| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Geraldine Brush Cancer Research Institute, California Pacific Medical Center [Z. L., Z. H. M., R. C., S. H. D.], and University of California, San Francisco Comprehensive Cancer Center [W-L. K., C. C. C., J. W. G.], San Francisco, California 94115
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
(2)
arrests normal differentiation of avian erythroblast progenitors resulting in virally induced leukemic transformation (3)
. Deletions encompassing TRß3
are suspected to play a role in the genesis of small cell lung cancer (4)
. In breast cancer, LOH is a common occurrence at chromosome 3p in the general vicinity of the TRß1 gene (5
, 6)
. Most notably, LOH encompassing the TRß1 gene occurs before the manifestation of morphological changes in TDLUs of cancerous breast tissue (7
, 8)
. We demonstrate here that epigenetic changes in the promoter region of TRß1 are also involved in the inactivation of this gene in breast cancer cell lines and possibly in early stage breast tumors. | Materials and Methods |
|---|
|
|
|---|
GAPDH-F; TGATGACATCAAGAAGGTGGTGAA;
GAPDH-R: TCCTTGGAGGCCATGTGGGCCAT; (250 bp product)
TRß1-F: GAACAGTCGTCGCCACATCTC;
TRß1-R: TGAGCTCCCATTCCTCGTC; (500 bp product)
RARß2-F: AGAGTTTGATGGAGTTGGGTGGAC; and
RARß2-R: GCTGGCAGAGTGAAGGGAAAGTTT (721 bp product).
For restoration of TRß1 expression, cell lines were incubated with medium supplemented with 1 µM 5-aza-2-deoxycytidine for 5 days.
FISH, LOH, and Immunoperoxidase Analysis.
For FISH, nuclear signals generated from two color hybridization of FITC-conjugated chromosome 3 centromere probe and Cy3-conjugated TRß1 probe (prepared and validated in the Division of Cancer Genetics, University of California, San Francisco Cancer Center) were visualized and recorded from 50 to 100 cells of each test culture. The proportion of nuclei displaying fewer copies of orange-colored TRß1 signal in comparison with the green colored centromeric signal was determined. Before LOH analysis of tumors, control DNA from nonmalignant skin of the patient was used to determine informative status (presence of heterozygosity) at the EABMD and EABH loci within the TRß1 region. Tumor DNA was isolated from manually microdissected, H&E-stained paraffin sections. PCR conditions were as described in Deng et al. (7)
. Samples were scored as positive for LOH if
30% reduction was observed in the allelic ratio of tumor compared with control DNA. A mouse monoclonal antibody (J51) specific for human TRß1 (Santa Cruz Biotechnology Biotech. Inc.) was used at 1:50 dilution for immunoperoxidase staining of multitumor tissue array sections from 0.8 mm cores of paraffin-embedded samples of 106 stage I invasive ductal breast carcinoma (assembled at the University of California, San Francisco Cancer Center). Antibody binding to tissue sections was visualized with the ABC immunoperoxidase kit (Vector Labs). Normal breast tissue served as a positive control for nuclear signal specificity. Tumor samples, which displayed
10% nuclear positive cells in a x10 microscope field, were recorded as TRß1 positive.
DNA Extraction and Bisulfite Treatment.
Fresh tissue from 7 cases of reduction mammoplasty and frozen blocks from 12 cases of pathologically confirmed stage I and II ductal breast carcinoma, and nonmalignant peripheral tissue were collected at the California Pacific Medical Center, San Francisco, CA, under Institutional Review Board approved guidelines. Genomic DNA was isolated from tissues and cell lines by the standard method of proteinase K digestion and phenol-chloroform extraction. A minimum of 10 ng (1000 cells) genomic DNA was treated with sodium bisulfite as described (9)
. On the basis of the TRß1 promoter sequence (Human Genome Project Working Draft),4
a set of universal primers (CVT3F/CVT4R) was designed to amplify both the methylated and the unmethylated strands of bisulfite converted DNA. Additional analysis included MSP, and COBRA, as reported (9
, 10)
. In the second round of the nested PCR assay, for MSP, primers M1F/M1R and U1F/U1R, and for COBRA (in tissue samples only), primers CVT3F/CVT3R were used. In COBRA, the PCR product was digested with TaqI to distinguish between methylated and unmethylated DNA. In each assay, absence of DNA template served as negative control, whereas the MDA435 cell line, where methylation was confirmed by sequence analysis of converted DNA, was used as a positive control.
MSP primers:
M1F: GGTAATTTGGTTAGAGGATCGCGC;
M1R: CACCCCTCCGATTCTTACGACG;
U1F: TATTGGTAATTTGGTTAGAGGATTGTGT; and
U1R: CACACCCCTCCAATT CTTACAACA
COBRA primers:
CVT3F: GTTTTAGGGTATTGGTAATTTGGT;
CVT4R: GACCACCCTATTCCACCACTA; and
CVT3R: CAAACTAATAACACCCCCACCA
The relative positions of the CpG sites covered by the above-mentioned primers are shown in Fig. 1a
.
|
| Results |
|---|
|
|
|---|
|
Methylation of the TRß1 Promoter in Breast Cancer Cell Lines.
On the basis of the presence of a CpG island in the 5' region of the gene (Fig. 1a)
we examined the role of promoter hypermethylation in TRß1 inactivation. Toward a rapid screen for TRß1 hypermethylation in noncancerous breast epithelial cells isolated from cosmetic reduction mammoplasty tissue and breast cancer cell lines, we first analyzed bisulfite converted DNA by the MSP assay (Fig. 1c)
. High gene expression levels were associated with the absence of DNA hypermethylation in MCF 7, T47D, and BT474 cell lines. Notably, a lack of detectable transcripts and promoter hypermethylation was concordant in MDA435 and SKBR3 cells. Subsequent sequence analysis of the MDA435 cell line demonstrated 27 of 27 potential sites in a 325-bp region within the CpG island of the gene promoter to be methylated. Four CpG sites downstream of the MSP region, where complete methylation was observed, are shown in Fig. 1d
. Incomplete methylation evident at several sites (not shown) most likely accounts for the presence of unmethylated DNA in this cell line.
The detection of abnormally methylated sites in the promoter region is generally considered to be a strong indication of aberrant gene expression, although the target sites of methylation, which effectively inactivate the gene, may be far removed from the observed site of methylation. We have taken additional approaches to identify other methylation sites and additional links between methylation and lack of TRß1 expression. In methylation analysis by the COBRA method, the cell lines found to be methylated by MSP once again displayed hypermethylation (Fig. 1e)
.
Moreover, we have showed the restoration of TRß1 expression on treatment with a demethylating agent, 5-aza-deoxycytidine, demonstrating that silencing of the gene by this mechanism is partially reversible (Fig. 1e)
. We have observed a 43% and 20% reduction in DNA methylation status of 5-aza-deoxycytidine treated cultures of MDA435 and SKBR-3 cells, respectively. These results demonstrate a direct functional link between methylation and loss of expression, and demethylation and restoration of expression (Fig. 1e)
. Simultaneous analysis of another methylated gene in the 3p24 region, RARß2, displayed discordant hypermethylation of the two genes in these samples suggesting that these events were not necessarily linked during tumor progression. Transcript levels of RARß2 were unaltered by treatment with 5-aza-deoxycytidine alone as reported previously (12
, 13) .
TRß1 Promoter Methylation, LOH, and Immunolocalization in Primary Breast Cancer.
In addition to breast cancer cell lines, we evaluated 11 matched cases of primary tumor and breast tissue peripheral to carcinoma for epigenetic alterations in the TRß1 promoter. We observed TRß1 hypermethylation in all 11 of the breast tumors concurrently by MSP and COBRA (Fig. 2, a and b)
. Considerable intertumor variability in the degree of methylation was evident by the intensity of the PCR products. In 7 of 7 independent cases of normal tissue from women without breast cancer, no methylation was detected by any of the methods used (representative examples shown in Fig. 1, c and d
). Whereas it was surprising that the frequency with which TRß1 methylation occurred in established breast cancer cell lines was remarkably lower than tumor tissue, this finding may be related to years of in vitro selection. Methylation was not restricted only to the tumor cells but also occurred in nonmalignant tissue peripheral to carcinoma. In 4 of 11 cases, both CpG test sites in the promoter DNA were methylated. In the remaining 7 cases, no methylation was observed in the nonmalignant tissue or it was detected only within one of the two PCR-amplified regions of the CpG island. In one case (394T), in the quantitative COBRA assay, tumor DNA displayed less methylation than the peripheral tissue. Although the clonal relationship between the tumor and peripheral epithelium is not known in these samples, the TRß1 methylation data suggest the presence of heterogeneity in the nonmalignant component of the afflicted breast in this regard.
|
To extend the analysis of aberrations in TRß1 gene expression to a larger group of tumor samples, we evaluated tumor tissue arrays comprised of >100 cases of stage I primary breast carcinoma by immunoperoxidase localization of TRß1gene product. Samples, which were uniformly negative for all of the cell types, were excluded based on the assumption of protein degradation. A lack of characteristic TRß1 nuclear immunostaining was observed in 18 of 78 cases (Fig. 2, c
, middle panel). In these cases, nonmalignant constituents of the tumor sample, such as TDLU, lymphocytes, fibroblasts, and blood vessels continued to display TRß1-positive nuclei (Fig. 2, c
, right panel). The overall incidence of tumors lacking TRß1 nuclear expression in the patient subset studied here was 25% (22 of 85). At this time it remains unknown whether hypermethylation is involved in biallelic inactivation and gene silencing of all or a proportion of these cases.
| Discussion |
|---|
|
|
|---|
Our analysis of the TRß1 gene in breast cancer cell lines provides evidence of promoter hypermethylation, decreased DNA copy number, and reversible reduction in transcript expression. TRß1 status of clinical tumor samples demonstrates that hypermethylation and LOH occur more frequently than the complete absence of nuclear protein. This suggests the possibility that the full extent of methylation required for gene inactivation was most likely under-represented because of the limited MSP and COBRA sites examined here. However, the detection of any abnormally methylated site is a strong indication that this mechanism could alter expression levels of the target gene. Nonexpressing tumors could serve as an important tool in mapping target CpG sites in the TRß1 promoter. A partially inactivating event, LOH in the region of the TRß1 gene, occurs before detectable morphological changes in normal TDLU adjacent to carcinoma (7 , 8) . Here, we have shown that the epigenetic alteration of TRß1 is also an early event, which occurs in nonmalignant tissue peripheral to carcinoma. Similar findings of estrogen receptor gene hypermethylation in normal colon tissue of cancer patients are postulated to be "field defects" (18) .
Ligand-mediated prevention strategies for breast cancer have targeted RARß (19) , another epigenetically inactivated nuclear receptor superfamily member (12 , 13) . Our findings regarding multiple mechanisms of TRß1 inactivation support the importance of exploring this target as an additional approach for breast cancer control. However, a thorough understanding of the cellular consequences of modulating a ligand-induced master switch, such as TRß1, is an essential prerequisite. Notably, the incidence of thyroid diseases, although controversial, is reportedly higher in breast cancer patients (20) . An evaluation of thyroid function in the context of underlying breast biology in such cases could provide important clues regarding TRß1 as a potential factor that links disease manifestation in the two organ systems.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 To whom requests for reprints should be addressed, at Geraldine Brush Cancer Research Institute, 2330 Clay Street San Francisco, CA 94115. Phone: (415) 561-1653; Fax: (415) 561-1390; E-mail: shanaz{at}cooper.cpmc.org ![]()
3 The abbreviations used are: TRß, thyroid hormone receptor ß; LOH, loss of heterozygosity; TDLU, terminal ductal lobular unit; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RARß2, retinoic acid receptor ß2; FISH, fluorescence in situ hybridization; MSP, methylation-specific PCR; COBRA, combined bisulfite restriction analysis; RT-PCR, reverse transcription-PCR. ![]()
4 Internet address: http://genome.ucsc.edu. ![]()
Received 7/12/01. Accepted 2/13/02.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. M. Euhus, D. Bu, R. Ashfaq, X.-J. Xie, A. Bian, A. M. Leitch, and C. M. Lewis Atypia and DNA Methylation in Nipple Duct Lavage in Relation to Predicted Breast Cancer Risk Cancer Epidemiol. Biomarkers Prev., September 1, 2007; 16(9): 1812 - 1821. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Rocha, R. Marques, I. Bento, R. Soares, J. Magalhaes, I. V. de Castro, and P. Soares Thyroid hormone receptor {beta} mutations in the 'hot-spot region' are rare events in thyroid carcinomas J. Endocrinol., January 1, 2007; 192(1): 83 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shiina, J. E. Breault, W. W. Basset, H. Enokida, S. Urakami, L.-C. Li, S. T. Okino, M. Deguchi, M. Kaneuchi, M. Terashima, et al. Functional Loss of the {gamma}-Catenin Gene through Epigenetic and Genetic Pathways in Human Prostate Cancer Cancer Res., March 15, 2005; 65(6): 2130 - 2138. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kato, H. Ying, M. C. Willingham, and S.-Y. Cheng A Tumor Suppressor Role for Thyroid Hormone {beta} Receptor in a Mouse Model of Thyroid Carcinogenesis Endocrinology, October 1, 2004; 145(10): 4430 - 4438. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garcia-Silva and A. Aranda The Thyroid Hormone Receptor Is a Suppressor of ras-Mediated Transcription, Proliferation, and Transformation Mol. Cell. Biol., September 1, 2004; 24(17): 7514 - 7523. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Parrella, M. L. Poeta, A. P. Gallo, M. Prencipe, M. Scintu, A. Apicella, R. Rossiello, G. Liguoro, D. Seripa, C. Gravina, et al. Nonrandom Distribution of Aberrant Promoter Methylation of Cancer-Related Genes in Sporadic Breast Tumors Clin. Cancer Res., August 15, 2004; 10(16): 5349 - 5354. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kopelovich, J. A. Crowell, and J. R. Fay The Epigenome as a Target for Cancer Chemoprevention J Natl Cancer Inst, December 3, 2003; 95(23): 1747 - 1757. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ying, H. Suzuki, H. Furumoto, R. Walker, P. Meltzer, M. C. Willingham, and S.-Y. Cheng Alterations in genomic profiles during tumor progression in a mouse model of follicular thyroid carcinoma Carcinogenesis, September 1, 2003; 24(9): 1467 - 1479. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, Z. H. Meng, A. Sayeed, R. Shalaby, B.-M. Ljung, and S. H. Dairkee Genome-wide Allelotyping of a New in Vitro Model System Reveals Early Events in Breast Cancer Progression Cancer Res., October 15, 2002; 62(20): 5980 - 5987. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |