Cancer Research Meeting Calendar  Metabolism and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hensen, K.
Right arrow Articles by Voz, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hensen, K.
Right arrow Articles by Voz, M. L.
[Cancer Research 62, 1510-1517, March 1, 2002]
© 2002 American Association for Cancer Research


Molecular Biology and Genetics

The Tumorigenic Diversity of the Three PLAG Family Members Is Associated with Different DNA Binding Capacities1

Karen Hensen2, Isabelle C. C. Van Valckenborgh, Koen Kas, Wim J. M. Van de Ven and Marianne L. Voz3

Laboratory for Molecular Oncology, Center for Human Genetics (CME), University of Leuven (KUL) and Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat 49 B-3000 Leuven, Belgium


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pleomorphic adenoma gene (PLAG) 1, the main translocation target in pleomorphic adenomas of the salivary glands, is a member of a new subfamily of zinc finger proteins comprising the tumor suppressor candidate PLAG-like1 (also called ZAC1 or lost on transformation 1) and PLAGL2. In this report, we show that NIH3T3 cells overexpressing PLAG1 or PLAGL2 display the typical markers of neoplastic transformation: (a) the cells lose cell-cell contact inhibition; (b) show anchorage-independent growth; and (c) are able to induce tumors in nude mice. In contrast, PLAGL1 has been shown to prevent the proliferation of tumor cells by inducing cell cycle arrest and apoptosis. This difference in function is also reflected in their DNA binding, as we show here that the three PLAG proteins, although highly homologous in their DNA-binding domain, bind different DNA sequences in a distinct fashion. Interestingly, the PLAG1- and PLAGL2-induced transformation is accompanied by a drastic up-regulation of insulin-like growth factor-II, which we prove is a target of PLAG1 and PLAGL2. This strongly suggests that the oncogenic capacity of PLAG1 and PLAGL2 is mediated at least partly by activating the insulin-like growth factor-II mitogenic pathway.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pleomorphic adenoma of the salivary gland is a benign epithelial tumor, which usually arises as a result of activation of the PLAG14 gene on chromosome 8q12 (1) . In most cases, this activation results from recurrent chromosomal translocations that lead to promoter substitution between PLAG1, a gene mainly expressed in fetal tissue, and more broadly expressed genes. The three translocation partners characterized thus far are the ß-catenin gene (1) , the leukemia inhibitory factor receptor gene (2) , and the elongation factor SII gene (3) . Breakpoints invariably occur in the 5' noncoding part of the PLAG1 gene, leading to an exchange of regulatory control elements while preserving the PLAG1 coding sequence. The replacement of the PLAG1 promoter, which is inactive in adult salivary glands, by a strong promoter derived from the translocation partner, leads to ectopic expression of PLAG1 in the tumor cells. This abnormal PLAG1 expression presumably results in a deregulation of PLAG1 target genes, causing salivary gland tumorigenesis.

We demonstrated recently that PLAG1 is a genuine transcription factor that binds a bipartite element containing a Core sequence, GRGGC, and a G-cluster, RGGK, separated by seven random nucleotides. Potential PLAG1-binding sites were found in promoter 3 of the human IGF-II gene. Remarkably, IGF-II transcripts deriving from the P3 promoter are highly expressed in salivary gland adenomas overexpressing PLAG1, whereas they are not detectable in adenomas without abnormal PLAG1 expression or in normal salivary gland tissue. This suggests that IGF-II could be a PLAG1 target gene (4) .

Two novel cDNAs encoding C2H2 zinc finger proteins, PLAGL1 and PLAGL2, which show high homology to PLAG1, have been identified, constituting by this way a novel subfamily of zinc finger proteins (5) . PLAGL1 has also been isolated independently and referred to as LOT1 and ZAC1 (6 , 7) . The homology between these three PLAG proteins resides mainly in their NH2-terminal zinc finger domain (73% and 79% identity for PLAGL1 and PLAGL2, respectively), whereas the COOH-terminal region is much more divergent. Although PLAGL1 show high homology to PLAG1 in the DNA-binding domain, the DNA-binding specificities of these two proteins seem to differ slightly. Indeed the consensus binding site for PLAGL1 has been identified as the sequence GGGGGGCCCC (8) . This sequence contains the extended PLAG1 core GGRGGCC but does not include the G-Cluster 7 nucleotides downstream. A second difference between these two related factors is that PLAG1, when consistently overexpressed in pleomorphic adenomas, is thought to act as a proto-oncogene, whereas PLAGL1 seems to act as a tumor suppressor gene. Indeed, expression of PLAGL1 prevented proliferation of tumor cells as measured by colony formation, growth rate, and cloning in soft agar, and precluded tumor formation in nude mice (7 , 8) . Moreover it encodes a protein that regulates apoptosis and cell cycle arrest (7) , maps to a chromosomal region frequently lost in cancer (6) , and a decrease or loss of expression has been observed in breast tumors (9) .

To determine whether PLAG1 is a genuine proto-oncogene, we evaluated the in vitro transforming capacity of PLAG1 by analyzing the growth profile of NIH3T3 cells overexpressing PLAG1, their ability to form foci, to grow in soft agar, and to form tumors in nude mice. These analyses were extended to PLAGL2, the third member of the PLAG family. Both PLAG1 and PLAGL2 are able to transform NIH3T3 cells and, therefore, can be considered proto-oncogenes. Furthermore, by investigating the DNA binding specificities of the PLAG proteins and comparing their mode of DNA recognition, we demonstrate that PLAG1 and PLAGL2 have indistinguishable binding capacities, which are different from that of PLAGL1. Their similar binding capacities are reflected in their ability to induce common target genes; we prove here that IGF-II is a common target of PLAG1 and PLAGL2. Moreover, the transformation of NIH3T3 cells by these factors is accompanied by a drastic up-regulation of IgfII expression, suggesting that PLAG1 and PLAGL2 stimulate cell proliferation by activating the IGF-II mitogenic pathway.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Construction.
pCDNA3-FLAG-PLAG1 (=pKH26) was constructed by ligating in frame the MscI/XhoI fragment isolated from the pCDNA3-PLAG1 expression construct (4) into pCDNA3.1FLAG (a kind gift of Stefan Pype of the laboratory of Cell Growth, Differentiation and Development, KUL, VIB). This enables expression of a chimeric protein containing the FLAG epitope fused to amino acids 2–500 of PLAG1. The complete PLAGL2 ORF except the first ATG was amplified using pyrococcus furiosus (pfu) DNA polymerase (Stratagene) with the sense primer P3N2 (5'CCCGAATTCTGACCACATTTTTCACCAGCG3') and the antisense primer P3C496 (5'TTTCCATCAAGCATTCCAGTAGCTCGAG3'). The PCR product was cloned in frame into the pCDNA3.1FLAG vector (=pKH32). pMSCV-FLAG-PLAG1 and pMSCV-FLAG-PLAGL2 were constructed by cloning a blunt NheI/XbaI fragment of pKH26 or pKH32 into the HpaI site of the pMSCVpuro retroviral vector, respectively (kindly provided by Jan Cools, CME and KUL, and described by Ref. 10 ).

The PLAG1 expression construct pCDNA3-PLAG1 has been described elsewhere (4) . Expression plasmids pCDNA3-PLAGL1 and pCDNA3-PLAGL2 were constructed by inserting into EcoRI-XhoI digested pCDNA3 (Invitrogen) the complete ORFs of PLAGL1 or PLAGL2 including their own Kozak consensus translation start site. These fragments were generated by PCR using pfu polymerase (Stratagene) with the 5' primer P2N-3 (5'-CCCGAATTCGCAAAGCCCATGGCCACGTTC-3') and the 3' primer P2C463 (5'-GGGCTCGAGTTATCTGAATGCATGATGGAAATGAG-3') for PLAGL1 and with the 5' primer P3N-3 (5'-CCCGAATTCAGCCTTGCCATGACCACATTT-3') and the 3' primer P3C496 (5'-GGGCTCGAGCTACTGGAATGCTTGATGGAAA-3') for PLAGL2. The three mutant PLAG cDNAs (PLAG1-F3mut, PLAGL1-F3mut, and PLAGL2-F3mut) were produced by altering the first codon for the histidine in the C2H2 motif of the corresponding zinc finger to that for alanine. This was performed using the QuickChange Site-directed Mutagenesis kit (Stratagene) according to the instructions of the supplier. The pSAR-MT- FLAG-PLAG1 and pSAR-MT-FLAG-PLAGL2 constructs were generated by inserting the NheI/XbaI-blunted fragments of pKH26 and pKH32, respectively, into the blunted BamHI site of the pSAR-MT vector (11) . (WT2)3-TK-luc and (mCLUmCO2)3-TK-luc have been obtained by inserting three copies of the corresponding double-stranded oligonucleotides WT2 and mCOmCLU2 (4) into pTK81luc (12) . All of the constructs were sequenced to confirm the fidelity of the PCR and the site-specific mutagenesis.

Cell Lines.
The human fetal kidney epithelial cell line 293 (ATCC CRL 1573) was cultured according to the suppliers’ protocols. Inducible PLAG1-, PLAGL2-, and ß-gal-expressing cell lines were obtained by transfecting 293 cell line with 2 µg of pSAR-MT-FLAG-PLAG1, pSAR-MT-FLAG-PLAGL2 or pSAR-MT-ß-gal (11) , respectively, together with 400 ng of the neomycin resistance vector pCDNA3 using FuGENE 6 Transfection Reagent (Boehringer Mannheim) according to the manufacturer’s protocol. After 10 days, selection with G418 (Life Technologies, Inc.) at a concentration of 700 µg/ml, individual clones were isolated and expanded. Individual colonies were screened for zinc-inducible expression of PLAG1, PLAGL2, or ß-gal by Western blot analysis. Cells were induced with 100 µM of ZnCl2 for 16 h.

The pMSCV retroviral constructs were cotransfected with the pIK 6.1 Ecopac vector (kindly provided by Jan Cools, CME, KULeuven), coding for the gag, pol, and env viral proteins, in 293T cells using Superfect (Qiagen) according to the manufacturer’s protocol. After transfection (48 h), 1 ml of the supernatant containing replication-incompetent retroviruses was used to infect NIH3T3 cells (ATCC CRL1658). Cells expressing the gene of interest were obtained after 2 days culturing under puromycin selection.

Western Blot Analysis.
Cells were harvested in PBS/EDTA. The cell pellets were lysed in SDS-PAGE sample buffer [60 mM Tris-HCl (pH 6.8), 12% glycerol, and 4% SDS], and sonicated. Samples containing equal protein amounts were heated at 95°C for 5 min, and were electrophoresed in a 10% polyacrylamide gel and blotted onto nitrocellulose membranes. FLAG-tagged proteins were detected with a mouse anti-FLAG monoclonal antibody (SIGMA; 0.8 µg/ml) followed by a peroxidase-labeled rabbit {alpha}-mouse polyclonal antibody (PROSAN; DAKO; 0.4 µg/ml). Blots were revealed using the Renaissance detection kit (NEN Life Science Products) according to the supplier’s instructions.

Transfections and Luciferase Assay.
The puromycin-resistant cells, obtained after infection with recombinant retroviruses or empty pMSCV vectors, were plated in six-well plates. The next day, they were transiently cotransfected in triplicate with 400 ng of (WT2)3TKluc or (mCLUmCO2)3TKluc reporter plasmids together with the Rouse sarcoma virus ß-gal DNA as internal control using 3 µl of FuGENE 6 Transfection Reagent (Boehringer Mannheim) according to the manufacturer’s protocol. Cells were harvested 40 h after the transfection and luciferase activity measured using a Monolight 2010 luminometer (Analytical Luminescence Laboratory).

Preparation of RNA and Northern Blot Analysis.
Total RNA was extracted using the guanidine thiocyanate method (13) . Northern blot analysis was performed according to standard procedures. For filter hybridizations, probes were radiolabeled with {alpha}[32P]dCTP using the megaprime DNA labeling system (Amersham). A 1.5-kb cDNA probe containing the complete PLAG1 or PLAGL2 ORF was used for the detection of the respective transcripts. A probe containing exon 6 of the mouse IgfII, which is common to the different transcripts generated by the three different promoters, was generated by PCR using sense primer mIgfII-up (5'CAGATACCCCGTGGGCAAGTTCTTCCAATA3') and antisense primer mIgfII-low (5'TGAAGGGGGGGGGGCGCCGAATTATTTGA3'). The human IGF-II exon 9 probe, common to the four different transcripts P1, P2, P3, and P4, was generated by PCR and contained nucleotides 7970–8774 of the published gene sequence (Ref. 14 ; GenBank/European Molecular Biology Laboratory; accession no. X03562). A human IGF-II exon 5 probe specific for the P3 transcript was a kind gift of Dr. P. E. Holthuizen. The lacZ probe was generated by isolation of a 2.3-kb ClaI-EcoRI fragment from SDKlacZpA (Ref. 15 ; kindly given by Dr. J. Rossant).

EMSA.
The full-length PLAG proteins as well as the mutants were expressed by in vitro transcription and translation using the TNT kit (Promega). Quality of translation was monitored by SDS PAGE analysis of [35S]Met-labeled proteins. The EMSAs were performed as described previously (4) and 3 µl of translation reaction products were used per lane.

Focus Formation Assay.
Puromycin-resistant cells, obtained after infection with recombinant retroviruses, were plated at a density of 3 x 105 cells in a 60-mm tissue culture dish and grown in DMEM/F12 medium supplemented with 10% or 1% FCS and puromycin. Medium was changed every 2 or 3 days, and foci of densely growing cells appeared after 2–3 weeks. Some of the foci were cloned and grown to mass culture for RNA and protein analysis.

Cell Proliferation Assay.
Puromycin-resistant cells, obtained after infection with recombinant retroviruses, were plated at a density of 1 x 105 cells in a 60-mm tissue culture dish and cultured in of 5% or 1% FCS. Cells were counted every day for 10 days using a Coulter counter.

Soft Agar Assay.
Puromycin-resistant cells (1 x 105), obtained after infection with recombinant retroviruses, were resuspended in 2 ml 0.3% agar/DMEM/15%FCS and plated on a base of 0.6% agar/DMEM/15% FCS in six-well plates. After 5 days the cells were fed with a fresh agar overlay in DMEM containing 15% FCS. Colonies were counted 3 weeks after plating.

Tumorigenicity in Nude Mice.
Tumorigenicity was evaluated by injecting the puromycin-resistant cells, obtained after infection with recombinant retroviruses carrying pMSCV-FLAG-PLAG1, pMSCV-FLAG-PLAGL2, or empty pMSCV vectors (5 x 106 cells in 0.1 ml PBS) s.c. into both flanks of athymic nude mice. The mice were examined for tumor development once a week for 2 months. All of the tumors were clearly macroscopically visible within 3–4 weeks after inoculation. Mice were sacrificed after 5 weeks, and the tumors were excised for RNA extraction or histological analysis.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PLAGL1 Binds a Different Consensus Sequence than PLAG1 and PLAGL2.
To compare the DNA-binding specificities of the PLAG proteins, we performed EMSA analysis on double-strand probes containing either the PLAG1 consensus binding site (WT2 probe), the PLAGL1 consensus binding site (zac probe; Ref. 8 ), or on five mutated probes (see Fig. 1Citation ). The proteins used for this study were full-length PLAG proteins translated in vitro in reticulocyte lysates. As shown in a previous study (4) , we found that PLAG1 binds strongly to the PLAG1 consensus-binding motif (Fig. 1ACitation , Lane 1). Mutations in the G-cluster reduce drastically the binding (Fig. 1ACitation , Lane 2), whereas destruction of the Core abolishes it (Fig. 1ACitation , Lane 3) as do mutations in both (Fig. 1ACitation , Lane 4). The distance between the G-cluster and the Core was also shown to be important, as PLAG1 only binds weakly to a probe containing the G-cluster separated by 2 bp instead of 7 bp from the Core (Fig. 1ACitation , Lane 5). In contrast, the binding of PLAG1 to the zac probe (Fig. 1ACitation , Lane 6) is much less efficient than to the WT2 probe. A similar binding profile is observed with PLAGL2 (Fig. 1CCitation , Lanes 1–7) suggesting that PLAGL2 has binding capacities comparable with PLAG1. In contrast, PLAGL1 show different binding specificities, as it binds more efficiently to the zac probe than to the WT2 probe (compare Fig. 1BCitation , Lane 6 to Lane 1). Moreover, mutations in the cluster of WT2 only slightly affect PLAGL1 binding (Fig. 1BCitation , Lane 2), suggesting that a G-cluster is not critical for the binding of PLAGL1. This hypothesis is corroborated by the fact that the zac probe does not contain any G-cluster. Mutations in the core motif of the PLAG1 consensus, on the other hand, completely prevent the binding of PLAGL1 (Fig. 1BCitation , Lane 3) as well as mutations in the core of the zac probe. Comparable results were also obtained using chimeric proteins containing the complete zinc finger domain of PLAG proteins fused in-frame to glutathione S-transferase (data not shown). All of these results indicate that both motifs, the core and the G-cluster, are critical for PLAG1 and PLAGL2 binding, whereas only the core motif is recognized by PLAGL1.



View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. PLAGL1 binds a different consensus sequence to PLAG1 and PLAGL2. EMSAs were performed with recombinant PLAG proteins produced in vitro in reticulocyte lysates. PLAG proteins were incubated with the probes WT2 (Lanes 1 and 8), mCLU2 (Lanes 2 and 9), mCO2 (Lanes 3 and 10), mCLUmCO2 (Lanes 4 and 11), WT2m1 (Lanes 5 and 12), Zac (Lanes 6 and 13), and Zac mut (Lanes 7 and 14) as described in "Materials and Methods." Equal efficiencies of protein expression were obtained for the different constructs as demonstrated by SDS-PAGE of proteins labeled with [35S]methionine (data not shown). The percentage of binding of the PLAG proteins to the different probes were compared with the binding of the wild-type PLAG to the probe WT2 and are the means of at least two experiments. *, a band attributable to binding to the WT2 probe of a protein present in the reticulocyte lysate.

 
Fingers 3 of PLAG1 and PLAGL2 but not of PLAGL1 Are Critical for the DNA-binding Capacities.
We have shown recently that finger 3 of PLAG1 interacts with the G-cluster, whereas the core is recognized by fingers 6 and 7 (4) . As the G-cluster is critical for the binding of PLAG1 and PLAGL2 but not for PLAGL1, we were interested in determining whether finger 3 could play different roles in these three proteins. To answer this question, we produced mutant PLAG proteins where finger 3 was destroyed by replacing the first histidine of the C2H2 motif with an alanine. This mutation hinders the coordination of zinc and has been shown to prevent the formation of a functional zinc finger (16) . The destruction of finger 3 in PLAG1 and in PLAGL2 drastically reduces the affinity of these proteins for the WT2 probe (compare Lanes 8 with Lanes 1 in Fig. 1, A and CCitation ). The specificity is also completely modified because the F3mut protein binds equally well to WT2, mCLU2, and WT2m1 (Lanes 9, 10, and 12 in Fig. 1, A and CCitation ). Moreover, the F3mut binds preferentially to the zac probe compared with the WT2 probe (compare Lanes 13 and 8 in Fig. 1, A and CCitation ). These results indicate that, as for PLAG1, finger 3 of PLAGL2 is required for interaction with the G-cluster. On the contrary, destruction of finger 3 of PLAGL1 does not affect the binding specificity of this protein and only slightly decreases its affinity (compare Lanes 8-14 in Fig. 1BCitation with Lanes 1-7). This indicates that in contrast to PLAG1 and PLAGL2, finger 3 of PLAGL1 is not directly involved in DNA recognition.

NIH3T3 Cells Infected with Retrovirus-containing Human PLAG1 and PLAGL2 cDNAs Express High Levels of Functional Proteins.
To generate NIH3T3 cell lines overexpressing PLAG1 and PLAGL2, we infected the cells with the pMSCV retroviral vector encoding FLAG-tagged human PLAG1 or PLAGL2. Empty pMSCV vector was used as a negative control. Positive transformants were obtained by puromycin selection and checked for gene expression by Northern blot and Western blot analyses. As shown on Fig. 2ACitation , the exogenous PLAG1 and PLAGL2 messages expressed from the viral 5' long terminal repeat could be detected as a 4-kb transcript in infected cells (Fig. 2ACitation , Lanes 2 and 4, respectively) but not in mock infected control cells (Fig. 2ACitation , Lanes 1 and 3). These are clearly overexpressed compared with the endogenous transcripts. The endogenous PLAG1 transcript is visible as a 7.5-kb band (Fig. 2ACitation , Lanes 1 and 2), whereas the endogenous PLAGL2 transcript, which is also expected to be 7.5 kb, was undetectable (Fig. 2ACitation , Lanes 3 and 4), suggesting extremely low expression, if any, of endogenous PLAGL2. Western blot analysis was performed to detect the presence of PLAG1 and PLAGL2 recombinant proteins in infected NIH3T3 cells (Fig. 2B)Citation . A Mr 56,000 and a Mr 50,000 protein corresponding to PLAG1 (Fig. 2BCitation , Lane 1) and PLAGL2 (Fig. 2BCitation , Lane 3), respectively, were present in infected cells but absent in mock-infected control cells (Fig. 2BCitation , Lane 2). These proteins were shown to be functional, because PLAG1- and PLAGL2-overexpressing cells can stimulate the luciferase activity of a reporter construct containing three copies of the consensus binding site (WT2)3-TK luc (27- and 10-fold, respectively; Fig. 2CCitation ). This stimulation is completely abolished when the core and cluster are mutated (mCOmCLU). In contrary, mock-infected cells only slightly induced the (WT2)3-TK luc reporter construct (~2.5-fold). This induction is probably because of endogenous PLAG1 present in the NIH3T3 cells.



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. NIH3T3 cells infected with recombinant retrovirus containing human PLAG1 or PLAGL2 express high levels of functional protein. A, total RNA from NIH3T3 cells infected with control virus (Lanes 1 and 3), human Flag-PLAG1 retrovirus (Lane 2), and human Flag-PLAGL2 retrovirus (Lane 4) were hybridized with a 32P-labeled human PLAG1 cDNA (Lanes 1 and 2) or with a 32P-labeled human PLAGL2 cDNA (Lanes 3 and 4). Expression of ß-actin monitored the integrity and yield of RNA. B, Western blot analysis of whole cell lysates from NIH3T3 cells infected with Flag-PLAG1 retrovirus (Lane 1), control retrovirus (Lane 2), and Flag-PLAGL2 retrovirus (Lane 3) using an {alpha}-FLAG mouse monoclonal antibody. C, PLAG1 and PLAGL2 can stimulate transcription through the binding to the consensus sequence WT2. Mock-, PLAG1-, and PLAGL2-expressing NIH3T3 cells were transfected with 400 ng of the (mCOmCLU2)3 TK-luc reporter construct ({blacksquare}) and 400 ng of the (WT2)3TK-luc reporter construct (), respectively. Rous Sarcoma Viral promoter-ß-gal (200 ng) was cotransfected as internal control. The results correspond to the mean of the corrected luciferase value of at least two independent transfections performed in triplicate; bars, ±SE.

 
All of these data indicate that infected NIH3T3 cells produce high level of functional PLAG1 and PLAGL2 proteins. Moreover, it is the first demonstration that PLAGL2 is also a genuine transcription factor.

Mitogenic Stimulation of NIH3T3 Cells Overexpressing PLAG1 and PLAGL2.
Transformed cells, unlike normal cells, are able to proliferate in culture medium containing low levels of serum, because they have become independent of growth factors. To prove that PLAG1 and PLAGL2 are transforming factors, we investigated the growth of NIH3T3 cells overexpressing PLAG1 and PLAGL2 in low serum culture conditions. Fig. 3ACitation shows the growth curve of a population of cells grown in 5% FCS. The proliferation rate of cells overexpressing PLAG1 and PLAGL2 was significantly higher than mock-infected NIH3T3 cells (~3-fold for PLAG1- and 2.5 fold for PLAGL2-expressing cells). The effect was even more striking when cells were cultured in 1% FCS. PLAG1- and PLAGL2-expressing cells proliferate, whereas mock-infected NIH3T3 cells are unable to grow (Fig. 3B)Citation . The PLAG1-overexpressing cells consistently show higher growth rates than the PLAGL2-expressing cells. These data suggest that NIH3T3 cells overexpressing PLAG1 and PLAGL2 behave like transformed cells and lose dependence on growth factors present in FCS.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. The mitogenic stimulation of NIH3T3 cells overexpressing PLAG1 and PLAGL2. Mock-, PLAG1-, and PLAGL2-expressing NIH3T3 cells were grown in DMEM supplemented with either 5% (A) or 1% (B) FCS and counted daily. After 7 days, PLAG1- and PLAGL2-expressing cells reached a maximum cell density. The data correspond to the mean of three independent experiments; bars, ±SE.

 
Overexpressed PLAG1 and PLAGL2 Proteins Are Able to Transform NIH3T3 Cells.
To evaluate the transforming activity of PLAG1 and PLAGL2 when overexpressed, infected cells were grown as a monolayer to confluence in medium containing either 1% or 10% serum, and the formation of foci was analyzed (Fig. 4A)Citation . Contact inhibition of growth was lost leading the cells to pile up and form foci. Cells in the foci presented various morphologies, ranging from an elongated shape at the foci border to a rounded and refractile appearance in the center. PLAG1-expressing cells seemed to have a higher efficiency in forming foci than PLAGL2-expressing cells (Fig. 4A and B)Citation ; foci appeared sooner and became much bigger. Foci were more rapidly observed in cells grown in medium containing 1% serum. In contrast, mock-infected NIH3T3 cells in both FCS concentrations exhibited contact inhibition and formed no foci. To test if PLAG1- and PLAGL2-mediated effects on growth and transformation are dependent on their DNA binding activity, we made retroviral constructs of PLAG1 and PLAGL2 containing a mutation in finger 7 to destroy their binding to DNA (4) . NIH3T3 cells were infected with these retroviruses, and focus-forming assay was performed. Transformation of the NIH3T3 cells was almost completely abolished supporting the hypothesis that the transformation is caused by binding and subsequently activation of the target genes of PLAG1 and PLAGL2 (data not shown).



View larger version (142K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Overexpressed PLAG1 and PLAGL2 proteins are able to transform NIH3T3 cells. A, the mock-, PLAG1-, and PLAGL2-expressing NIH3T3 cells were used for focus-forming assay in medium containing 1% FCS or 10% FCS and for soft agar assay as described in "Materials and Methods." The photographs (x100 magnification) were taken on day 17 (focus assay) and day 25 (agar). B, table of the transforming properties of the NIH3T3 transfectants: the number of foci per 300 000 puromycin-resistant cells. Average of three dishes from two independent infection experiments from cells grown in 1% FCS (1) . Colonies have been counted 24 days after seeding and results are expressed as the ratio [(number of colonies formed/number of plated cells) x 100] (2) . The number of tumors per site of inoculation (3) .

 
The cell lines overexpressing PLAG1 and PLAGL2 were also tested for anchorage-independent growth, another tumorigenic feature. For this, cells were seeded in a soft agar suspension and colonies counted 3 weeks after growth. Colonies first appeared microscopically 10 days after seeding. Colonies of PLAG1-expressing cells remained small compared with colonies formed in PLAGL2-overexpressing cells where the cells were able to form colonies visible by the naked eye within 4 weeks of incubation (Fig. 4A)Citation . PLAGL2-expressing cells showed a colony-forming efficiency of 44%, whereas for PLAG1-expressing cells, 26% of seeded cells give rise to colonies (Fig. 4B)Citation . As expected, control cells failed to form such colonies. These results are summarized in Fig. 4BCitation .

PLAG1- and PLAGL2-expressing NIH3T3 Cells Are Tumorigenic in Nude Mice.
To determine whether the PLAG1- and PLAGL2-expressing NIH3T3 cells are tumorigenic in nude mice, cells were injected s.c. into athymic NMRI-nu/nu mice and examined every week for tumor development. PLAG1-overexpressing cells induced rapidly growing tumors at the site of inoculation within 3 weeks, whereas tumor formation originating from cells overexpressing PLAGL2 was apparent a few days later. The mock-infected cells did not form any tumors during this time period (Fig. 4B)Citation . The mice were sacrificed after 5 weeks, and histological analysis identified tumors induced by the PLAG1-expressing cell line as fibrosarcomas (data not shown). Metastatic spread to other organs was not detected macroscopically during the time period of observation, but formation of microscopic metastasis cannot be ruled out. To verify whether PLAG1 and PLAGL2 were still expressed in the tumor, Northern blot analysis was performed. High levels of retroviral PLAG1 and PLAGL2 transcripts could be detected indicating that the tumors produced in the nude mice originated from the injected cells (data not shown).

IGF-II Is Up-Regulated in Cells Overexpressing PLAG1 and PLAGL2.
As shown in this report, PLAG1 and PLAGL2 have common transcriptional properties, because they activate transcription via binding to the same DNA consensus sequence. These observations indicate that PLAG1 and PLAGL2 could be transcription factors that regulate common genes. Because IGF-II has been identified as a putative target gene of PLAG1, we analyzed IgfII expression in PLAG1- and PLAGL2-overexpressing NIH3T3 cells. As shown in Fig. 5Citation , a significant up-regulation of the major IgfII transcript was observed in cells overexpressing PLAG1 and PLAGL2 (Fig. 5Citation , Lanes b and c). In addition, two minor transcripts of 2.0 and 1.2 kb, not present in the control cells, were also detected in cells overexpressing PLAG1 and PLAGL2. Moreover, PLAGL2 induces IgfII expression in the same range as PLAG1. To exclude the possibility that IgfII up-regulation in transformed NIH3T3 cells could be a secondary effect occurring in the process of the transformation, we determined whether IGF-II constitutes a transcriptional target for PLAG1 and PLAGL2. For this purpose, we generated PLAG-inducible cell lines where IGF-II expression could be analyzed shortly after induction of PLAG1 and PLAGL2 expression. We isolated independent clones, deriving from the human epithelial kidney 293 cell line, containing a zinc-inducible expression vector (11) encoding either PLAG1 (clones P1–8 and P1–32), PLAGL2 (clones PL2–2 and PL2–24), or the lacZ gene (clones B-1 and B-4). When clones were grown in the absence of zinc ions, no exogenous PLAG1 or PLAGL2 could be detected, whereas only low level of ß-gal were detected. On induction with 100 µM of ZnCl2, PLAG1 and PLAGL2 transcripts are efficiently synthesized. This expression results in a drastic up-regulation of IGF-II expression (Fig. 6)Citation . This stimulation is specific, because it is not observed either with the ß-gal-expressing clones used as control or with the parental cell line. Furthermore, IGF-II up-regulation by PLAGL2 goes not via the induction of endogenous PLAG1 and vice versa, because no stimulation of endogenous PLAG1 and PLAGL2 transcript could be detected after zinc induction (data not shown). Moreover, the detected 6-kb IGF-II transcript corresponds to the one deriving from the P3 promoter, which is known to contain PLAG1-binding sites (4) , as hybridization with a probe specific for the P3 transcript (exon 5 probe) detects the same band (data not shown). All of these results demonstrate a strong correlation between PLAG1, PLAGL2, and IGF-II expression, suggesting that IGF-II is a target gene not only for PLAG1 but also for PLAGL2.



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. IgfII is up-regulated in NIH3T3 cells overexpressing PLAG1 and PLAGL2. Northern blot analysis of total RNA extracted from NIH3T3 cells infected with empty virus (a), human Flag-PLAG1 (b), and human Flag-PLAGL2 (c) grown in 10% FCS. The membrane was hybridized with a 32P-labeled mouse IgfII probe specific for exon 6, a 32P-labeled PLAG1 probe, or a 32P-labeled PLAGL2 probe. Expression of ß-actin transcript monitored the integrity and yield of RNA.

 


View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. IGF-II is a direct target of PLAG1 and PLAGL2. Northern blot analysis of total RNA isolated from clones, deriving from the human epithelial kidney 293 cell line, containing a zinc-inducible expression vector (11) either for PLAG1 (clones P1–8 and P1–32), PLAGL2 (clones PL2–2 and PL2–24), or the lacZ gene (clones B-1, B21, and B-4) grown without (-) or with (+) 100 µM of ZnCl2. Blots were hybridized sequentially with 32P-labeled human PLAG1 cDNA, 32P-labeled human PLAGL2 cDNA, 32P-labeled lacZ, 32P-labeled human IGF-II probe, and 32P-labeled human actin probe.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pleomorphic adenomas of the salivary glands are characterized by recurrent translocations that lead to promoter substitution between PLAG1, a gene mainly expressed in fetal tissue, and more broadly expressed genes. The replacement of the PLAG1 promoter, inactive in adult salivary glands, by a strong promoter derived from the translocation partner leads to ectopic expression of PLAG1 in tumoral cells (1) . The question remains whether ectopic expression of PLAG1 leads to the development of neoplasias, in this way acting as an oncogene. To approach this question, we determined the in vitro transforming capacity of PLAG1 in NIH3T3 cells. The transformation of NIH3T3 cells is a sensitive bioassay for the detection of transforming genes (17) . Since we also show here that PLAGL2 has indistinguishable DNA-binding capacities compared with PLAG1, we were interested to see if PLAGL2 has the same transforming effect in vitro. We found that cell lines producing high levels of PLAG1 or PLAGL2 are able to proliferate in medium containing only 1% serum suggesting that these genes partially abrogate the serum requirement for the growth of NIH3T3 cells. Moreover, these cells expressed the typical markers of neoplastic transformation; foci appeared within 2–3 weeks with a similar morphology to that described previously in transfection studies involving integrated c-ets1 DNA in NIH3T3 cells (18) . In addition, cells overexpressing PLAG1 and PLAGL2 show anchorage-independent growth and are able to induce tumors in nude mice. These observations allow us to define the PLAG1 and PLAGL2 family members as proto-oncogenes with mitogenic and transforming potential when overexpressed in NIH3T3 cells. On the contrary, the PLAGL1 family member has been shown to inhibit tumor cell proliferation through induction of both apoptosis and cell cycle arrest, in this way acting as a tumor suppressor gene (8) . These data together with our own indicate that the three members of the PLAG family are involved in cellular transformation in distinct ways.

The in vitro transformation data are consistent with the role of PLAG1 and PLAGL1 described in tumorigenesis. Indeed, PLAGL1 prevents the proliferation of tumor cells in vitro (8 , 19) , which correlates with the complete or partial loss of PLAGL1 expression observed in breast tumor cell lines and primary breast tumors harboring loss of chromosomal material in the 6q24–25 region. This suggests that lost of expression of PLAGL1 in premalignant epithelial cells can contribute to the initiation or progression of breast tumors (9) . For PLAG1, the in vitro data indicate that PLAG1 is able to induce cellular transformation when overexpressed. This correlates with in vivo data, because PLAG1 ectopic expression was observed not only in pleomorphic adenomas of the salivary gland but also in other kinds of tumors. Indeed, PLAG1 promoter swapping has been discovered recently to also be a critical event in lipoblastomas with 8q12 rearrangements (20) . Ectopic expression has also been found in other tumors such as uterine leiomyoma, leiomyosarcomas, and smooth muscle tumors, and in pleomorphic adenomas with 12q15 translocations and normal karyotype (3) . This emphasizes the importance of PLAG1 overexpression in tumorigenesis. Regarding PLAGL2, thus far we have no evidence for aberrant expression in any type of tumor. However, chromosome 20q11–12 aberrations, in the region where PLAGL2 is located, are a recurrent abnormality in malignant myeloid disorders. By screening the tumor databank of the Center for Human Genetics in Leuven, 20q11–12 translocations were found in patients who developed myeloid diseases. Fluorescence in situ hybridization analysis revealed that three patients present translocations in the PLAGL2 region. Additional investigations are still required to determine whether PLAGL2 overexpression could play a role in the development of this disease.

The mechanisms by which PLAG1 and perhaps PLAGL2 proteins induce tumorigenesis are not yet known. Because PLAG1 and PLAGL2 are genuine transcription factors, deregulation of PLAG expression possibly leads to deregulation of particular target genes involved in mitogenic stimulation, tissue remodeling, and vascularization associated with neoplasias. In this report we show that IgfII is not only up-regulated in NIH3T3 cells expressing PLAG1 and PLAGL2, but IGF-II expression is also immediately activated on PLAG1 and PLAGL2 expression by using PLAG1 and PLAGL2 zinc-inducible human 293 kidney cell lines. These results suggest that IGF-II is a target gene of PLAG1 and PLAGL2. IGF-II is a peptide fetal growth factor that plays an important role during embryonic development and carcinogenesis (21) . Interestingly, the pattern of expression of PLAG1 and IGF-II is similar because expression is high during fetal life and decreases drastically after birth (22 , 23) .5 These results link abnormal PLAG1 and PLAGL2 expression with the activation of the IGF-II mitogenic signaling, which is mainly mediated via the IGF-I-R. Activation of the IGF-I-R can increase mitogenesis, which is mediated primarily by activating the Ras/Raf/ mitogen-activated protein kinase pathway (24) . This provides an explanation for the ability of PLAG1 and PLAGL2 to stimulate neoplastic transformation. This hypothesis is supported by transformation studies performed on R- cells. R- cells are 3T3 cells derived from mouse embryos with a targeted disruption of the IGF-I-R genes (25 , 26) . Because the transforming effect of IGF-II is believed to be mainly mediated via this receptor, we were wondering if PLAG1 and PLAGL2 still could transform these R- cells. When focus-forming assay was performed on R- cells overexpressing PLAG1 or PLAGL2, cells could not form foci anymore (data not shown). We can now propose a model that ectopic expression of PLAG1 and PLAGL2 leads to the reactivation of IGF-II transcription, which results in a restarted developmental program with concomitant loss of differentiation, the typical hallmark of any tumor. This model is supported by immunohistochemistry on pleomorphic adenomas of the salivary gland. It revealed that the most differentiated cells of the inner tubuloductal epithelium only sporadically express PLAG1, whereas less differentiated cells of the outer tubuloductal epithelium in the tumor were strongly PLAG1 positive (27) . Moreover, undifferentiated cells in the tumor exhibited up-regulation of the antiapoptotic Bcl2 protein, a downstream element in the cascade of the antiapoptotic activity mediated via the IGF-I-R. Indeed, the transforming activity of the IGF-I-R depends on its potent antiapoptotic activity in addition to its mitogenic effect (28 , 29) . Additional investigations will be performed to analyze which level of the IGF system is influenced in PLAG1-mediated tumorigenesis.

As shown here, all of the three members of the PLAG family seem to be involved in tumorigenesis but in distinct ways. This difference in function is reflected in the DNA-binding capacity, because we found that the PLAG proteins display different binding characteristics. Indeed, PLAG1 and PLAGL2 bind to a bipartite motif containing a Core and the G-cluster, whereas PLAGL1 binds only to an extended Core motif (Fig. 7B)Citation . This difference can be explained by the fact that the finger 3 of PLAGL1 is not directly involved in DNA recognition, whereas in PLAG1 and PLAGL2, it interacts with the G-cluster. This difference in binding specificity is quite surprising, as the zinc finger domain of the three PLAG proteins is quite highly conserved (74% identity; Fig. 7ACitation ). The highest homology is found in fingers 6 and 7, responsible for binding to the Core motif. This can explain why these three proteins recognize a similar Core sequence (Fig. 7B)Citation . In contrast, fingers 2 to 5 shows much less conservation except in the key residues (highlighted in Fig. 7ACitation ). These residues typically make key base contacts that are responsible for defining sequence specificity (reviewed in Ref. 30 ). Finger 3, which is critical for the binding to the G-cluster, is surprisingly well conserved in PLAGL1, notably in the key residues (see Fig. 7ACitation ). This indicates that these key residues, although essential for binding, are not sufficient to determine specificity and that other amino acids also play a role.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Comparison of the zinc finger motifs in the three PLAG proteins. A, alignment of the seven zinc fingers motifs in PLAG1, PLAGL1, and PLAGL2. Only the amino acids different in PLAGL1 and PLAGL2 are indicated. The key residues (highlighted) are defined on the basis that each finger module folds to form a compact ßß{alpha} structure with the {alpha}-helix fitting in the major grove. (reviewed in Ref. 30 ). Residues -1, +2, +3 and +6 (numbering with respect to the start of the {alpha}-helix) typically make key base contacts that are responsible for defining sequence specificity. B, comparison of the DNA-binding consensus sequence of PLAG1 and PLAGL1. The consensus reported here for PLAG1 is not the minimal consensus GRGGC(N)7RGGK as described previously (4) but has been extended on both sides of the Core by the more frequent bases found in the CASTing experiments.

 
It is interesting to note that PLAG1 undergoes extensive alternative splicing, notably of exon 4, which contains the first ATG (31) . This will lead to different isoforms starting either at methionine 83 or methionine 100. This is assumed to have considerable consequences, because the isoform starting at position 100 does not contain finger 3 and, thus, does not recognize the G-cluster, giving rise to a splice form with different DNA binding specificity. This is reminiscent of the situation of the Wilms tumor 1 gene (32) and the PR-domain family genes (33) where the different isoforms have different DNA specificities and even opposing effects on tumorigenicity.

On the basis of our DNA-binding studies, we can also hypothesize that the difference in DNA-binding specificity described here could be one of the reasons PLAGL1 behaves as a tumor suppressor gene in contrast to the other two family members. PLAGL1 probably regulates a different set of target genes, which results in a different response. Regarding PLAG1 and PLAGL2, their similar binding capacities suggest that they regulate the expression of the same target genes, and IGF-II is the first example of such a common target gene. This discovery of IGF-II as a target in pleomorphic adenomas is an important step in the treatment of this disease, because we can envision that drugs designed to decrease the IGF-II levels in other types of tumors could be also used for the treatment of pleomorphic adenomas.


    ACKNOWLEDGMENTS
 
We thank Prof. Dr. B. Van Damme for the histological analysis of the tumors from the nude mice, Jan Cools from the CME KULeuven for providing the pMSCVpuro and pIK6.1 Ecopac vector and technical advice, N. Agten and M. Willems for the technical assistance, P. E. Holthuizen for her kind gift of the IGF-II exon5 probe, Dr. J. Rossant for her kind gift of the SDKlacZpA vector, Bert Vogelstein for the kind gift of the pSAR-MT-ßgal vector, and Dr. Renato Baserga from the Kimmel Cancer Center at the Thomas Jefferson University in Philadelphia, PA, for providing the R- cells. Additionally, we thank Neil Taylor for critical review of the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the "Geconcerteerde Onderzoekacties 1997–2001" and the "Fonds voor Wetenschappelijk Onderzoek Vlaanderen (FWO)." M. L. V. is a Chercheur Qualifié from the Fonds National de la Recherche Scientifique, I. C. C. V. V. is an aspirant fellow of the FWO, and K. H. is a doctoral fellow of the VIB. Back

2 To whom requests for reprints should be addressed, at Laboratory for Molecular Oncology, Center for Human Genetics, University of Leuven and Flanders Interuniversity Institute for Biotechnology, Herestraat 49 B-3000 Leuven, Belgium. Phone: 32-16-346082; Fax: 32-16-346073; E-mail: karen.hensen{at}med.kuleuven.ac.be. Back

3 Present address: Université de Liège, Laboratoire de Biologie Moléculaire et de Génie Génétique, Allée du XVI-août, Institut de Chimie, B6, B-4000 Sart-Tilman, Belgium. Back

4 The abbreviations used are: PLAG, pleomorphic adenoma gene; IGF, insulin-like growth factor; ORF, open reading frame; ß-gal, ß-galactosidase; EMSA, electrophoretic mobility shift analysis; IGF-I-R, type 1 insulin-like growth factor. Back

5 Hensen et al., unpublished observations. Back

Received 3/21/01. Accepted 12/28/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kas K., Voz M. L., Roijer E., Astrom A. K., Meyen E., Stenman G., Van de Ven W. J. Promoter swapping between the genes for a novel zinc finger protein and ß-catenin in pleiomorphic adenomas with t(3;8)(p21;q12) translocations. Nat. Genet., 15: 170-174, 1997.[Medline]
  2. Voz M. L., Astrom A. K., Kas K., Mark J., Stenman G., Van de Ven W. J. The recurrent translocation t(5;8)(p13;q12) in pleomorphic adenomas results in upregulation of PLAG1 gene expression under control of the LIFR promoter. Oncogene, 16: 1409-1416, 1998.[Medline]
  3. Astrom A. K., Voz M. L., Kas K., Roijer E., Wedell B., Mandahl N., Van de Ven W., Mark J., Stenman G. Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: identification of SII as a new fusion partner gene. Cancer Res., 59: 918-923, 1999.[Abstract/Free Full Text]
  4. Voz M. L., Agten N. S., Van de Ven W. J., Kas K. PLAG1, the main translocation target in pleomorphic adenoma of the salivary glands, is a positive regulator of IGF-II. Cancer Res., 60: 106-113, 2000.[Abstract/Free Full Text]
  5. Kas K., Voz M. L., Hensen K., Meyen E., Van de Ven W. J. M. Transcriptional activation capacity of the novel PLAG family of zinc finger proteins. J. Biol. Chem., 273: 23026-23032, 1998.[Abstract/Free Full Text]
  6. Abdollahi A., Roberts D., Godwin A. K., Schultz D. C., Sonoda G., Testa J. R., Hamilton T. C. Identification of a zinc-finger gene at 6q25: a chromosomal region implicated in development of many solid tumors. Oncogene, 14: 1973-1979, 1997.[Medline]
  7. Spengler D., Villalba M., Hoffmann A., Pantaloni C., Houssami S., Bockaert J., Journot L. Regulation of apoptosis and cell cycle arrest by Zac1, a novel zinc finger protein expressed in the pituitary gland and the brain. EMBO J., 16: 2814-2825, 1997.[Medline]
  8. Varrault A., Ciani E., Apiou F., Bilanges B., Hoffmann A., Pantaloni C., Bockaert J., Spengler D., Journot L. hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc. Natl. Acad. Sci. USA, 95: 8835-8840, 1998.[Abstract/Free Full Text]
  9. Bilanges B., Varrault A., Basyuk E., Rodriguez C., Mazumdar A., Pantaloni C., Bockaert J., Theillet C., Spengler D., Journot L. Loss of expression of the candidate tumor suppressor gene ZAC in breast cancer cell lines and primary tumors. Oncogene, 18: 3979-3988, 1999.[Medline]
  10. Hawley R. G., Lieu F. H., Fong A. Z., Hawley T. S. Versatile retroviral vectors for potential use in gene therapy. Gene Ther., 1: 136-138, 1994.[Medline]
  11. Morin P. J., Vogelstein B., Kinzler K. W. Apoptosis and APC in colorectal tumorigenesis. Proc. Natl. Acad. Sci. USA, 93: 7950-7954, 1996.[Abstract/Free Full Text]
  12. Nordeen S. K. Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques, 6: 454-458, 1988.[Medline]
  13. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
  14. Dull T. J., Gray A., Hayflick J. S., Ullrich A. Insulin-like growth factor II precursor gene organization in relation to insulin gene family. Nature (Lond.), 310: 777-781, 1984.[Medline]
  15. Sanchez M. P., Silos-Santiago I., Frisen J., He B., Lira S. A., Barbacid M. Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature (Lond.), 382: 70-73, 1996.[Medline]
  16. Ikeda K., Kawakami K. DNA binding through distinct domains of zinc-finger-homeodomain protein AREB6 has different effects on gene transcription. Eur. J. Biochem., 233: 73-82, 1995.[Medline]
  17. Jainchill J. L., Aaronson S. A., Todaro G. J. Murine sarcoma and leukemia viruses: assay using clonal lines of contact-inhibited mouse cells. J. Virol., 4: 549-553, 1969.[Abstract/Free Full Text]
  18. Seth A., Papas T. S. The c-ets-1 proto-oncogene has oncogenic activity and is positively autoregulated. Oncogene, 5: 1761-1767, 1990.[Medline]
  19. Abdollahi A., Bao R., Hamilton T. C. LOT1 is a growth suppressor gene down-regulated by the epidermal growth factor receptor ligands and encodes a nuclear zinc-finger protein. Oncogene, 18: 6477-6487, 1999.[Medline]
  20. Hibbard M. K., Kozakewich H. P., Dal Cin P., Sciot R., Tan X., Xiao S., Fletcher J. A. PLAG1 fusion oncogenes in lipoblastoma. Cancer Res., 60: 4869-4872, 2000.[Abstract/Free Full Text]
  21. Toretsky J. A., Helman L. J. Involvement of IGF-II in human cancer. J. Endocrinol., 149: 367-372, 1996.[Abstract/Free Full Text]
  22. Roberts C. T., Jr., Brown A. L., Graham D. E., Seelig S., Berry S., Gabbay K. H., Rechler M. M. Growth hormone regulates the abundance of insulin-like growth factor I RNA in adult rat liver. J. Biol. Chem., 261: 10025-10028, 1986.[Abstract/Free Full Text]
  23. Brown A. L., Graham D. E., Nissley S. P., Hill D. J., Strain A. J., Rechler M. M. Developmental regulation of insulin-like growth factor II mRNA in different rat tissues. J. Biol. Chem., 261: 13144-50, 1986.[Abstract/Free Full Text]
  24. LeRoith D., Werner H., Neuenschwander S., Kalebic T., Helman L. J. The role of the insulin-like growth factor-I receptor in cancer. Ann. N. Y. Acad. Sci., 766: 402-408, 1995.[Medline]
  25. Sell C., Dumenil G., Deveaud C., Miura M., Coppola D., DeAngelis T., Rubin R., Efstratiadis A., Baserga R. Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. Mol. Cell. Biol., 14: 3604-3612, 1994.[Abstract/Free Full Text]
  26. Sell C., Rubini M., Rubin R., Liu J. P., Efstratiadis A., Baserga R. Simian virus 40 large tumor antigen is unable to transform mouse embryonic fibroblasts lacking type 1 insulin-like growth factor receptor. Proc. Natl. Acad. Sci. USA, 90: 11217-11221, 1993.[Abstract/Free Full Text]
  27. Debiec-Rychter M., Van Valckenborgh I., Van Den Broeck C., Hagemeijer A., Van De Ven W. J., Kas K., Van Damme B., Voz M. L. Histologic localization of plag1 (pleomorphic adenoma gene 1) in pleomorphic adenoma of the salivary gland: cytogenetic evidence of common origin of phenotypically diverse cells. Lab. Investig., 81: 1289-1297, 2001.[Medline]
  28. Rodriguez-Tarduchy G., Collins M. K., Garcia I., Lopez-Rivas A. Insulin-like growth factor-I inhibits apoptosis in IL-3-dependent hemopoietic cells. J. Immunol., 149: 535-540, 1992.[Abstract]
  29. Resnicoff M., Burgaud J. L., Rotman H. L., Abraham D., Baserga R. Correlation between apoptosis, tumorigenesis, and levels of insulin-like growth factor I receptors. Cancer Res., 55: 3739-3741, 1995.[Abstract/Free Full Text]
  30. Choo Y., Klug A. Physical basis of a protein-DNA recognition code. Curr. Opin. Struct. Biol., 7: 117-125, 1997.[Medline]
  31. Queimado L., Lopes C., Du F., Martins C., Bowcock A. M., Soares J., Lovett M. Pleomorphic adenoma gene 1 is expressed in cultured benign and malignant salivary gland tumor cells. Lab. Investig., 79: 583-589, 1999.[Medline]
  32. Menke A. L., Riteco N., van Ham R. C., de Bruyne C., Rauscher F. J. d., van der Eb A. J., Jochemsen A. G. Wilms’ tumor 1 splice variants have opposite effects on the tumorigenicity of adenovirus-transformed baby-rat kidney cells. Oncogene, 12: 537-546, 1996.[Medline]
  33. Jiang G. L., Huang S. The yin-yang of PR-domain family genes in tumorigenesis. Histol. Histopathol., 15: 109-117, 2000.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. C. B. Ammons, D. W. Siemsen, L. K. Nelson-Overton, M. T. Quinn, and K. A. Gauss
Binding of Pleomorphic Adenoma Gene-like 2 to the Tumor Necrosis Factor (TNF)-{alpha}-responsive Region of the NCF2 Promoter Regulates p67phox Expression and NADPH Oxidase Activity
J. Biol. Chem., June 15, 2007; 282(24): 17941 - 17952.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Zheng and Y.-C. Yang
Sumoylation and Acetylation Play Opposite Roles in the Transactivation of PLAG1 and PLAGL2
J. Biol. Chem., December 9, 2005; 280(49): 40773 - 40781.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
Y. Lu, P.-Y. Liu, P. Xiao, and H.-W. Deng
Hotelling's T2 multivariate profiling for detecting differential expression in microarrays
Bioinformatics, July 15, 2005; 21(14): 3105 - 3113.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Declercq, F. Van Dyck, C. V. Braem, I. C. Van Valckenborgh, M. Voz, M. Wassef, L. Schoonjans, B. Van Damme, L. Fiette, and W. J.M. Van de Ven
Salivary Gland Tumors in Transgenic Mice with Targeted PLAG1 Proto-Oncogene Overexpression
Cancer Res., June 1, 2005; 65(11): 4544 - 4553.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. F. Landrette, Y.-H. Kuo, K. Hensen, S. B. van Waalwijk van Doorn-Khosrovani, P. N. Perrat, W. J. M. Van de Ven, R. Delwel, and L. H. Castilla
Plag1 and Plagl2 are oncogenes that induce acute myeloid leukemia in cooperation with Cbfb-MYH11
Blood, April 1, 2005; 105(7): 2900 - 2907.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M.-C. W. Yang, J. C. Weissler, L. S. Terada, F. Deng, and Y.-S. Yang
Pleiomorphic Adenoma Gene-Like-2, a Zinc Finger Protein, Transactivates the Surfactant Protein-C Promoter
Am. J. Respir. Cell Mol. Biol., January 1, 2005; 32(1): 35 - 43.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Van Dyck, E. L. D. Delvaux, W. J. M. Van de Ven, and M. V. Chavez
Repression of the Transactivating Capacity of the Oncoprotein PLAG1 by SUMOylation
J. Biol. Chem., August 20, 2004; 279(34): 36121 - 36131.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. H. Castilla, P. Perrat, N. J. Martinez, S. F. Landrette, R. Keys, S. Oikemus, J. Flanegan, S. Heilman, L. Garrett, A. Dutra, et al.
Identification of genes that synergize with Cbfb-MYH11 in the pathogenesis of acute myeloid leukemia
PNAS, April 6, 2004; 101(14): 4924 - 4929.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hensen, K.
Right arrow Articles by Voz, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hensen, K.
Right arrow Articles by Voz, M. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online