| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Laboratory for Molecular Oncology, Center for Human Genetics (CME), University of Leuven (KUL) and Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat 49 B-3000 Leuven, Belgium
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
We demonstrated recently that PLAG1 is a genuine transcription factor that binds a bipartite element containing a Core sequence, GRGGC, and a G-cluster, RGGK, separated by seven random nucleotides. Potential PLAG1-binding sites were found in promoter 3 of the human IGF-II gene. Remarkably, IGF-II transcripts deriving from the P3 promoter are highly expressed in salivary gland adenomas overexpressing PLAG1, whereas they are not detectable in adenomas without abnormal PLAG1 expression or in normal salivary gland tissue. This suggests that IGF-II could be a PLAG1 target gene (4) .
Two novel cDNAs encoding C2H2 zinc finger proteins, PLAGL1 and PLAGL2, which show high homology to PLAG1, have been identified, constituting by this way a novel subfamily of zinc finger proteins (5) . PLAGL1 has also been isolated independently and referred to as LOT1 and ZAC1 (6 , 7) . The homology between these three PLAG proteins resides mainly in their NH2-terminal zinc finger domain (73% and 79% identity for PLAGL1 and PLAGL2, respectively), whereas the COOH-terminal region is much more divergent. Although PLAGL1 show high homology to PLAG1 in the DNA-binding domain, the DNA-binding specificities of these two proteins seem to differ slightly. Indeed the consensus binding site for PLAGL1 has been identified as the sequence GGGGGGCCCC (8) . This sequence contains the extended PLAG1 core GGRGGCC but does not include the G-Cluster 7 nucleotides downstream. A second difference between these two related factors is that PLAG1, when consistently overexpressed in pleomorphic adenomas, is thought to act as a proto-oncogene, whereas PLAGL1 seems to act as a tumor suppressor gene. Indeed, expression of PLAGL1 prevented proliferation of tumor cells as measured by colony formation, growth rate, and cloning in soft agar, and precluded tumor formation in nude mice (7 , 8) . Moreover it encodes a protein that regulates apoptosis and cell cycle arrest (7) , maps to a chromosomal region frequently lost in cancer (6) , and a decrease or loss of expression has been observed in breast tumors (9) .
To determine whether PLAG1 is a genuine proto-oncogene, we evaluated the in vitro transforming capacity of PLAG1 by analyzing the growth profile of NIH3T3 cells overexpressing PLAG1, their ability to form foci, to grow in soft agar, and to form tumors in nude mice. These analyses were extended to PLAGL2, the third member of the PLAG family. Both PLAG1 and PLAGL2 are able to transform NIH3T3 cells and, therefore, can be considered proto-oncogenes. Furthermore, by investigating the DNA binding specificities of the PLAG proteins and comparing their mode of DNA recognition, we demonstrate that PLAG1 and PLAGL2 have indistinguishable binding capacities, which are different from that of PLAGL1. Their similar binding capacities are reflected in their ability to induce common target genes; we prove here that IGF-II is a common target of PLAG1 and PLAGL2. Moreover, the transformation of NIH3T3 cells by these factors is accompanied by a drastic up-regulation of IgfII expression, suggesting that PLAG1 and PLAGL2 stimulate cell proliferation by activating the IGF-II mitogenic pathway.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The PLAG1 expression construct pCDNA3-PLAG1 has been described elsewhere (4) . Expression plasmids pCDNA3-PLAGL1 and pCDNA3-PLAGL2 were constructed by inserting into EcoRI-XhoI digested pCDNA3 (Invitrogen) the complete ORFs of PLAGL1 or PLAGL2 including their own Kozak consensus translation start site. These fragments were generated by PCR using pfu polymerase (Stratagene) with the 5' primer P2N-3 (5'-CCCGAATTCGCAAAGCCCATGGCCACGTTC-3') and the 3' primer P2C463 (5'-GGGCTCGAGTTATCTGAATGCATGATGGAAATGAG-3') for PLAGL1 and with the 5' primer P3N-3 (5'-CCCGAATTCAGCCTTGCCATGACCACATTT-3') and the 3' primer P3C496 (5'-GGGCTCGAGCTACTGGAATGCTTGATGGAAA-3') for PLAGL2. The three mutant PLAG cDNAs (PLAG1-F3mut, PLAGL1-F3mut, and PLAGL2-F3mut) were produced by altering the first codon for the histidine in the C2H2 motif of the corresponding zinc finger to that for alanine. This was performed using the QuickChange Site-directed Mutagenesis kit (Stratagene) according to the instructions of the supplier. The pSAR-MT- FLAG-PLAG1 and pSAR-MT-FLAG-PLAGL2 constructs were generated by inserting the NheI/XbaI-blunted fragments of pKH26 and pKH32, respectively, into the blunted BamHI site of the pSAR-MT vector (11) . (WT2)3-TK-luc and (mCLUmCO2)3-TK-luc have been obtained by inserting three copies of the corresponding double-stranded oligonucleotides WT2 and mCOmCLU2 (4) into pTK81luc (12) . All of the constructs were sequenced to confirm the fidelity of the PCR and the site-specific mutagenesis.
Cell Lines.
The human fetal kidney epithelial cell line 293 (ATCC CRL 1573) was cultured according to the suppliers protocols. Inducible PLAG1-, PLAGL2-, and ß-gal-expressing cell lines were obtained by transfecting 293 cell line with 2 µg of pSAR-MT-FLAG-PLAG1, pSAR-MT-FLAG-PLAGL2 or pSAR-MT-ß-gal (11)
, respectively, together with 400 ng of the neomycin resistance vector pCDNA3 using FuGENE 6 Transfection Reagent (Boehringer Mannheim) according to the manufacturers protocol. After 10 days, selection with G418 (Life Technologies, Inc.) at a concentration of 700 µg/ml, individual clones were isolated and expanded. Individual colonies were screened for zinc-inducible expression of PLAG1, PLAGL2, or ß-gal by Western blot analysis. Cells were induced with 100 µM of ZnCl2 for 16 h.
The pMSCV retroviral constructs were cotransfected with the pIK 6.1 Ecopac vector (kindly provided by Jan Cools, CME, KULeuven), coding for the gag, pol, and env viral proteins, in 293T cells using Superfect (Qiagen) according to the manufacturers protocol. After transfection (48 h), 1 ml of the supernatant containing replication-incompetent retroviruses was used to infect NIH3T3 cells (ATCC CRL1658). Cells expressing the gene of interest were obtained after 2 days culturing under puromycin selection.
Western Blot Analysis.
Cells were harvested in PBS/EDTA. The cell pellets were lysed in SDS-PAGE sample buffer [60 mM Tris-HCl (pH 6.8), 12% glycerol, and 4% SDS], and sonicated. Samples containing equal protein amounts were heated at 95°C for 5 min, and were electrophoresed in a 10% polyacrylamide gel and blotted onto nitrocellulose membranes. FLAG-tagged proteins were detected with a mouse anti-FLAG monoclonal antibody (SIGMA; 0.8 µg/ml) followed by a peroxidase-labeled rabbit
-mouse polyclonal antibody (PROSAN; DAKO; 0.4 µg/ml). Blots were revealed using the Renaissance detection kit (NEN Life Science Products) according to the suppliers instructions.
Transfections and Luciferase Assay.
The puromycin-resistant cells, obtained after infection with recombinant retroviruses or empty pMSCV vectors, were plated in six-well plates. The next day, they were transiently cotransfected in triplicate with 400 ng of (WT2)3TKluc or (mCLUmCO2)3TKluc reporter plasmids together with the Rouse sarcoma virus ß-gal DNA as internal control using 3 µl of FuGENE 6 Transfection Reagent (Boehringer Mannheim) according to the manufacturers protocol. Cells were harvested 40 h after the transfection and luciferase activity measured using a Monolight 2010 luminometer (Analytical Luminescence Laboratory).
Preparation of RNA and Northern Blot Analysis.
Total RNA was extracted using the guanidine thiocyanate method (13)
. Northern blot analysis was performed according to standard procedures. For filter hybridizations, probes were radiolabeled with
[32P]dCTP using the megaprime DNA labeling system (Amersham). A 1.5-kb cDNA probe containing the complete PLAG1 or PLAGL2 ORF was used for the detection of the respective transcripts. A probe containing exon 6 of the mouse IgfII, which is common to the different transcripts generated by the three different promoters, was generated by PCR using sense primer mIgfII-up (5'CAGATACCCCGTGGGCAAGTTCTTCCAATA3') and antisense primer mIgfII-low (5'TGAAGGGGGGGGGGCGCCGAATTATTTGA3'). The human IGF-II exon 9 probe, common to the four different transcripts P1, P2, P3, and P4, was generated by PCR and contained nucleotides 79708774 of the published gene sequence (Ref. 14
; GenBank/European Molecular Biology Laboratory; accession no. X03562). A human IGF-II exon 5 probe specific for the P3 transcript was a kind gift of Dr. P. E. Holthuizen. The lacZ probe was generated by isolation of a 2.3-kb ClaI-EcoRI fragment from SDKlacZpA (Ref. 15
; kindly given by Dr. J. Rossant).
EMSA.
The full-length PLAG proteins as well as the mutants were expressed by in vitro transcription and translation using the TNT kit (Promega). Quality of translation was monitored by SDS PAGE analysis of [35S]Met-labeled proteins. The EMSAs were performed as described previously (4)
and 3 µl of translation reaction products were used per lane.
Focus Formation Assay.
Puromycin-resistant cells, obtained after infection with recombinant retroviruses, were plated at a density of 3 x 105 cells in a 60-mm tissue culture dish and grown in DMEM/F12 medium supplemented with 10% or 1% FCS and puromycin. Medium was changed every 2 or 3 days, and foci of densely growing cells appeared after 23 weeks. Some of the foci were cloned and grown to mass culture for RNA and protein analysis.
Cell Proliferation Assay.
Puromycin-resistant cells, obtained after infection with recombinant retroviruses, were plated at a density of 1 x 105 cells in a 60-mm tissue culture dish and cultured in of 5% or 1% FCS. Cells were counted every day for 10 days using a Coulter counter.
Soft Agar Assay.
Puromycin-resistant cells (1 x 105), obtained after infection with recombinant retroviruses, were resuspended in 2 ml 0.3% agar/DMEM/15%FCS and plated on a base of 0.6% agar/DMEM/15% FCS in six-well plates. After 5 days the cells were fed with a fresh agar overlay in DMEM containing 15% FCS. Colonies were counted 3 weeks after plating.
Tumorigenicity in Nude Mice.
Tumorigenicity was evaluated by injecting the puromycin-resistant cells, obtained after infection with recombinant retroviruses carrying pMSCV-FLAG-PLAG1, pMSCV-FLAG-PLAGL2, or empty pMSCV vectors (5 x 106 cells in 0.1 ml PBS) s.c. into both flanks of athymic nude mice. The mice were examined for tumor development once a week for 2 months. All of the tumors were clearly macroscopically visible within 34 weeks after inoculation. Mice were sacrificed after 5 weeks, and the tumors were excised for RNA extraction or histological analysis.
| RESULTS |
|---|
|
|
|---|
|
NIH3T3 Cells Infected with Retrovirus-containing Human PLAG1 and PLAGL2 cDNAs Express High Levels of Functional Proteins.
To generate NIH3T3 cell lines overexpressing PLAG1 and PLAGL2, we infected the cells with the pMSCV retroviral vector encoding FLAG-tagged human PLAG1 or PLAGL2. Empty pMSCV vector was used as a negative control. Positive transformants were obtained by puromycin selection and checked for gene expression by Northern blot and Western blot analyses. As shown on Fig. 2A
, the exogenous PLAG1 and PLAGL2 messages expressed from the viral 5' long terminal repeat could be detected as a 4-kb transcript in infected cells (Fig. 2A
, Lanes 2 and 4, respectively) but not in mock infected control cells (Fig. 2A
, Lanes 1 and 3). These are clearly overexpressed compared with the endogenous transcripts. The endogenous PLAG1 transcript is visible as a 7.5-kb band (Fig. 2A
, Lanes 1 and 2), whereas the endogenous PLAGL2 transcript, which is also expected to be 7.5 kb, was undetectable (Fig. 2A
, Lanes 3 and 4), suggesting extremely low expression, if any, of endogenous PLAGL2. Western blot analysis was performed to detect the presence of PLAG1 and PLAGL2 recombinant proteins in infected NIH3T3 cells (Fig. 2B)
. A Mr 56,000 and a Mr 50,000 protein corresponding to PLAG1 (Fig. 2B
, Lane 1) and PLAGL2 (Fig. 2B
, Lane 3), respectively, were present in infected cells but absent in mock-infected control cells (Fig. 2B
, Lane 2). These proteins were shown to be functional, because PLAG1- and PLAGL2-overexpressing cells can stimulate the luciferase activity of a reporter construct containing three copies of the consensus binding site (WT2)3-TK luc (27- and 10-fold, respectively; Fig. 2C
). This stimulation is completely abolished when the core and cluster are mutated (mCOmCLU). In contrary, mock-infected cells only slightly induced the (WT2)3-TK luc reporter construct (
2.5-fold). This induction is probably because of endogenous PLAG1 present in the NIH3T3 cells.
|
Mitogenic Stimulation of NIH3T3 Cells Overexpressing PLAG1 and PLAGL2.
Transformed cells, unlike normal cells, are able to proliferate in culture medium containing low levels of serum, because they have become independent of growth factors. To prove that PLAG1 and PLAGL2 are transforming factors, we investigated the growth of NIH3T3 cells overexpressing PLAG1 and PLAGL2 in low serum culture conditions. Fig. 3A
shows the growth curve of a population of cells grown in 5% FCS. The proliferation rate of cells overexpressing PLAG1 and PLAGL2 was significantly higher than mock-infected NIH3T3 cells (
3-fold for PLAG1- and 2.5 fold for PLAGL2-expressing cells). The effect was even more striking when cells were cultured in 1% FCS. PLAG1- and PLAGL2-expressing cells proliferate, whereas mock-infected NIH3T3 cells are unable to grow (Fig. 3B)
. The PLAG1-overexpressing cells consistently show higher growth rates than the PLAGL2-expressing cells. These data suggest that NIH3T3 cells overexpressing PLAG1 and PLAGL2 behave like transformed cells and lose dependence on growth factors present in FCS.
|
|
PLAG1- and PLAGL2-expressing NIH3T3 Cells Are Tumorigenic in Nude Mice.
To determine whether the PLAG1- and PLAGL2-expressing NIH3T3 cells are tumorigenic in nude mice, cells were injected s.c. into athymic NMRI-nu/nu mice and examined every week for tumor development. PLAG1-overexpressing cells induced rapidly growing tumors at the site of inoculation within 3 weeks, whereas tumor formation originating from cells overexpressing PLAGL2 was apparent a few days later. The mock-infected cells did not form any tumors during this time period (Fig. 4B)
. The mice were sacrificed after 5 weeks, and histological analysis identified tumors induced by the PLAG1-expressing cell line as fibrosarcomas (data not shown). Metastatic spread to other organs was not detected macroscopically during the time period of observation, but formation of microscopic metastasis cannot be ruled out. To verify whether PLAG1 and PLAGL2 were still expressed in the tumor, Northern blot analysis was performed. High levels of retroviral PLAG1 and PLAGL2 transcripts could be detected indicating that the tumors produced in the nude mice originated from the injected cells (data not shown).
IGF-II Is Up-Regulated in Cells Overexpressing PLAG1 and PLAGL2.
As shown in this report, PLAG1 and PLAGL2 have common transcriptional properties, because they activate transcription via binding to the same DNA consensus sequence. These observations indicate that PLAG1 and PLAGL2 could be transcription factors that regulate common genes. Because IGF-II has been identified as a putative target gene of PLAG1, we analyzed IgfII expression in PLAG1- and PLAGL2-overexpressing NIH3T3 cells. As shown in Fig. 5
, a significant up-regulation of the major IgfII transcript was observed in cells overexpressing PLAG1 and PLAGL2 (Fig. 5
, Lanes b and c). In addition, two minor transcripts of 2.0 and 1.2 kb, not present in the control cells, were also detected in cells overexpressing PLAG1 and PLAGL2. Moreover, PLAGL2 induces IgfII expression in the same range as PLAG1. To exclude the possibility that IgfII up-regulation in transformed NIH3T3 cells could be a secondary effect occurring in the process of the transformation, we determined whether IGF-II constitutes a transcriptional target for PLAG1 and PLAGL2. For this purpose, we generated PLAG-inducible cell lines where IGF-II expression could be analyzed shortly after induction of PLAG1 and PLAGL2 expression. We isolated independent clones, deriving from the human epithelial kidney 293 cell line, containing a zinc-inducible expression vector (11)
encoding either PLAG1 (clones P18 and P132), PLAGL2 (clones PL22 and PL224), or the lacZ gene (clones B-1 and B-4). When clones were grown in the absence of zinc ions, no exogenous PLAG1 or PLAGL2 could be detected, whereas only low level of ß-gal were detected. On induction with 100 µM of ZnCl2, PLAG1 and PLAGL2 transcripts are efficiently synthesized. This expression results in a drastic up-regulation of IGF-II expression (Fig. 6)
. This stimulation is specific, because it is not observed either with the ß-gal-expressing clones used as control or with the parental cell line. Furthermore, IGF-II up-regulation by PLAGL2 goes not via the induction of endogenous PLAG1 and vice versa, because no stimulation of endogenous PLAG1 and PLAGL2 transcript could be detected after zinc induction (data not shown). Moreover, the detected 6-kb IGF-II transcript corresponds to the one deriving from the P3 promoter, which is known to contain PLAG1-binding sites (4)
, as hybridization with a probe specific for the P3 transcript (exon 5 probe) detects the same band (data not shown). All of these results demonstrate a strong correlation between PLAG1, PLAGL2, and IGF-II expression, suggesting that IGF-II is a target gene not only for PLAG1 but also for PLAGL2.
|
|
| DISCUSSION |
|---|
|
|
|---|
The in vitro transformation data are consistent with the role of PLAG1 and PLAGL1 described in tumorigenesis. Indeed, PLAGL1 prevents the proliferation of tumor cells in vitro (8 , 19) , which correlates with the complete or partial loss of PLAGL1 expression observed in breast tumor cell lines and primary breast tumors harboring loss of chromosomal material in the 6q2425 region. This suggests that lost of expression of PLAGL1 in premalignant epithelial cells can contribute to the initiation or progression of breast tumors (9) . For PLAG1, the in vitro data indicate that PLAG1 is able to induce cellular transformation when overexpressed. This correlates with in vivo data, because PLAG1 ectopic expression was observed not only in pleomorphic adenomas of the salivary gland but also in other kinds of tumors. Indeed, PLAG1 promoter swapping has been discovered recently to also be a critical event in lipoblastomas with 8q12 rearrangements (20) . Ectopic expression has also been found in other tumors such as uterine leiomyoma, leiomyosarcomas, and smooth muscle tumors, and in pleomorphic adenomas with 12q15 translocations and normal karyotype (3) . This emphasizes the importance of PLAG1 overexpression in tumorigenesis. Regarding PLAGL2, thus far we have no evidence for aberrant expression in any type of tumor. However, chromosome 20q1112 aberrations, in the region where PLAGL2 is located, are a recurrent abnormality in malignant myeloid disorders. By screening the tumor databank of the Center for Human Genetics in Leuven, 20q1112 translocations were found in patients who developed myeloid diseases. Fluorescence in situ hybridization analysis revealed that three patients present translocations in the PLAGL2 region. Additional investigations are still required to determine whether PLAGL2 overexpression could play a role in the development of this disease.
The mechanisms by which PLAG1 and perhaps PLAGL2 proteins induce tumorigenesis are not yet known. Because PLAG1 and PLAGL2 are genuine transcription factors, deregulation of PLAG expression possibly leads to deregulation of particular target genes involved in mitogenic stimulation, tissue remodeling, and vascularization associated with neoplasias. In this report we show that IgfII is not only up-regulated in NIH3T3 cells expressing PLAG1 and PLAGL2, but IGF-II expression is also immediately activated on PLAG1 and PLAGL2 expression by using PLAG1 and PLAGL2 zinc-inducible human 293 kidney cell lines. These results suggest that IGF-II is a target gene of PLAG1 and PLAGL2. IGF-II is a peptide fetal growth factor that plays an important role during embryonic development and carcinogenesis (21) . Interestingly, the pattern of expression of PLAG1 and IGF-II is similar because expression is high during fetal life and decreases drastically after birth (22 , 23) .5 These results link abnormal PLAG1 and PLAGL2 expression with the activation of the IGF-II mitogenic signaling, which is mainly mediated via the IGF-I-R. Activation of the IGF-I-R can increase mitogenesis, which is mediated primarily by activating the Ras/Raf/ mitogen-activated protein kinase pathway (24) . This provides an explanation for the ability of PLAG1 and PLAGL2 to stimulate neoplastic transformation. This hypothesis is supported by transformation studies performed on R- cells. R- cells are 3T3 cells derived from mouse embryos with a targeted disruption of the IGF-I-R genes (25 , 26) . Because the transforming effect of IGF-II is believed to be mainly mediated via this receptor, we were wondering if PLAG1 and PLAGL2 still could transform these R- cells. When focus-forming assay was performed on R- cells overexpressing PLAG1 or PLAGL2, cells could not form foci anymore (data not shown). We can now propose a model that ectopic expression of PLAG1 and PLAGL2 leads to the reactivation of IGF-II transcription, which results in a restarted developmental program with concomitant loss of differentiation, the typical hallmark of any tumor. This model is supported by immunohistochemistry on pleomorphic adenomas of the salivary gland. It revealed that the most differentiated cells of the inner tubuloductal epithelium only sporadically express PLAG1, whereas less differentiated cells of the outer tubuloductal epithelium in the tumor were strongly PLAG1 positive (27) . Moreover, undifferentiated cells in the tumor exhibited up-regulation of the antiapoptotic Bcl2 protein, a downstream element in the cascade of the antiapoptotic activity mediated via the IGF-I-R. Indeed, the transforming activity of the IGF-I-R depends on its potent antiapoptotic activity in addition to its mitogenic effect (28 , 29) . Additional investigations will be performed to analyze which level of the IGF system is influenced in PLAG1-mediated tumorigenesis.
As shown here, all of the three members of the PLAG family seem to be involved in tumorigenesis but in distinct ways. This difference in function is reflected in the DNA-binding capacity, because we found that the PLAG proteins display different binding characteristics. Indeed, PLAG1 and PLAGL2 bind to a bipartite motif containing a Core and the G-cluster, whereas PLAGL1 binds only to an extended Core motif (Fig. 7B)
. This difference can be explained by the fact that the finger 3 of PLAGL1 is not directly involved in DNA recognition, whereas in PLAG1 and PLAGL2, it interacts with the G-cluster. This difference in binding specificity is quite surprising, as the zinc finger domain of the three PLAG proteins is quite highly conserved (74% identity; Fig. 7A
). The highest homology is found in fingers 6 and 7, responsible for binding to the Core motif. This can explain why these three proteins recognize a similar Core sequence (Fig. 7B)
. In contrast, fingers 2 to 5 shows much less conservation except in the key residues (highlighted in Fig. 7A
). These residues typically make key base contacts that are responsible for defining sequence specificity (reviewed in Ref. 30
). Finger 3, which is critical for the binding to the G-cluster, is surprisingly well conserved in PLAGL1, notably in the key residues (see Fig. 7A
). This indicates that these key residues, although essential for binding, are not sufficient to determine specificity and that other amino acids also play a role.
|
On the basis of our DNA-binding studies, we can also hypothesize that the difference in DNA-binding specificity described here could be one of the reasons PLAGL1 behaves as a tumor suppressor gene in contrast to the other two family members. PLAGL1 probably regulates a different set of target genes, which results in a different response. Regarding PLAG1 and PLAGL2, their similar binding capacities suggest that they regulate the expression of the same target genes, and IGF-II is the first example of such a common target gene. This discovery of IGF-II as a target in pleomorphic adenomas is an important step in the treatment of this disease, because we can envision that drugs designed to decrease the IGF-II levels in other types of tumors could be also used for the treatment of pleomorphic adenomas.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by the "Geconcerteerde Onderzoekacties 19972001" and the "Fonds voor Wetenschappelijk Onderzoek Vlaanderen (FWO)." M. L. V. is a Chercheur Qualifié from the Fonds National de la Recherche Scientifique, I. C. C. V. V. is an aspirant fellow of the FWO, and K. H. is a doctoral fellow of the VIB. ![]()
2 To whom requests for reprints should be addressed, at Laboratory for Molecular Oncology, Center for Human Genetics, University of Leuven and Flanders Interuniversity Institute for Biotechnology, Herestraat 49 B-3000 Leuven, Belgium. Phone: 32-16-346082; Fax: 32-16-346073; E-mail: karen.hensen{at}med.kuleuven.ac.be. ![]()
3 Present address: Université de Liège, Laboratoire de Biologie Moléculaire et de Génie Génétique, Allée du XVI-août, Institut de Chimie, B6, B-4000 Sart-Tilman, Belgium. ![]()
4 The abbreviations used are: PLAG, pleomorphic adenoma gene; IGF, insulin-like growth factor; ORF, open reading frame; ß-gal, ß-galactosidase; EMSA, electrophoretic mobility shift analysis; IGF-I-R, type 1 insulin-like growth factor. ![]()
5 Hensen et al., unpublished observations. ![]()
Received 3/21/01. Accepted 12/28/01.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. C. B. Ammons, D. W. Siemsen, L. K. Nelson-Overton, M. T. Quinn, and K. A. Gauss Binding of Pleomorphic Adenoma Gene-like 2 to the Tumor Necrosis Factor (TNF)-{alpha}-responsive Region of the NCF2 Promoter Regulates p67phox Expression and NADPH Oxidase Activity J. Biol. Chem., June 15, 2007; 282(24): 17941 - 17952. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zheng and Y.-C. Yang Sumoylation and Acetylation Play Opposite Roles in the Transactivation of PLAG1 and PLAGL2 J. Biol. Chem., December 9, 2005; 280(49): 40773 - 40781. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lu, P.-Y. Liu, P. Xiao, and H.-W. Deng Hotelling's T2 multivariate profiling for detecting differential expression in microarrays Bioinformatics, July 15, 2005; 21(14): 3105 - 3113. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Declercq, F. Van Dyck, C. V. Braem, I. C. Van Valckenborgh, M. Voz, M. Wassef, L. Schoonjans, B. Van Damme, L. Fiette, and W. J.M. Van de Ven Salivary Gland Tumors in Transgenic Mice with Targeted PLAG1 Proto-Oncogene Overexpression Cancer Res., June 1, 2005; 65(11): 4544 - 4553. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Landrette, Y.-H. Kuo, K. Hensen, S. B. van Waalwijk van Doorn-Khosrovani, P. N. Perrat, W. J. M. Van de Ven, R. Delwel, and L. H. Castilla Plag1 and Plagl2 are oncogenes that induce acute myeloid leukemia in cooperation with Cbfb-MYH11 Blood, April 1, 2005; 105(7): 2900 - 2907. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. W. Yang, J. C. Weissler, L. S. Terada, F. Deng, and Y.-S. Yang Pleiomorphic Adenoma Gene-Like-2, a Zinc Finger Protein, Transactivates the Surfactant Protein-C Promoter Am. J. Respir. Cell Mol. Biol., January 1, 2005; 32(1): 35 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Van Dyck, E. L. D. Delvaux, W. J. M. Van de Ven, and M. V. Chavez Repression of the Transactivating Capacity of the Oncoprotein PLAG1 by SUMOylation J. Biol. Chem., August 20, 2004; 279(34): 36121 - 36131. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Castilla, P. Perrat, N. J. Martinez, S. F. Landrette, R. Keys, S. Oikemus, J. Flanegan, S. Heilman, L. Garrett, A. Dutra, et al. Identification of genes that synergize with Cbfb-MYH11 in the pathogenesis of acute myeloid leukemia PNAS, April 6, 2004; 101(14): 4924 - 4929. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |