Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium AACR Conference on Molecular Diagnostics - 2008
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Z.
Right arrow Articles by Dairkee, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Z.
Right arrow Articles by Dairkee, S. H.
[Cancer Research 62, 1939-1943, April 1, 2002]
© 2002 American Association for Cancer Research

Advances in Brief

Biallelic Inactivation of the Thyroid Hormone Receptor ß1 Gene in Early Stage Breast Cancer1

Zheng Li, Zhen Hang Meng, Raman Chandrasekaran, Wen-Lin Kuo, Colin C. Collins, Joe W. Gray and Shanaz H. Dairkee2

Geraldine Brush Cancer Research Institute, California Pacific Medical Center [Z. L., Z. H. M., R. C., S. H. D.], and University of California, San Francisco Comprehensive Cancer Center [W-L. K., C. C. C., J. W. G.], San Francisco, California 94115


   ABSTRACT
Top
 ABSTRACT
Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Loss of heterozygosity within the short arm of chromosome 3 is a common molecular event in several types of solid tumors. In breast cancer, 3p loss of heterozygosity occurs in invasive tumor cells as well as in morphologically normal terminal ductal lobular units adjacent to carcinoma in some cases [G. Deng et al., Science (Wash. DC), 274: 2057–2059, 1996.]. The most frequent region of allelic loss at 3p24.3 in morphologically normal terminal ductal lobular units encompasses the thyroid hormone receptor ß1 (TRß1) gene. Here we have observed a variable degree of TRß1 promoter hypermethylation in all 11 cases of primary breast cancer examined. Moreover, hypermethylation occurred at the same CpG sites in nonmalignant tissue peripheral to carcinoma in 4 of 11 cases. The lack of TRß1 nuclear staining, a likely result of biallelic gene inactivation, was observed in 25% (22 of 85) of primary tumors. This is a first demonstration of promoter hypermethylation and a concurrent reduction of TRß1 transcripts in breast cancer cell lines, although specific CpG sites targeted for gene silencing remain to be determined. Gene expression was restored by treatment with 5-aza-deoxycytidine in such cases. The observation of early, frequent, and multiple mechanisms of TRß1 inactivation suggests a potential role for this gene in the suppression of breast tumorigenesis.


   Introduction
Top
 ABSTRACT
 Introduction
Materials and Methods
 Results
 Discussion
 REFERENCES
 
Thyroid hormone receptors are ligand-mediated transcription factors, which form complexes with other nuclear receptors and multiple effector proteins to regulate growth, differentiation, and development (1) . Loss of gene function associated with v erb A, a mutated variant of thyroid hormone receptor {alpha} (2) arrests normal differentiation of avian erythroblast progenitors resulting in virally induced leukemic transformation (3) . Deletions encompassing TRß3 are suspected to play a role in the genesis of small cell lung cancer (4) . In breast cancer, LOH is a common occurrence at chromosome 3p in the general vicinity of the TRß1 gene (5 , 6) . Most notably, LOH encompassing the TRß1 gene occurs before the manifestation of morphological changes in TDLUs of cancerous breast tissue (7 , 8) . We demonstrate here that epigenetic changes in the promoter region of TRß1 are also involved in the inactivation of this gene in breast cancer cell lines and possibly in early stage breast tumors.


   Materials and Methods
Top
 ABSTRACT
 Introduction
 Materials and Methods
Results
 Discussion
 REFERENCES
 
RT-PCR Analysis.
Established breast cancer cell lines and second passage normal mammary epithelial cells isolated from reduction mammoplasty tissue were propagated under routine culture conditions. Total cellular RNA was isolated from cells in the logarithmic growth phase using the RNeasy Mini kit (Qiagen). Up to 2 µg of total RNA was reverse transcribed using Superscript II RT RNase H- Reverse Transcriptase (Life Technologies, Inc.) and random hexamers (Operon, Inc.) in a reaction volume of 50 µl. In subsequent PCR reactions, 2 µl of cDNA were amplified. To normalize the relative amount of the cDNA synthesized for each test transcript, GAPDH was used as an internal competitive control within the same PCR reaction as the genes of interest. Gels were scanned, and the ratio of test gene:GAPDH was determined using ImageQuant (Molecular Dynamics). The PCR conditions were as follows: 94°C for 4 min 30 s to 30–35 PCR cycles at 94°C, 15 s; 58–61°C, 15 s; 72°C, 30 s; and a final 5 min extension at 72°C. PCR products were resolved in 2.0% agarose gel stained with ethidium bromide. Primer sequences were as follows:

GAPDH-F; TGATGACATCAAGAAGGTGGTGAA;

GAPDH-R: TCCTTGGAGGCCATGTGGGCCAT; (250 bp product)

TRß1-F: GAACAGTCGTCGCCACATCTC;

TRß1-R: TGAGCTCCCATTCCTCGTC; (500 bp product)

RARß2-F: AGAGTTTGATGGAGTTGGGTGGAC; and

RARß2-R: GCTGGCAGAGTGAAGGGAAAGTTT (721 bp product).

For restoration of TRß1 expression, cell lines were incubated with medium supplemented with 1 µM 5-aza-2-deoxycytidine for 5 days.

FISH, LOH, and Immunoperoxidase Analysis.
For FISH, nuclear signals generated from two color hybridization of FITC-conjugated chromosome 3 centromere probe and Cy3-conjugated TRß1 probe (prepared and validated in the Division of Cancer Genetics, University of California, San Francisco Cancer Center) were visualized and recorded from 50 to 100 cells of each test culture. The proportion of nuclei displaying fewer copies of orange-colored TRß1 signal in comparison with the green colored centromeric signal was determined. Before LOH analysis of tumors, control DNA from nonmalignant skin of the patient was used to determine informative status (presence of heterozygosity) at the EABMD and EABH loci within the TRß1 region. Tumor DNA was isolated from manually microdissected, H&E-stained paraffin sections. PCR conditions were as described in Deng et al. (7) . Samples were scored as positive for LOH if >=30% reduction was observed in the allelic ratio of tumor compared with control DNA. A mouse monoclonal antibody (J51) specific for human TRß1 (Santa Cruz Biotechnology Biotech. Inc.) was used at 1:50 dilution for immunoperoxidase staining of multitumor tissue array sections from 0.8 mm cores of paraffin-embedded samples of 106 stage I invasive ductal breast carcinoma (assembled at the University of California, San Francisco Cancer Center). Antibody binding to tissue sections was visualized with the ABC immunoperoxidase kit (Vector Labs). Normal breast tissue served as a positive control for nuclear signal specificity. Tumor samples, which displayed >=10% nuclear positive cells in a x10 microscope field, were recorded as TRß1 positive.

DNA Extraction and Bisulfite Treatment.
Fresh tissue from 7 cases of reduction mammoplasty and frozen blocks from 12 cases of pathologically confirmed stage I and II ductal breast carcinoma, and nonmalignant peripheral tissue were collected at the California Pacific Medical Center, San Francisco, CA, under Institutional Review Board approved guidelines. Genomic DNA was isolated from tissues and cell lines by the standard method of proteinase K digestion and phenol-chloroform extraction. A minimum of 10 ng (1000 cells) genomic DNA was treated with sodium bisulfite as described (9) . On the basis of the TRß1 promoter sequence (Human Genome Project Working Draft),4 a set of universal primers (CVT3F/CVT4R) was designed to amplify both the methylated and the unmethylated strands of bisulfite converted DNA. Additional analysis included MSP, and COBRA, as reported (9 , 10) . In the second round of the nested PCR assay, for MSP, primers M1F/M1R and U1F/U1R, and for COBRA (in tissue samples only), primers CVT3F/CVT3R were used. In COBRA, the PCR product was digested with TaqI to distinguish between methylated and unmethylated DNA. In each assay, absence of DNA template served as negative control, whereas the MDA435 cell line, where methylation was confirmed by sequence analysis of converted DNA, was used as a positive control.

MSP primers:

M1F: GGTAATTTGGTTAGAGGATCGCGC;

M1R: CACCCCTCCGATTCTTACGACG;

U1F: TATTGGTAATTTGGTTAGAGGATTGTGT; and

U1R: CACACCCCTCCAATT CTTACAACA

COBRA primers:

CVT3F: GTTTTAGGGTATTGGTAATTTGGT;

CVT4R: GACCACCCTATTCCACCACTA; and

CVT3R: CAAACTAATAACACCCCCACCA

The relative positions of the CpG sites covered by the above-mentioned primers are shown in Fig. 1aCitation .



View larger version (47K):
[in this window]
[in a new window]
  		Fig. 1. TRß1 expression and methylation analysis in breast cancer cell lines. a, genomic map of the CpG island in the 5' promoter region of the TRß1gene spanning the first exon and intron. represents the transcription initiation site. CpG sites are represented by filled beads. Within this 325 bp region, a total of 31 CpG sites are shown. Arrows represent PCR primer sets used for methylation analysis. b, relative expression of TRß1transcript (500-bp PCR product) in normal and malignant breast epithelial mRNA. Corresponding level of GAPDH expression for each culture was measured simultaneously with TRß1 within the same PCR reaction mixture. Note that TRß1 levels in normal breast reduction mammoplasty tissue before cell culture (Lane 2) and cultures of the same specimen at passage 2 (Lane 3) show close similarity. c, MSP analysis of TRß1 promoter hypermethylation in breast cancer cell lines. The CVT3F/CVT3R primer set was used to amplify sodium bisulfite converted genomic DNA. The distinction between methylated and unmethylated alleles was based on amplification in the second round of a nested PCR with methylation-specific primers M1F and M1R or no methylation-specific primers, U1F and U1R. The product in U indicates the presence of unmethylated DNA, whereas the product in M indicates methylated DNA. d, bisulfite sequencing of TRß1hypermethylated fragment using the CVT4R primer. Top panel, normal breast epithelial cells showing C->T conversion (unmethylated DNA). Bottom panel, breast cancer cell line MDA435 showing unconverted (methylated) CpG sites (indicated in larger bolded font). e, TRß1 expression before and after treatment with 1 µM 5-aza-2'-deoxycytidine in nonexpressing lines MDA435 and SKBR-3 compared with expressing lines MCF-7 and T47D. Note restoration of TRß1 expression in MDA435 and SKBR-3 cells. No change induced by drug treatment in MCF-7 and T47D cells. Middle panels demonstrate no effect of the demethylating agent on RARß expression in the same mRNA samples shown in the top panels. Corresponding GAPDH and test gene expression levels were measured in the same PCR reaction mixture. Bottom panels, COBRA analysis on the cell populations shown in panels above. The products U and M indicate unmethylated and methylated DNA, respectively. Lanes u represent product before enzyme digestion. Lanes d represent cleavage of PCR products by TaqI, displayed as the two lower bands in MDA435 and SKBR-3 cells. Note concurrent reduction in the methylated DNA fraction of treated cells, which display TRß1 re-expression.

 

   Results
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
Discussion
 REFERENCES
 
TRß1 mRNA Expression and Gene Copy Number in Breast Cancer Cell Lines.
Toward a full understanding of the mechanisms of TRß1 inactivation during tumorigenesis, initially we analyzed relative gene expression in breast cancer cell lines by RT-PCR, using primers encompassing exons 4–7. Moderate TRß1 expression was observed in noncancerous breast epithelium before and after cell culture. Transcript levels below those of normal breast epithelial cells were observed in 7 of 10 cell lines (Fig. 1bCitation ; Table 1Citation ). Concurrently, we determined whether reduction in gene copy number was an underlying factor in the level of gene expression. In the majority of cell lines, FISH analysis with site-specific probes for interphase signal enumeration demonstrated equal numbers of chromosome 3 centromere and TRß1-specific signals. In BT474 cells, reduction in copy number did not appear to influence expression level. In those cultures where gene expression was undetectable, such as MDA435 and SKBR3, fewer TRß1 gene copies were observed in the nuclei of a large proportion of cells (Table 1)Citation .


View this table:
[in this window]
[in a new window]
  		Table 1 Status of TRß1 copy number and relative gene expression in breast epithelial cultures

 
Homozygous deletions encompassing TRß1 were not found in any of 10 breast cancer cell lines examined. Similarly, in primary tumors, analyzed here (n = 12) and previously (64 stage I and II cases examined by LOH analysis, Ref. 8 ), chromosomal deletions were limited to loss of a single allele. To determine whether the remaining allele harbored inactivating gene mutations, cDNA of cell lines and primary tumors (12 cases) was analyzed by single-strand conformational polymorphism analysis of exons 9 and 10. This region consists of the ligand-binding domain, a common site of TRß1 germ-line mutations in syndromes unrelated to cancer (11) . Because TRß1 mutations were not detected, here we have focused on the possible role of epigenetic mechanisms in gene inactivation.

Methylation of the TRß1 Promoter in Breast Cancer Cell Lines.
On the basis of the presence of a CpG island in the 5' region of the gene (Fig. 1a)Citation we examined the role of promoter hypermethylation in TRß1 inactivation. Toward a rapid screen for TRß1 hypermethylation in noncancerous breast epithelial cells isolated from cosmetic reduction mammoplasty tissue and breast cancer cell lines, we first analyzed bisulfite converted DNA by the MSP assay (Fig. 1c)Citation . High gene expression levels were associated with the absence of DNA hypermethylation in MCF 7, T47D, and BT474 cell lines. Notably, a lack of detectable transcripts and promoter hypermethylation was concordant in MDA435 and SKBR3 cells. Subsequent sequence analysis of the MDA435 cell line demonstrated 27 of 27 potential sites in a 325-bp region within the CpG island of the gene promoter to be methylated. Four CpG sites downstream of the MSP region, where complete methylation was observed, are shown in Fig. 1dCitation . Incomplete methylation evident at several sites (not shown) most likely accounts for the presence of unmethylated DNA in this cell line.

The detection of abnormally methylated sites in the promoter region is generally considered to be a strong indication of aberrant gene expression, although the target sites of methylation, which effectively inactivate the gene, may be far removed from the observed site of methylation. We have taken additional approaches to identify other methylation sites and additional links between methylation and lack of TRß1 expression. In methylation analysis by the COBRA method, the cell lines found to be methylated by MSP once again displayed hypermethylation (Fig. 1e)Citation .

Moreover, we have showed the restoration of TRß1 expression on treatment with a demethylating agent, 5-aza-deoxycytidine, demonstrating that silencing of the gene by this mechanism is partially reversible (Fig. 1e)Citation . We have observed a 43% and 20% reduction in DNA methylation status of 5-aza-deoxycytidine treated cultures of MDA435 and SKBR-3 cells, respectively. These results demonstrate a direct functional link between methylation and loss of expression, and demethylation and restoration of expression (Fig. 1e)Citation . Simultaneous analysis of another methylated gene in the 3p24 region, RARß2, displayed discordant hypermethylation of the two genes in these samples suggesting that these events were not necessarily linked during tumor progression. Transcript levels of RARß2 were unaltered by treatment with 5-aza-deoxycytidine alone as reported previously (12 , 13) .

TRß1 Promoter Methylation, LOH, and Immunolocalization in Primary Breast Cancer.
In addition to breast cancer cell lines, we evaluated 11 matched cases of primary tumor and breast tissue peripheral to carcinoma for epigenetic alterations in the TRß1 promoter. We observed TRß1 hypermethylation in all 11 of the breast tumors concurrently by MSP and COBRA (Fig. 2, a and b)Citation . Considerable intertumor variability in the degree of methylation was evident by the intensity of the PCR products. In 7 of 7 independent cases of normal tissue from women without breast cancer, no methylation was detected by any of the methods used (representative examples shown in Fig. 1, c and dCitation ). Whereas it was surprising that the frequency with which TRß1 methylation occurred in established breast cancer cell lines was remarkably lower than tumor tissue, this finding may be related to years of in vitro selection. Methylation was not restricted only to the tumor cells but also occurred in nonmalignant tissue peripheral to carcinoma. In 4 of 11 cases, both CpG test sites in the promoter DNA were methylated. In the remaining 7 cases, no methylation was observed in the nonmalignant tissue or it was detected only within one of the two PCR-amplified regions of the CpG island. In one case (394T), in the quantitative COBRA assay, tumor DNA displayed less methylation than the peripheral tissue. Although the clonal relationship between the tumor and peripheral epithelium is not known in these samples, the TRß1 methylation data suggest the presence of heterogeneity in the nonmalignant component of the afflicted breast in this regard.



View larger version (74K):
[in this window]
[in a new window]
  		Fig. 2. TRß1 promoter methylation and immunolocalization in primary breast cancer. a, MSP analysis of TRß1promoter hypermethylation in primary breast tumor (T) and nonmalignant tissue peripheral to carcinoma (P). M, methylated DNA; U, unmethylated DNA. b, COBRA of primary breast tumor (T) and nonmalignant tissue peripheral to carcinoma (P). c, indirect immunoperoxidase staining of TRß1in breast tumors visible as black nuclei. Nuclear fast red counter stain visible as gray TRß1-negative nuclei. Left panel, strong nuclear staining of TRß1in a proportion of tumor cells. Middle panel, primary tumor with no positively stained malignant cells showing nuclear counter stain only. Right panel, positively stained nuclei in normal TDLUs present within the TRß1-negative tumor section shown in the middle panel. Magnification, x100.

 
To evaluate the concordance between TRß1 promoter methylation, LOH, and expression of nuclear protein, we immunostained tumor sections of cases where TRß1 methylation and allelic loss was confirmed previously (n = 7). These cases exhibited complete loss of expression (4 cases) or a mixture of nuclear positive and negative tumor cells present within a single microscopic field (Fig. 2, cCitation , left panel) indicating biallelic TRß1 silencing to be an emerging aberration in an evolving population of tumor cells.

To extend the analysis of aberrations in TRß1 gene expression to a larger group of tumor samples, we evaluated tumor tissue arrays comprised of >100 cases of stage I primary breast carcinoma by immunoperoxidase localization of TRß1gene product. Samples, which were uniformly negative for all of the cell types, were excluded based on the assumption of protein degradation. A lack of characteristic TRß1 nuclear immunostaining was observed in 18 of 78 cases (Fig. 2, cCitation , middle panel). In these cases, nonmalignant constituents of the tumor sample, such as TDLU, lymphocytes, fibroblasts, and blood vessels continued to display TRß1-positive nuclei (Fig. 2, cCitation , right panel). The overall incidence of tumors lacking TRß1 nuclear expression in the patient subset studied here was 25% (22 of 85). At this time it remains unknown whether hypermethylation is involved in biallelic inactivation and gene silencing of all or a proportion of these cases.


   Discussion
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
REFERENCES
 
TRß1 regulates gene expression when bound to thyroid response elements in the proximity of target genes (14) . On the basis of the presence or absence of the ligand, thyroid hormone (triiodothyronine, T3), TRß1 can act as a transcriptional activator or silencer (15) . In vitro studies have shown that T3 treatment of TRß1-overexpressing cultures arrests proliferation in the G0/G1 phase of the cell cycle, and induces morphological and functional differentiation (16) . Interestingly, T3-induced differentiation is preceded by a rapid decrease in the expression of the oncogene c-myc (17) . Mechanisms, which inactivate TRß1, may thus play an important role in the up-regulation of thyroid response elements harboring oncogenes during malignant progression. To our knowledge, this is the first direct demonstration of an epigenetic mechanism associated with TRß1 gene silencing in cancer.

Our analysis of the TRß1 gene in breast cancer cell lines provides evidence of promoter hypermethylation, decreased DNA copy number, and reversible reduction in transcript expression. TRß1 status of clinical tumor samples demonstrates that hypermethylation and LOH occur more frequently than the complete absence of nuclear protein. This suggests the possibility that the full extent of methylation required for gene inactivation was most likely under-represented because of the limited MSP and COBRA sites examined here. However, the detection of any abnormally methylated site is a strong indication that this mechanism could alter expression levels of the target gene. Nonexpressing tumors could serve as an important tool in mapping target CpG sites in the TRß1 promoter. A partially inactivating event, LOH in the region of the TRß1 gene, occurs before detectable morphological changes in normal TDLU adjacent to carcinoma (7 , 8) . Here, we have shown that the epigenetic alteration of TRß1 is also an early event, which occurs in nonmalignant tissue peripheral to carcinoma. Similar findings of estrogen receptor gene hypermethylation in normal colon tissue of cancer patients are postulated to be "field defects" (18) .

Ligand-mediated prevention strategies for breast cancer have targeted RARß (19) , another epigenetically inactivated nuclear receptor superfamily member (12 , 13) . Our findings regarding multiple mechanisms of TRß1 inactivation support the importance of exploring this target as an additional approach for breast cancer control. However, a thorough understanding of the cellular consequences of modulating a ligand-induced master switch, such as TRß1, is an essential prerequisite. Notably, the incidence of thyroid diseases, although controversial, is reportedly higher in breast cancer patients (20) . An evaluation of thyroid function in the context of underlying breast biology in such cases could provide important clues regarding TRß1 as a potential factor that links disease manifestation in the two organ systems.


   ACKNOWLEDGMENTS
 
We thank Jing Peng for assistance with cell culture and Karen Chew for assembling tumor tissue arrays.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by P50 CA-58207. Back

2 To whom requests for reprints should be addressed, at Geraldine Brush Cancer Research Institute, 2330 Clay Street San Francisco, CA 94115. Phone: (415) 561-1653; Fax: (415) 561-1390; E-mail: shanaz{at}cooper.cpmc.org Back

3 The abbreviations used are: TRß, thyroid hormone receptor ß; LOH, loss of heterozygosity; TDLU, terminal ductal lobular unit; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RARß2, retinoic acid receptor ß2; FISH, fluorescence in situ hybridization; MSP, methylation-specific PCR; COBRA, combined bisulfite restriction analysis; RT-PCR, reverse transcription-PCR. Back

4 Internet address: http://genome.ucsc.edu. Back

Received 7/12/01. Accepted 2/13/02.


   REFERENCES
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Chen J. D., Evans R. M. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature (Lond.), 377: 454-457, 1995.[Medline]
  2. Weinberger C., Thompson C. C., Ong E. S., Lebo R., Gruol D. J., Evans R. M. The c-erb-A gene encodes a thyroid hormone receptor. Nature (Lond.), 324: 641-646, 1986.[Medline]
  3. Kahn P., Frykberg L., Brady C., Stanley I., Beug H., Vennstrom B., Graf T. v-erbA cooperates with sarcoma oncogenes in leukemic cell transformation. Cell, 45: 349-356, 1986.[Medline]
  4. Dobrovic A., Houle B., Belouchi A., Bradley W. E. erbA-related sequence coding for DNA-binding hormone receptor localized to chromosome 3p21–3p25 and deleted in small cell lung carcinoma. Cancer Res., 48: 682-685, 1988.[Abstract/Free Full Text]
  5. Ali I. U., Lidereau R., Callahan R. Presence of two members of c-erbA receptor gene family (c-erbA ß and c-erbA2) in smallest region of somatic homozygosity on chromosome 3p21–p25 in human breast carcinoma. J. Natl. Cancer Inst., 81: 1815-1820, 1989.[Abstract/Free Full Text]
  6. Matsumoto S., Kasumi F., Sakamoto G., Onda M., Nakamura Y., Emi M. Detailed deletion mapping of chromosome arm 3p in breast cancers: a 2-cM region on 3p14.3–21.1 and a 5-cM region on 3p24.3–25.1 commonly deleted in tumors. Genes Chromosomes Cancer, 20: 268-274, 1997.[Medline]
  7. Deng G., Lu Y., Zlotnikov G., Thor A. D., Smith H. S. Loss of heterozygosity in normal tissue adjacent to breast carcinomas. Science (Wash. DC), 274: 2057-2059, 1996.[Abstract/Free Full Text]
  8. Li Z., Moore D. H., Meng Z., Ljung B-M., Gray J. W., Dairkee S. H. Increased risk of local recurrence is associated with allelic loss in normal lobules of breast cancer patients. Cancer Res., 62: 1000-1003, 2002.[Abstract/Free Full Text]
  9. Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation-specific PCR a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826, 1996.[Abstract/Free Full Text]
  10. Xiong Z., Laird P. W. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res., 25: 2532-2534, 1997.[Abstract/Free Full Text]
  11. Weiss R. E., Weinberg M., Refetoff S. Identical mutations in unrelated families with generalized resistance to thyroid hormone occur in cytosine-guanine-rich areas of the thyroid hormone receptor ß gene. Analysis of 15 families. J. Clin. Investig., 91: 2408-2415, 1993.
  12. Sirchia S. M., Ferguson A. T., Sironi E., Subramanyan S., Orlandi R., Sukumar S., Sacchi N. Evidence of epigenetic changes affecting the chromatin state of the retinoic acid receptor ß2 promoter in breast cancer cells. Oncogene, 19: 1556-1563, 2000.[Medline]
  13. Widschwendter M., Berger J., Hermann M., Muller H. M., Amberger A., Zeschnigk M., Widschwendter A., Abendstein B., Zeimet A. G., Daxenbichler G., Marth C. Methylation and silencing of the retinoic acid receptor-ß2 gene in breast cancer. J. Natl. Cancer Inst., 92: 826-832, 2000.[Abstract/Free Full Text]
  14. Mangelsdorf D. J., Thummel C., Beato M., Herrlich P., Schutz G., Umesono K., Blumberg B., Kastner P., Mark M., Chambon P. The nuclear receptor superfamily: the second decade. Cell, 83: 835-839, 1995.[Medline]
  15. Damm K., Thompson C. C., Evans R. M. Protein encoded by v-erbA functions as a thyroid-hormone receptor antagonist. Nature (Lond.), 339: 593-597, 1989.[Medline]
  16. Lebel J. M., Dussault J. H., Puymirat J. Overexpression of the ß 1 thyroid receptor induces differentiation in neuro-2a cells. Proc. Natl. Acad. Sci. USA, 91: 2644-2648, 1994.[Abstract/Free Full Text]
  17. Perez-Juste G., Garcia-Silva S., Aranda A. An element in the region responsible for premature termination of transcription mediates repression of c-myc gene expression by thyroid hormone in neuroblastoma cells. J. Biol. Chem., 275: 1307-1314, 2000.[Abstract/Free Full Text]
  18. Issa J. P., Ottaviano Y. L., Celano P., Hamilton S. R., Davidson N. E., Baylin S. B. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat. Genet., 7: 536-540, 1994.[Medline]
  19. Veronesi U., De Palo G., Marubini E., Costa A., Formelli F., Mariani L., Decensi A., Camerini T., Del Turco M. R., Di Mauro M. G., Muraca M. G., Del Vecchio M., Pinto C., D’Aiuto G., Boni C., Campa T., Magni A., Miceli R., Perloff M., Malone W. F., Sporn M. B. Randomized trial of fenretinide to prevent second breast malignancy in women with early breast cancer. J. Natl. Cancer Inst., 91: 1847-1856, 1999.[Abstract/Free Full Text]
  20. Smyth P. P. The thyroid and breast cancer: a significant association?. Ann. Med., 29: 189-191, 1997.[Medline]



This article has been cited by other articles:


Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
D. M. Euhus, D. Bu, R. Ashfaq, X.-J. Xie, A. Bian, A. M. Leitch, and C. M. Lewis
Atypia and DNA Methylation in Nipple Duct Lavage in Relation to Predicted Breast Cancer Risk
Cancer Epidemiol. Biomarkers Prev., September 1, 2007; 16(9): 1812 - 1821.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
A. S. Rocha, R. Marques, I. Bento, R. Soares, J. Magalhaes, I. V. de Castro, and P. Soares
Thyroid hormone receptor {beta} mutations in the 'hot-spot region' are rare events in thyroid carcinomas
J. Endocrinol., January 1, 2007; 192(1): 83 - 86.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. Shiina, J. E. Breault, W. W. Basset, H. Enokida, S. Urakami, L.-C. Li, S. T. Okino, M. Deguchi, M. Kaneuchi, M. Terashima, et al.
Functional Loss of the {gamma}-Catenin Gene through Epigenetic and Genetic Pathways in Human Prostate Cancer
Cancer Res., March 15, 2005; 65(6): 2130 - 2138.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
Y. Kato, H. Ying, M. C. Willingham, and S.-Y. Cheng
A Tumor Suppressor Role for Thyroid Hormone {beta} Receptor in a Mouse Model of Thyroid Carcinogenesis
Endocrinology, October 1, 2004; 145(10): 4430 - 4438.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Garcia-Silva and A. Aranda
The Thyroid Hormone Receptor Is a Suppressor of ras-Mediated Transcription, Proliferation, and Transformation
Mol. Cell. Biol., September 1, 2004; 24(17): 7514 - 7523.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
P. Parrella, M. L. Poeta, A. P. Gallo, M. Prencipe, M. Scintu, A. Apicella, R. Rossiello, G. Liguoro, D. Seripa, C. Gravina, et al.
Nonrandom Distribution of Aberrant Promoter Methylation of Cancer-Related Genes in Sporadic Breast Tumors
Clin. Cancer Res., August 15, 2004; 10(16): 5349 - 5354.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
L. Kopelovich, J. A. Crowell, and J. R. Fay
The Epigenome as a Target for Cancer Chemoprevention
J Natl Cancer Inst, December 3, 2003; 95(23): 1747 - 1757.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
H. Ying, H. Suzuki, H. Furumoto, R. Walker, P. Meltzer, M. C. Willingham, and S.-Y. Cheng
Alterations in genomic profiles during tumor progression in a mouse model of follicular thyroid carcinoma
Carcinogenesis, September 1, 2003; 24(9): 1467 - 1479.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Z. Li, Z. H. Meng, A. Sayeed, R. Shalaby, B.-M. Ljung, and S. H. Dairkee
Genome-wide Allelotyping of a New in Vitro Model System Reveals Early Events in Breast Cancer Progression
Cancer Res., October 15, 2002; 62(20): 5980 - 5987.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Z.
Right arrow Articles by Dairkee, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Z.
Right arrow Articles by Dairkee, S. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online