines (Table 1)Citation . These results provide evidence that the repair mechanism of 8-oxoG may be different in nuclear and mitochondrial extracts of some human breast cancer cells.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A kinetic analysis of the incision of 8-oxoG by nuclear and mitochondrial extracts. A 5' end-labeled duplex oligonucleotide (0.2 ng) containing a single 8-oxoG lesion was incubated at 37°C for the indicated time with 50 µg of either nuclear or mitochondrial extracts. The incision products were quantified as described in "Materials and Methods." Error bars, SD from the mean of three independent experiments. Panels, incision activities of: A, MCF-7; B, MDA-MB-468; and C, CRL 2337 cell lines. Error bars at 4, 6, and 8 h (Fig. 2B)Citation are small and cannot be distinguished.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Cytochrome oxidase activity

 
Defective Repair of 8-oxoG by Mitochondrial Extracts from MCF-7 and MDA-MB-468 Breast Cancer Cells.
To determine whether the low 8-oxoG incision activity observed in the mitochondrial extracts was characteristic of the breast cancer cell lines, MCF-7 and MDA-MB-468, we examined the repair of 8-oxoG by mitochondrial extracts from noncancer human mammary epithelial cells AG11134 and noncancer lympoblastoid cell line CRL 2337 (Fig. 3A)Citation . The maximum 8-oxoG incision activity for the mitochondrial extracts was attained at 6 h (Fig. 2, A—CCitation , clear bars). Therefore, we compared the 6-h incision activity in mitochondrial extracts from the two breast cancer cell lines to the two noncancer cell lines. The results showed that mitochondrial extracts from both breast cancer cell lines are deficient in the incision of 8-oxoG (Fig. 3)Citation , compared with those from the noncancer cell lines. The incision activity for MCF-7 (spotted bar) and MDA-MB-468 (clear bar) was 2–3-fold lower than the noncancer cell lines AG11134 (black bar) and CRL 2337 (hatched bar). To ascertain that the observed activity in the mitochondrial extracts was not attributable to nuclear contamination, Western blot analyses were carried out using an antibody to a nuclear envelope protein, lamin B. The results showed lamin B was not detectable in the mitochondrial extracts but was present in the nuclear extract (Fig. 3B)Citation . Furthermore, the method used in isolating mitochondria had been shown previously to be free of nuclear contamination (29) . These results suggest a possible defect in the repair of 8-oxoG by mitochondrial extracts from these breast cancer cells.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Defective 8-oxoG repair by mitochondrial extracts from MCF-7 and MDA-MB-468 breast cancer cell lines. In A, 0.2 ng of a 5' end-labeled duplex oligonucleotide containing a single 8-oxoG lesion was incubated at 37°C for 6 h with 50 µg of mitochondrial extracts from MCF-7, MDA-MB-468, or noncancer cell lines, AG11134 and CRL 2337. The incision products were quantified as described previously. Error bars, SD from the mean of three independent experiments. B, results of Western blot analyses of lamin B in mitochondrial and nuclear extracts of these cell lines.

 
Cytochrome c Oxidase Activity.
To determine the integrity of the mitochondrial extract preparations, cytochrome c oxidase activity was measured as described in the "Materials and Methods" section. The results of this experiment showed that the mitochondria from the breast cancer cell lines MCF-7 and MDA-MB-468 had normal activity relative to the noncancer cell lines CRL 2337 (Table 1)Citation .

Kinetic Analyses of Tg Incision by Nuclear and Mitochondrial Extracts from MCF-7 and MDA-MB-468 Breast Cancer Cells.
To determine whether the defective repair of 8-oxoG in the two breast cancer cell lines represents a general defect in BER of oxidative lesions in mitochondria, we tested the ability of nuclear and mitochondrial extracts to repair Tg. A kinetic analysis of Tg repair was performed with 10 µg each of nuclear or mitochondrial extracts (determined from Fig. 1, C and DCitation ). As shown in Fig. 4Citation , both nuclear ({blacksquare}) and mitochondrial ({circ}) or (closed circles) extracts from both MCF-7 and MDA-MB-468 cells were proficient in the removal of Tg. The kinetics of removal of Tg were similar in both nuclear and mitochondrial extracts, as shown by the overlapping kinetic graphs. These results indicate that the mechanisms of Tg repair may be similar in nuclear and mitochondria of human mammary cells and that mitochondrial extracts from the two breast cancer cell lines are efficient in Tg incision. The repair kinetics of Tg indicates that mtDNA repair is just as efficient as nuclear DNA repair, thereby ruling out the notion that mitochondria intrinsically have lower DNA repair capacity than nuclear extracts. Furthermore, the results suggest that the observed decreased 8-oxoG activity was specific for that lesion and restricted to mitochondria of both breast cancer cell lines analyzed. Because the repair activity of Tg by the breast cancer extracts was comparable with that of noncancer extracts, the data suggest that the BER subpathway for the repair of 8-oxoG is defective in the mitochondria of these specific breast cancer cell lines



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Kinetic analyses of Tg incision by nuclear and mitochondrial extracts from MCF-7 and MDA-MB-468 cell lines. A 5' end-labeled duplex oligonucleotide (0.2 ng) containing a single Tg lesion was incubated at 37°C for the indicated time with 10 µg of either nuclear or mitochondrial extracts. The incision products were quantified as described in "Materials and Methods." Each datum point represents the mean of three biological experiments; error bars, SD from the mean of three independent experiments. A, extracts from MCF-7 cells; B, extracts from MDA-MB-468 cells.

 
Analyses of the Expression of hOgg1 by RT-PCR and Western Blot.
To determine whether the defective incision of 8-oxoG in MCF-7 and MDA-MB-468 cells was attributable to reduced expression of hOgg1, we analyzed the mRNA and protein levels of hOgg1 by RT-PCR and Western blotting, respectively. The results showed that mRNAs for both the nuclear form ({alpha} Ogg1) and mitochondrial form (ß-Ogg1) were overexpressed in the MCF-7 and the MDA-MB-468 compared with the AG11134 and CRL 2337 controls (Fig. 5A)Citation . Western blot analyses with an Ogg1 antibody specific for the nuclear form also showed that {alpha}-hOgg1 was overexpressed in both the breast cancer cell lines (Fig. 5B)Citation . Western analyses using an antibody specific for the ß-hOgg1 revealed that ß-hOgg1 was present in the mitochondria of both breast cancer cell lines at equal or higher amounts relative to the noncancer mammary cell line AG11134 (Fig. 5B)Citation . Thus, defective 8-oxoG repair in the mitochondria of the two breast cancer cell lines is not attributable to the lack of expression of hOgg1.



View larger version (73K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Expression of hOgg1 in MCF-7, MDA-MB-468, and AG11134 cell lines. In A, RT-PCR analysis of hOGG1 mRNA in noncancer mammary AG11134 and the breast cancer MCF-7 and MD-MB-468 cell lines was performed as described in "Materials and Methods." For control, ß-actin primers were used to amplify ß-actin cDNA. B, Western blot analyses of {alpha}-hOGG1 and ß-hOgg1in the noncancer AG11134 and the breast cancer MCF-7 and MD-MB-468 cell lines as described in "Materials and Methods." For control, each membrane was stripped and reprobed with ß-actin antibody.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we have examined the ability of nuclear and mitochondrial extracts from breast cancer cell lines MCF-7 and MDA-MB-468 to initiate the repair of 8-oxoG and Tg lesions from duplex oligonucleotides. We report several important findings in this study: (a) mitochondrial extracts from both MCF-7 and MDA-MB-468 cell lines are deficient in the removal of 8-oxoG (Fig. 3A)Citation . Both breast cancer cell lines exhibited more than 2-fold decrease in their ability to incise 8-oxoG relative to the noncancer cell lines AG11134 and CRL 2337. This defect was specific for 8-oxoG because the incision of Tg by the same mitochondrial extracts was high and comparable with that of nuclear extracts (Fig. 4)Citation ; (b) nuclear extracts from both breast cancer cell lines removed 8-oxoG more rapidly and efficiently than mitochondrial extracts (Fig. 2, A and B)Citation ; and (c) nuclear extracts were shown to incise Tg more rapidly than 8-oxoG (Fig. 1, C–E)Citation .

To date, there have been no studies addressing the repair of 8-oxoG in mitochondria of breast cancer cells. However, there are studies on 8-oxoG repair using other cancer models. Specifically, Hyun et al. (33) have shown that mitochondrial extracts from a leukemia cell line KG-1 have a significant reduction in the ability to incise 8-oxoG. Dobson et al. (34) have reported that mitochondrial extracts from HeLa cells are almost devoid of 8-oxoG repair. Taken together, these studies suggest that mitochondrial extracts from cancer cells may be defective in the repair of 8-oxoG. On the basis of the above observations, one may expect to find increased mutations in mtDNA of cancer cells. Consistent with this speculation, recent studies have reported increased homoplasmic transition mutations in mtDNA of various cancers (35) . Recently, Parrella et al. (36) reported increased mtDNA mutations in 61% of the 18 primary breast tumors analyzed.

The enzyme that specifically repairs 8-oxoG in humans is a DNA glycosylase/AP lyase designated as hOgg1 (9, 10, 11) . This enzyme is well characterized and has been shown to preferentially remove 8-oxoG opposite cytosine in the nuclear genome (9 , 10) . However, it is not clear whether mitochondria have a separate DNA glycosylase for the removal of 8-oxoG. It has been shown recently that mitochondria from OGG1 knock mice have significantly reduced 8-oxoG incision activity (37) ; however, the presence of backup enzymes cannot be ruled out. Only recently has the evidence for oxidative DNA damage repair been reported in human mitochondria (28 , 29 , 38, 39, 40) . There are two major forms of hOgg1, {alpha}- and ß-hOgg1, that are products of alternative splicing (41 , 42) . Both forms have a putative mitochondria localization signal. However, only the {alpha}-hOgg1 has a nuclear localization signal (43) . Recent studies by Takao et al. (40) and Nishioka et al. (43) showed that the ß-form is targeted to the mitochondria. Our analyses of the hOgg1 mRNA by RT-PCR showed that the nuclear form ({alpha}-hOgg1) was the most abundant form in both the normal and breast cancer cell lines (Fig. 5A)Citation . These results are consistent with results from other human tissues in which the {alpha}-hOgg1 was also the most abundant form (9 , 43 , 44) , as well as results of Shinmura et al. (45) in which cancerous and noncancerous human cells expressed the {alpha}-Ogg1 form constitutively. We also found that mRNA for both the {alpha}-and the ß-hOgg1 were overexpressed in both breast cancer cell lines relative to the noncancer mammary cell line AG11134 (Fig. 5A)Citation . In addition, Western blot analyses revealed that both forms of Ogg1 were present in the breast cancer extracts either in similar or higher amounts relative to the noncancer AG11134 cells (Fig. 5B)Citation . On the basis of these results, expression of the ß-hOgg1 both at the mRNA or protein level cannot account for the reduced activity in the mitochondrial extracts from the breast cancer cells. Overexpression of both forms of hOgg1 examined by RT-PCR was not accompanied by increase in the incision activity of 8-oxoG, suggesting that the glycosylase involved may be distinct from hOgg1. Recently, Mitra et al. (46) reported two separate 8-oxoG-specific activities in whole cell extracts of HeLa cells. However, if ß-hOgg1 is involved, it may harbor mutations that could result in reduced enzyme activity in the mitochondria. Thus far, there are no studies that have examined the mutation spectrum in the ß-hOgg1. However, mutations in the {alpha}-hOgg1 have been reported and characterized mostly in tumor cells (33 , 47) . The studies by Hyun et al., (33) reported homozygous mutation CGA-CAA, resulting in amino acid Arg229-Gln229 in a leukemia cell line, KG-1. In a separate study, Chevillard et al. (47) found an Arg131 to Gln in primary lung cancer and that these cells were devoid of 8-oxoG incision activity. Other mutations in hOgg1 have been reported but found to have no effect on the 8-oxoG incision activity (41 , 42) . Therefore, it is important to examine the genetic status of ß-hOgg1 in MCF-7 and MDA-MB-468 cell lines. Another possible explanation for the reduced 8-oxoG incision by the mitochondrial extracts from the breast cancer cells could be the presence or absence of other factors that may inhibit or enhance the activity of glycosylase(s) involved.

The mechanism of repair of 8-oxoG has been determined in human whole cell extracts (17 , 46 , 48) . However, there are a few reports comparing the repair of 8-oxoG to other oxidative lesions, such as Tg, abasic sites, and uracil (49 , 50) . Our results show that human mammary extracts were able to remove Tg much more rapidly than 8-oxoG (Fig. 1, C–E)Citation . These results are consistent with those by Cappelli et al. (50) , showing that 8-oxoG is poorly repaired in normal human fibroblasts compared with uracil and AP sites. Because we examined the glycosylic activity of Tg and 8-oxoG, we propose that the difference in the kinetics of the repair of the two lesions is likely to be controlled by the initial step of BER. The Cappelli et al. (50) findings also indicate that the efficiency of DNA repair synthesis is dependent on the removal of the base.

In this study, we show for the first time that mitochondria from human breast cancer cell lines MCF-7 and MDA-MB-468 are defective in the repair of 8-oxoG. This defect may imply that some breast cancer cells have a high incidence of mtDNA mutations. The genetic status of mtDNA from these breast cancer cells remains to be determined through sequence analyses. Therefore, we conclude that repair of 8-oxoG in the mitochondrial genome may be an important factor in the development of breast cancer. Our studies may provide a basis for novel molecular interventions of certain breast cancers. We further propose that other forms of cancer may be defective in oxidative DNA damage repair.


    ACKNOWLEDGMENTS
 
We thank Althaf Lohani for the assistance with cell culture. We thank Drs. Andrej Podlutsky, Nikki Holbrook, Grigory Dianov, Parimal Karmakar, and Stephen Lloyd for critically reading the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 E. M. and S. G. N. contributed equally to this manuscript. Back

2 To whom requests for reprints should be addressed, at Laboratories of Cellular and Molecular Biology, National Institute on Aging National Institutes of Health, Baltimore, MD 21224. Back

3 The abbreviations used are: ROS, reactive oxygen species; AP, apyrimidinic; 8-oxoG, 8-hydroxyguanine; Ogg1, 8-hydroxyguanine DNA glycosylase; hOgg1, human 8-hydroxyguanine DNA glycosylase; RT-PCR, reverse transcription-PCR; FBS, fetal bovine serum; BER, base excision repair; mtDNA, mitochondrial DNA; Tg, thymine glycol; NER, nucleotide excision repair. Back

Received 7/ 2/01. Accepted 12/28/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Landis S. H., Murray T., Bolden S., Wingo P. A. Cancer statistics, 1999. CA Cancer J. Clin., 49: 8-31, 1999.[Abstract/Free Full Text]
  2. Dizdaroglu M. Chemical determination of free radical-induced damage to DNA. Free Radic. Biol. Med., 10: 225-242, 1991.[Medline]
  3. Ide H., Kow Y. W., Wallace S. S. Thymine glycols and urea residues in M13 DNA constitute replicative blocks in vitro. Nucleic Acids Res., 13: 8035-8052, 1985.[Abstract/Free Full Text]
  4. Hatahet Z., Purmal A. A., Wallace S. S. Oxidative DNA lesions as blocks to in vitro transcription by phage T7 RNA polymerase. Ann. N. Y. Acad. Sci., 726: 346-348, 1994.[Medline]
  5. Grollman A. P., Moriya M. Mutagenesis by 8-oxoguanine: an enemy within. Trends Genet., 9: 246-249, 1993.[Medline]
  6. Gunther T., Schneider-Stock R., Rys J., Niezabitowski A., Roessner A. p53 gene mutations and expression of p53 and mdm2 proteins in invasive breast carcinoma. A comparative analysis with clinico-pathological factors. J. Cancer Res. Clin. Oncol., 123: 388-394, 1997.[Medline]
  7. Hollstein M., Shomer B., Greenblatt M., Soussi T., Hovig E., Montesano R., Harris C. C. Somatic point mutations in the p53 gene of human tumors and cell lines: updated compilation. Nucleic Acids Res., 24: 141-146, 1996.[Abstract/Free Full Text]
  8. Michaels M. L., Miller J. H. The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine). J. Bacteriol., 174: 6321-6325, 1992.[Free Full Text]
  9. Radicella J. P., Dherin C., Desmaze C., Fox M. S., Boiteux S. Cloning and characterization of hOGG1, a human homolog of the OGG1 gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA, 94: 8010-8015, 1997.[Abstract/Free Full Text]
  10. Rosenquist T. A., Zharkov D. O., Grollman A. P. Cloning and characterization of a mammalian 8-oxoguanine DNA glycosylase. Proc. Natl. Acad. Sci. USA, 94: 7429-7434, 1997.[Abstract/Free Full Text]
  11. Lu R., Nash H. M., Verdine G. L. A mammalian DNA repair enzyme that excises oxidatively damaged guanines maps to a locus frequently lost in lung cancer. Curr. Biol., 7: 397-407, 1997.[Medline]
  12. Thomas D., Scot A. D., Barbey R., Padula M., Boiteux S. Inactivation of OGG1 increases the incidence of G. C–>T. A transversions in Saccharomyces cerevisiae: evidence for endogenous oxidative damage to DNA in eukaryotic cells. Mol. Gen. Genet., 254: 171-178, 1997.[Medline]
  13. Tajiri T., Maki H., Sekiguchi M. Functional cooperation of MutT, MutM and MutY proteins in preventing mutations caused by spontaneous oxidation of guanine nucleotide in Escherichia coli. Mutat. Res., 336: 257-267, 1995.[Medline]
  14. Malins D. C., Haimanot R. Major alterations in the nucleotide structure of DNA in cancer of the female breast. Cancer Res., 51: 5430-5432, 1991.[Abstract/Free Full Text]
  15. Malins D. C., Holmes E. H., Polissar N. L., Gunselman S. J. The etiology of breast cancer. Characteristic alteration in hydroxyl radical-induced DNA base lesions during oncogenesis with potential for evaluating incidence risk. Cancer (Phila.), 71: 3036-3043, 1993.[Medline]
  16. Malins D. C. Identification of hydroxyl radical-induced lesions in DNA base structure: biomarkers with a putative link to cancer development. J. Toxicol. Environ. Health, 40: 247-261, 1993.[Medline]
  17. Dianov G., Bischoff C., Piotrowski J., Bohr V. A. Repair pathways for processing of 8-oxoguanine in DNA by mammalian cell extracts. J. Biol. Chem., 273: 33811-33816, 1998.[Abstract/Free Full Text]
  18. Kovacs E., Stucki D., Weber W., Muller H. Impaired DNA-repair synthesis in lymphocytes of breast cancer patients. Eur. J. Cancer Clin. Oncol., 22: 863-869, 1986.[Medline]
  19. Kovacs E., Almendral A. Reduced DNA repair synthesis in healthy women having first degree relatives with breast cancer. Eur. J. Cancer Clin. Oncol., 23: 1051-1057, 1987.[Medline]
  20. Parshad R., Price F. M., Bohr V. A., Cowans K. H., Zujewski J. A., Sanford K. K. Deficient DNA repair capacity, a predisposing factor in breast cancer. Br. J. Cancer, 74: 1-5, 1996.[Medline]
  21. Gowen L. C., Avrutskaya A. V., Latour A. M., Koller B. H., Leadon S. A. BRCA1 required for transcription-coupled repair of oxidative DNA damage. Science (Wash. DC), 281: 1009-1012, 1998.[Abstract/Free Full Text]
  22. Jackson A. L., Loeb L. A. The contribution of endogenous sources of DNA damage to the multiple mutations in cancer. Mutat. Res., 477: 7-21, 2001.[Medline]
  23. Kawanishi S., Hiraku Y., Oikawa S. Mechanism of guanine-specific DNA damage by oxidative stress and its role in carcinogenesis and aging. Mutat. Res., 488: 65-76, 2001.[Medline]
  24. Richter C., Park J. W., Ames B. N. Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl. Acad. Sci. USA, 85: 6465-6467, 1988.[Abstract/Free Full Text]
  25. Mecocci P., MacGarvey U., Kaufman A. E., Koontz D., Shoffner J. M., Wallace D. C., Beal M. F. Oxidative damage to mitochondrial DNA shows marked age-dependent increases in human brain. Ann. Neurol., 34: 609-616, 1993.[Medline]
  26. Shigenaga M. K., Hagen T. M., Ames B. N. Oxidative damage and mitochondrial decay in aging. Proc. Natl. Acad. Sci. USA, 91: 10771-10778, 1994.[Abstract/Free Full Text]
  27. Ames B. N., Shigenaga M. K., Hagen T. M. Oxidants, antioxidants, and the degenerative diseases of aging. Proc. Natl. Acad. Sci. USA, 90: 7915-7922, 1993.[Abstract/Free Full Text]
  28. Croteau D. L., ap Rhys C. M., Hudson E. K., Dianov G. L., Hansford R. G., Bohr V. A. An oxidative damage-specific endonuclease from rat liver mitochondria. J. Biol. Chem., 272: 27338-27344, 1997.[Abstract/Free Full Text]
  29. Croteau D. L., Bohr V. A. Repair of oxidative damage to nuclear and mitochondrial DNA in mammalian cells. J. Biol. Chem., 272: 25409-25412, 1997.[Free Full Text]
  30. Lin L. H., Cao S., Yu L., Cui J., Hamilton W. J., Liu P. K. Up-regulation of base excision repair activity for 8-hydroxy-2'-deoxyguanosine in the mouse brain after forebrain ischemia-reperfusion. J. Neurochem., 74: 1098-1105, 2000.[Medline]
  31. Dianov G. L., Thybo T., Dianova I. I., Lipinski L. J., Bohr V. A. Single nucleotide patch base excision repair is the major pathway for removal of thymine glycol from DNA in human cell extracts. J. Biol. Chem., 275: 11809-11813, 2000.[Abstract/Free Full Text]
  32. Higgins S. A., Frenkel K., Cummings A., Teebor G. W. Definitive characterization of human thymine glycol N-glycosylase activity. Biochemistry, 26: 1683-1688, 1987.[Medline]
  33. Hyun J. W., Choi J. Y., Zeng H. H., Lee Y. S., Kim H. S., Yoon S. H., Chung M. H. Leukemic cell line, KG-1 has a functional loss of hOGG1 enzyme due to a point mutation and 8-hydroxydeoxyguanosine can kill KG-1. Oncogene, 19: 4476-4479, 2000.[Medline]
  34. Dobson A. W., Xu Y., Kelley M. R., LeDoux S. P., Wilson G. L. Enhanced mitochondrial DNA repair and cellular survival after oxidative stress by targeting the human 8-oxoguanine glycosylase repair enzyme to mitochondria. J. Biol. Chem., 275: 37518-37523, 2000.[Abstract/Free Full Text]
  35. Polyak K., Li Y., Zhu H., Lengauer C., Willson J. K., Markowitz S. D., Trush M. A., Kinzler K. W., Vogelstein B. Somatic mutations of the mitochondrial genome in human colorectal tumours. Nat. Genet., 20: 291-293, 1998.[Medline]
  36. Parrella P., Xiao Y., Fliss M., Sanchez-Cespedes M., Mazzarelli P., Rinaldi M., Nicol T., Gabrielson E., Cuomo C., Cohen D., Pandit S., Spencer M., Rabitti C., Fazio V. M., Sidransky D. Detection of mitochondrial dna mutations in primary breast cancer and fine-needle aspirates. Cancer Res., 61: 7623-7626, 2001.[Abstract/Free Full Text]
  37. de Souza-Pinto N. C., Eide L., Hogue B. A., Thybo T., Stevnsner T., Seeberg E., Klungland A., Bohr V. A. Repair of 8-oxodeoxyguanosine lesions in mitochondrial dna depends on the oxoguanine dna glycosylase (OGG1) gene and 8-oxoguanine accumulates in the mitochondrial dna of OGG1-defective mice. Cancer Res., 61: 5378-5381, 2001.[Abstract/Free Full Text]
  38. Driggers W. J., Holmquist G. P., LeDoux S. P., Wilson G. L. Mapping frequencies of endogenous oxidative damage and the kinetic response to oxidative stress in a region of rat mtDNA. Nucleic Acids Res., 25: 4362-4369, 1997.[Abstract/Free Full Text]
  39. Taffe B. G., Larminat F., Laval J., Croteau D. L., Anson R. M., Bohr V. A. Gene-specific nuclear and mitochondrial repair of formamidopyrimidine DNA glycosylase-sensitive sites in Chinese hamster ovary cells. Mutat. Res., 364: 183-192, 1996.[Medline]
  40. Takao M., Aburatani H., Kobayashi K., Yasui A. Mitochondrial targeting of human DNA glycosylases for repair of oxidative DNA damage. Nucleic Acids Res., 26: 2917-2922, 1998.[Abstract/Free Full Text]
  41. Dherin C., Radicella J. P., Dizdaroglu M., Boiteux S. Excision of oxidatively damaged DNA bases by the human {alpha}-hOgg1 protein and the polymorphic {alpha}-hOgg1(Ser326Cys) protein which is frequently found in human populations. Nucleic Acids Res., 27: 4001-4007, 1999.[Abstract/Free Full Text]
  42. Kohno T., Shinmura K., Tosaka M., Tani M., Kim S. R., Sugimura H., Nohmi T., Kasai H., Yokota J. Genetic polymorphisms and alternative splicing of the hOGG1 gene, that is involved in the repair of 8-hydroxyguanine in damaged DNA. Oncogene, 16: 3219-3225, 1998.[Medline]
  43. Nishioka K., Ohtsubo T., Oda H., Fujiwara T., Kang D., Sugimachi K., Nakabeppu Y. Expression and differential intracellular localization of two major forms of human 8-oxoguanine DNA glycosylase encoded by alternatively spliced OGG1 mRNAs. Mol. Biol. Cell, 10: 1637-1652, 1999.[Abstract/Free Full Text]
  44. Monden Y., Arai T., Asano M., Ohtsuka E., Aburatani H., Nishimura S. Human MMH (OGG1) type 1a protein is a major enzyme for repair of 8-hydroxyguanine lesions in human cells. Biochem. Biophys. Res. Commun., 258: 605-610, 1999.[Medline]
  45. Shinmura K., Kohno T., Kasai H., Koda K., Sugimura H., Yokota J. Infrequent mutations of the hOGG1 gene, that is involved in the excision of 8-hydroxyguanine in damaged DNA, in human gastric cancer. Jpn. J. Cancer Res., 89: 825-828, 1998.[Medline]
  46. Hazra T. K., Izumi T., Maidt L., Floyd R. A., Mitra S. The presence of two distinct 8-oxoguanine repair enzymes in human cells: their potential complementary roles in preventing mutation. Nucleic Acids Res., 26: 5116-5122, 1998.[Abstract/Free Full Text]
  47. Chevillard S., Radicella J. P., Levalois C., Lebeau J., Poupon M. F., Oudard S., Dutrillaux B., Boiteux S. Mutations in OGG1, a gene involved in the repair of oxidative DNA damage, are found in human lung and kidney tumours. Oncogene, 16: 3083-3086, 1998.[Medline]
  48. Fortini P., Parlanti E., Sidorkina O. M., Laval J., Dogliotti E. The type of DNA glycosylase determines the base excision repair pathway in mammalian cells. J. Biol. Chem., 274: 15230-15236, 1999.[Abstract/Free Full Text]
  49. Dianov G., Bischoff C., Sunesen M., Bohr V. A. Repair of 8-oxoguanine in DNA is deficient in Cockayne syndrome group B cells. Nucleic Acids Res., 27: 1365-1368, 1999.[Abstract/Free Full Text]
  50. Cappelli E., Degan P., Frosina G. Comparative repair of the endogenous lesions 8-oxo-7, 8-dihydroguanine (8-oxoG), uracil and abasic site by mammalian cell extracts: 8-oxoG is poorly repaired by human cell extracts. Carcinogenesis (Lond.), 21: 1135-1141, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
S. Maynard, S. H. Schurman, C. Harboe, N. C. de Souza-Pinto, and V. A. Bohr
Base excision repair of oxidative DNA damage and association with cancer and aging
Carcinogenesis, January 1, 2009; 30(1): 2 - 10.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
C.-K. Youn, P. I. Song, M.-H. Kim, J. S. Kim, J.-W. Hyun, S.-J. Choi, S. P. Yoon, M. H. Chung, I.-Y. Chang, and H. J. You
Human 8-Oxoguanine DNA Glycosylase Suppresses the Oxidative Stress Induced Apoptosis through a p53-Mediated Signaling Pathway in Human Fibroblasts
Mol. Cancer Res., October 1, 2007; 5(10): 1083 - 1098.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. W. Hill and M. K. Evans
Dimerization and opposite base-dependent catalytic impairment of polymorphic S326C OGG1 glycosylase
Nucleic Acids Res., March 20, 2006; 34(5): 1620 - 1632.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. R. Trzeciak, S. G. Nyaga, P. Jaruga, A. Lohani, M. Dizdaroglu, and M. K. Evans
Cellular repair of oxidatively induced DNA base lesions is defective in prostate cancer cell lines, PC-3 and DU-145
Carcinogenesis, August 1, 2004; 25(8): 1359 - 1370.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Jensen, G. Calvayrac, B. Karahalil, V. A. Bohr, and T. Stevnsner
Mammalian 8-Oxoguanine DNA Glycosylase 1 Incises 8-Oxoadenine Opposite Cytosine in Nuclei and Mitochondria, while a Different Glycosylase Incises 8-Oxoadenine Opposite Guanine in Nuclei
J. Biol. Chem., May 23, 2003; 278(21): 19541 - 19548.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mambo, E.
Right arrow Articles by Evans, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mambo, E.
Right arrow Articles by Evans, M. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online