Cancer Research The Future of Cancer Research: Science and Patient Impact  Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Noesel, M. M.
Right arrow Articles by Versteeg, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Noesel, M. M.
Right arrow Articles by Versteeg, R.
[Cancer Research 62, 2157-2161, April 1, 2002]
© 2002 American Association for Cancer Research


Tumor Biology

Tumor-specific Down-Regulation of the Tumor Necrosis Factor-related Apoptosis-inducing Ligand Decoy Receptors DcR1 and DcR2 Is Associated with Dense Promoter Hypermethylation1

Max M. van Noesel, Saskia van Bezouw, Gajja S. Salomons, P. A. Voûte, Rob Pieters, Steve B. Baylin, James G. Herman and Rogier Versteeg2

Department of Human Genetics [M. M. v. N., S. v. B., G. S. S., R. V.], and Department of Pediatric Oncology Emma Kinderziekenhuis [M. M. v. N., P. A. V.], Academic Medical Center, 1105 AZ, Amsterdam, the Netherlands; The Johns Hopkins Oncology Center, Tumor Biology Laboratory, Baltimore, Maryland 21231 [S. B. B., J. G. H., M. M. v. N.]; and Department of Pediatric Oncology/Hematology, Sophia Children’s Hospital/Erasmus University Rotterdam, 3015 GJ, Rotterdam, the Netherlands [M. M. v. N., R. P.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) induces apoptosis in a large variety of cancer cells but not in most normal human cells. This feature makes TRAIL, a potential antitumor agent. TRAIL can bind to four different receptors, two pro-apoptotic death receptors (DRs), DR4 and DR5, and two antiapoptotic decoy receptors (DcRs), DcR1 and DcR2. Normal cells express all four of the receptors. The increased TRAIL sensitivity of tumor cells has been postulated to result from the lack of DcR expression. We studied the tumor-specific down-regulation of the TRAIL receptors DcR1 and DcR2, as well as DR4 and DR5, in a group of pediatric tumor cell lines [nine neuroblastoma and three peripheral primitive neuro-ectodermal tumors (PNETs)] and three cell lines from adult tumors. Lack of expression of DcR1 and DcR2 was widespread (13 of the 15 cell lines and 10 of 15, respectively), both in the adult tumor cell lines and in the pediatric tumor lines. DR4 and DR5 were expressed in 8 of 15 and 12 of 15 cell lines, respectively. To understand the tumor-specific down-regulation of the TRAIL receptors, the promoter regions were studied for possible methylation changes of their CpG islands. All normal tissues were completely unmethylated, whereas in the tumor cell lines, we found frequent hypermethylation of the promoter. For DcR1 and DcR2, we found dense hypermethylation in 9 (69%) of 13 and 9 (90%) of 10 of nonexpressing cell lines, respectively. DR4 and DR5 were methylated in 5 (71%) of 7 and 2 (67%) of 3 nonexpressing cell lines, respectively. Treatment with the demethylating agent 5-aza-2'deoxycytidine resulted in partial demethylation and restored mRNA expression. In addition, we performed mutation analysis of the death domains of DR4 and DR5 by sequencing exon 9. Mutations were not present in any of the neuroblastoma or PNET cell lines. A panel of 28 fresh neuroblastoma tumor samples also lacked expression of DcR1 and DcR2 in 85 and 74% of cases, respectively. Hypermethylation was observed in 6 (21%) of 28 for DcR1 and 7 (25%) of 28 for DcR2. DR4 and DR5 were both expressed in 22 of 28 tumors, and no promoter methylation was observed. These data suggest that hypermethylation of the promoters of DcR1 and DcR2 is important in the down-regulation of expression in neuroblastoma and other tumor types.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TRAIL3 is a TNF-related ligand of receptors that modulate programmed cell death (1 , 2) . Pro-apoptotic TRAIL signaling is mediated through DR4 (also TNFRSF10A, Apo-2, TRAIL-R1) and DR5 (also TNFRSF10B, KILLER/DR5, TRICK2, TRAIL-R2). These receptors signal apoptosis by association of their intracellular death domain with similar domains in intracellular adapter proteins like FADD and pro-caspase 8 (3 , 4) . Subsequently, caspase 3 and the common route to programmed cell death are activated. This pro-apoptotic effect of TRAIL is counteracted by the DcRs 1 (also TNFRSF10C, TRID, TRAIL-R3) and 2 (also TNFRSF10D, TRUNDD, TRAIL-R4), which are structural homologues of the DRs but defective in their death domains. DcR1 completely lacks the intracellular death domain, and DcR2 contains a truncated, nonfunctional death domain (5, 6, 7, 8, 9) . Both receptors bind TRAIL but are unable to associate with the intracellular signaling molecules of apoptosis. They, thus, act as dominant-negative receptors for TRAIL. All TRAIL receptors have been mapped to the same chromosomal locus 8p21–22, which suggests that they have evolved as a result of gene duplication (9, 10, 11) .

Normal tissues usually express all four of the TRAIL receptors, and this balance prevents TRAIL-induced apoptosis. Cancer cells, on the other hand, often lack expression of the DcRs (6 , 7 , 12) . The unbalance in favor of pro-apoptotic receptors was postulated to determine their increased sensitivity to TRAIL-induced apoptosis. Support for this hypothesis was found in transfection assays in which reexpression of DcR1 in melanoma cells that lacked endogenous DcR1 altered their TRAIL-sensitive phenotype into a TRAIL-resistant one (13) . However, later studies involving multiple cancer cell lines of various origin, and leukemia samples from patients, could not establish a correlation between down-regulation of the DcRs and TRAIL sensitivity, or even a reverse correlation (14, 15, 16) . These conflicting data concerning the role of the DcRs in apoptosis have not yet been clarified.

Apoptotic defects are thought to play a major role in pediatric neuroblastomas. Neuroblastomas are exceptional tumors because they are resistant to TRAIL induction of apoptosis. It has been shown that down-regulation of casp 8 is important in this TRAIL-resistant phenotype (17, 18, 19, 20, 21) . However, not all neuroblastomas have down-regulated casp 8, and little is known about the correlation between expression of the TRAIL receptors and TRAIL sensitivity in neuroblastomas. Here, we studied the expression and methylation status of all four of the TRAIL receptors in a group of pediatric tumor cell lines (nine neuroblastomas and three peripheral PNETs) and cell lines from adult brain, colon, and skin tumors. Our data suggest that hypermethylation of DcR1 and DcR2 is involved in down-regulation of gene expression in tumor cell lines and fresh neuroblastoma tumors.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
Cell lines were cultured at 37°C, 5% CO2, using DMEM (Life Technologies, Inc.) containing 10% FCS, 292 µg/ml L-glutamine, 1% 100x MEM (nonessential amino acids medium; Life Technologies, Inc.) and 0.5% penicillin/streptomycin solution. Freshly prepared 5-AZA (Sigma Chemical Co.) was added three times (2 µM) in the last week before harvest, simultaneously with fresh medium. Cells were harvested 24 h after the last addition of 5-AZA and were used for DNA and RNA isolation.

TRAIL Treatment, Propidium Iodide Staining, and FACS Analysis.
TRAIL (Prepro Tech Inc., Rocky Hill, NJ; final concentration, 20 ng/ml) treatment was performed in 24-well plates (1–2 x 106 cells/ml of medium). After 24 h, cells were harvested, the medium was removed, and the cells were washed once with PBS and centrifuged at 200 x g. Apoptotic cells were determined by the propidium iodide method (22) . Briefly, 500 µl of a hypotonic buffer (50 µg/ml propidium iodide in 0.1% sodium citrate plus Triton X-100; Sigma Chemical Co.) was added directly to the cell pellet. The tubes were placed at 4°C in the dark, overnight, before flow cytometry analyses. The propidium iodide fluorescence of individual nuclei was measured using a FACScan flow cytometer (Beckman). At least 1 x 104 cells of each sample were analyzed in triplicate for each sample. Apoptotic nuclei appeared as a broad hypodiploid DNA peak, as compared with the diploid DNA peak (G0 or resting cells) or hyperdiploid DNA peak (G2 or dividing cells). Induction of apoptosis after stimulation with TRAIL was defined as a 2-fold induction or more of baseline apoptosis.

RT-PCR Detection of mRNA.
Total RNA was isolated from cell lines using RNAzol B (Cinna, Biotecx Laboratories Inc.) according to the manufacturer’s protocol. First-strand cDNA synthesis was performed on 2 µg of total RNA in a volume of 20 µl using Superscript II (Life Technologies, Inc.) and oligo(dT). The specific primers used for mRNA amplification were as follows: DR4 (Accession no. GI2460427) forward (315), CCAACAAGACCTAGCTCCCCAGC, and reverse (793), AAGACTACGGCTGCAACTGTGACTCC; DR5 (Accession no. GI1945071) forward (295), GTCCTGCTGCAGGTCGTACC, and reverse (681), GATGTCACTCCAGGGCGTAC; DcR1 (Accession no. GI2338421) forward (205; Ref. 23 ), CCCAAAGACCCTAAAGTTCGTC, and reverse (447), GCAAGAAGGTTCATTGTTGGA; DcR2 (Accession no. GI4106963) forward (183), ACCCCAAGATCCTTAAGTTCG, reverse (426), CAAGAAGGCAAATTGTTGGAA; and casp 8 (Accession no. GI4502582) forward (516), GGAAAGGGAACTTCAGACACC, and reverse (850), TCAGCAGGCTCTTGTTGATTT.

Analysis of expression was performed in a 25-µl PCR reaction containing 1 µl of cDNA, 1 µl of dNTP (2.5 mM each), 0.5 µl each of the specific primers (150 ng/µl), and 0.25 µl of Taq DNA polymerase (5 units/µl; Boehringer). PCR conditions were as follows: 1 cycle, 5 min/95°C; 35 cycles, 1 min/95°C, 1 min/60°C, and 1 min/72°C; and 1 cycle, 5 min/72°C. PCR products were loaded on a 4% agarose gel (Metaphor; BioWhittaker Molecular Applications, Rockland, ME), stained with Gelstar nucleic acid gel stain (BioWhittaker Molecular Applications), and directly visualized under UV illumination.

MSP.
Genomic DNA was isolated from cell lines and primary tissues, using standard procedures. Approximately 1 µg of DNA was bisulfite-modified, as described previously (24) . This treatment converts all unmethylated cytosines into uracil. In the subsequent MSP reaction, all of the uracils become thymidines. The PCR requires primer pairs that specifically recognize methylated or unmethylated sequences. These primers were designed in the 5' untranslated region CpG island of the published sequences. The primer sequences are (5'- to -3'): DcR1, GAATTTTTTTATGTGTATGAATTTAGTTAAT (unmethylated sense), TTACGCGTACGAATTTAGTTAAC (methylated sense), CCATCAAACAACCAAAACA (unmethylated antisense), ATCAACGACCGACCGAAACG (methylated antisense); DcR2, TTGGGGATAAAGTGTTTTGATT (unmethylated sense), GGGATAAAGCGTTTCGATC (methylated sense), AAACCAACAACAAAACCACA (unmethylated antisense), CGACAACAAAACCGCG (methylated antisense); DR4, GTAGTGATTTTGAATTTTGGGAGTGTAGT (unmethylated sense), TTCGAATTTCGGGAGCGTAGC (methylated sense), CTCATAATTCAATCCCCACAA (unmethylated antisense), GTAATTCAATCCTCCCCGCGA (methylated antisense); DR5, TGTTTGAGTAGTGAAAGATTAGTTTGTGTT (unmethylated sense), GAGTAGTGAAAGATTAGTTCGCGTC (methylated sense), ACAACCAAAACATTCTATCCCCA (unmethylated antisense), CCGAAACGTTCTATCCCCG (methylated antisense); and casp 8 (17) , TAGGGGATTTGGAGATTGTGA (unmethylated sense), TAGGGGATTCGGAGATTGCGA (methylated sense), CCATATATATCTACATTCAAAACAA (unmethylated antisense), CGTATATCTACATTCGAAACGA (methylated antisense).

PCR reactions are hot-started at 95°C for 15 min, by using 0.25 µl (5 units/µl) of HotStarTaq DNA polymerase (Qiagen). Reactions were performed at 60°C annealing temperature. Each PCR reaction was loaded on a 6% nondenaturing polyacrylamide gel, stained with ethidium bromide and directly visualized under UV illumination. Genomic DNA, treated with Sss1 methylase (New England Biolabs; as instructed by manufacturer’s protocol) and after bisulfite modification, was used as positive control for methylated DNA.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of the DcRs 1 and 2.
We analyzed the mRNA expression of the DcRs 1 and 2 and DRs 4 and 5 in a panel of pediatric neuroblastoma cell lines and peripheral PNETs and adult tumor cell lines (see Table 1Citation ). Nontransformed, cultured fibroblasts were used as controls. Expression of the receptors was measured by RT-PCR. In the fibroblasts, we found expression of both DcR1 and DcR2. In the tumor cell line panel, DcR1 was down-regulated in 13 (87%) of 15 and DcR2 in 10 (66%) of 15 cell lines (Fig. 1)Citation . This frequent down-regulation of expression of DcR1 and DcR2 in pediatric tumor cell lines was previously reported for cell lines of adult type of cancers (6, 7, 8 , 13) . DR4 and DR5 expression was variable. DR4 was expressed in 8 (53%) of 15 cell lines and DR5 was expressed in 12 (80%) of 15 cell lines. Almost all of the cell lines (13 of 15), therefore, expressed at least one of the DRs, DR4 or DR5.


View this table:
[in this window]
[in a new window]
 
Table 1 TRAIL sensitivity of tumor cell lines, in relation to expression and methylation profiles of DcR1, DcR2, and casp 8

 


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 1. RT-PCR expression analysis of DcR1, DcR2, DR4, DR5, and casp 8 (Casp 8) in human cancer cell lines. Analysis of GAPDH mRNA expression serves as a control.

 
TRAIL sensitivity was measured by the ability of the tumor cells to undergo apoptosis after coculturing for 24 h with TRAIL. Apoptosis was measured by FACS analysis for apoptotic bodies after nuclear staining with propidium iodide. Eight of 15 cell lines were sensitive to TRAIL, ranging from 2-fold (518A, SK-N-AS) to 10-fold (CHP100) increase in apoptotic bodies compared with the controls (data summarized in Table 1Citation ). However, in six neuroblastoma cell lines, we did not observe any induction of apoptosis after stimulation with TRAIL. Recently, it was shown that many neuroblastomas lack expression of casp 8 and, therefore, are unable to respond to TRAIL (17, 18, 19, 20, 21) . This casp 8 down-regulation was found to be associated with promoter hypermethylation. We, therefore, checked the casp 8 expression and promoter methylation status for the complete panel. Indeed, casp 8 was not expressed in the TRAIL-resistant neuroblastoma cell lines, whereas robust expression was observed in all TRAIL-responsive cell lines (SK-N-AS, GI-ME-N, SJNB-8, and all non-neuroblastoma cell lines; Fig. 1Citation and Table 1Citation ). We used MSP to analyze promoter hypermethylation (24) . Cell lines IMR32, LA-N-1, NMB, KCNR, and LA-N-5 were found to be completely methylated and lacked expression of casp 8. All of the other cell lines with partially or completely unmethylated promoters expressed casp 8 and responded to TRAIL (Fig. 2Citation and Table 1Citation ). LA-N-6 was an exception because it was not completely methylated, and yet it also did not express casp 8.



View larger version (97K):
[in this window]
[in a new window]
 
Fig. 2. Methylation analysis of the DcR1, DcR2, DR4, DR5, and casp 8 (Casp 8) gene promoter. In each pair of panels listed on right side: top panels (U), amplified products with primers recognizing unmethylated sequences for each gene; bottom panels (M), amplified products with primers recognizing methylated sequences for each gene. IVD, in vitro methylated DNA serves as a positive control for methylated sequence. Completely methylated cell lines correspond with down-regulation of the mRNA expression (see Fig. 1Citation ).

 
This analysis showed that TRAIL resistance correlates very well with down-regulation of casp 8. To analyze a possible correlation between TRAIL sensitivity and TRAIL receptor expression, we further analyzed the group of casp 8-positive cell lines (SK-N-AS, GI-MEN, SJNB-8, CHP100, NN-1, TC32, 518A, and SW837; see Table 1Citation ). All of the cell lines in this subgroup were TRAIL sensitive. They all lacked DcR1 expression, and four of eight lacked DcR2 expression. This means that in this subgroup, down-regulation of DcR1 correlated with TRAIL sensitivity, and DcR2 did not.

Methylation of the TRAIL Receptors.
The almost complete absence of either of the two DcRs, DcR1 and DcR2, in many different tumor types and the variable expression of the DRs urged us to analyze the mechanisms involved in their down-regulation. We looked for promoter hypermethylation, which can selectively down-regulate gene expression, as a mechanism. DcR1 and DcR2 both contained CpG-rich areas near the translation start site. We first analyzed the methylation status of the promoter regions in normal human tissues (heart, liver, lung, muscle, ovary, spleen, kidney) and untransformed fibroblasts (Fig. 3)Citation . All normal tissues and fibroblasts were completely unmethylated for all four of the TRAIL receptors, except for a faintly methylated DcR2 product in liver tissue, which represented less that 5% of the total DNA. In the tumor cell lines, we found dense promoter methylation (>95%) for DcR1 in 9 (69%) of 13 of nonexpressing cell lines (6 of 7 neuroblastoma cell lines and 3 of 6 non-neuroblastoma cell lines; Fig. 2Citation and Table 1Citation ). DcR2 was densely methylated in 9 (90%) of 10 nonexpressing cell lines (6 of 7 neuroblastoma cell lines and 3 of 3 non-neuroblastoma cell lines). In addition, methylation of DR4 and DR5 was frequent. DR4 was methylated in 5 (71%) of 7 nonexpressing cell lines, and DR5 in 2 (66%) of 3. Partially methylated gene promoters did not correlate well with a down-regulation of expression, as was also true for casp 8. However, complete promoter methylation correlated in all cases with a lack of expression.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 3. Methylation analysis of the DcR1 and DcR2 genes in normal human tissues. All of the human tissues are unmethylated, except for a faint methylated DcR2 product in liver tissue. IVD, in vitro methylated DNA serves as a positive control for methylated sequence.

 
Demethylation of the TRAIL Receptors.
To further establish the role of methylation in the down-regulation of DcR1 and DcR2, we treated the nine nonexpressing, hypermethylated cell lines with the demethylating agent 5-AZA. Addition of 5-AZA to the cell culture induced partial demethylation of the DcRs in all of the cell lines tested. In addition, all demethylated cell lines restored mRNA expression of these genes to various degrees (Fig. 4)Citation . The same 5-AZA-treated cell lines also showed demethylation and reexpression of the DR4 and DR5 genes (data not shown). These results suggest that hypermethylation of the TRAIL receptor promoters plays a causative role in down-regulation of expression. Thus, in neuroblastoma cell lines, five genes within the TRAIL pathway (DcR1, DcR2, DR4, DR5, and casp 8) are subject to epigenetic down-regulation of expression.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 4. Demethylation and reexpression of DcR1 and DcR2 after treatment of cell lines with 5-AZA. A, DcR-1-U and DcR2-U: methylation analysis of DcR1 and DcR2 in tumor cell lines with primers recognizing unmethylated gene sequences. Cell lines have been pretreated with the demethylating agent 5-AZA. All of the cell lines contain unmethylated sequences (compare also Fig. 2Citation ). B, RT-DcR1-AZA and RT-DcR2-AZA, Corresponding RT-PCR expression analysis of DcR1 and DcR2 after 5-AZA pretreatment. Partial demethylation restores mRNA expression of DcR1 or DcR2 in cell lines that did not express DcR1 or 2 before 5-AZA treatment (see also Fig. 1Citation ). RT-GAPDH-AZA, a control.

 
Sequence Analysis of the Intracellular Death Domains of DR4 and DR5.
Mutations in the DR5 gene have been described for head and neck cancer and lung cancer (25, 26, 27) , and they were exclusively found in the intracellular death domain. Because not all cell lines with down-regulated DR4 and DR5 are hypermethylated, we performed a sequence analysis of the death domain spanning exon 9 for both genes. The analysis was performed on all neuroblastoma and PNET cell lines. Our analysis did not reveal any mutation (data not shown).

Methylation of Dcr1, DcR2, DR4, and DR5 in Fresh Neuroblastoma Tumors.
To establish the role of promoter methylation and expression of DcR1 and DcR2 in fresh tumors, we analyzed a panel of 28 neuroblastoma tumors. The neuroblastoma tumor panel contained a variety of all INSS (International Neuroblastoma Staging System) stages 1–4 and 4S, and was randomly chosen from our neuroblastoma tumor bank. Areas of dense tumor tissue (>90%) were selected. To this purpose, we made serial sections of tumor samples and did a microscopic analysis of each fifth section. Sections without detectable normal infiltrating tissue were marked, and DNA and RNA were isolated from the sections in between them. Expression of the studied genes in the tumors was comparable with that in the cell lines. DcR1 was weakly expressed in 5 (18%) of 28 and DcR2 in 8 (29%) of 28 tumors. DcR1 was methylated in 6 (21%) of 28 tumors and DcR2 was methylated in 7 (25%) of 28 tumors (Fig. 5)Citation . Five of six tumors with methylated DcR1 did not express this gene, as assessed by RT-PCR. The sixth sample showed weak expression only. For DcR2, three of the four methylated samples did not express the gene. These data show that methylated tumor samples have an absent or very weak DcR1 or DcR2 expression. However, many tumors without methylation of the promoter of DcR1 or DcR2 also lack expression of these genes. This suggests that other mechanisms beside methylation operate in tumors to mediate DcR1 and DcR2 down-regulation.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5. Methylation analysis of the 6 methylated samples (N1–N6) for DcR1 and DcR2 of a 28-primary-neuroblastoma-tumor panel.

 
In addition, we analyzed DR4 and DR5 methylation and expression in the tumor series. DR4 and DR5 were both expressed in 22 (78%) of 28 of the tumors. Methylation of DR4 and DR5 was not detected in any of the tumor samples (data not shown).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Carcinomas have been reported to lack expression of the DcRs, which may render them more susceptible to TRAIL-induced apoptosis (6 , 7 , 12) . Here, we showed that a series of pediatric tumor cell lines also shows a frequent abrogation of DcR expression. Considering the mechanisms responsible for this tumor-specific down-regulation of the DcRs, we found complete DcR1 and DcR2 promoter hypermethylation in 69 and 90% of nonexpressing cell lines, respectively. DR4 and DR5 were also frequently down-regulated and methylated in the cell lines. After treatment of the cell lines with the demethylating agent 5-AZA, we observed partial demethylation and restoration of mRNA expression. These experiments strongly suggest that promoter methylation is responsible for the down-regulation of the TRAIL receptors DcR1 and DcR2 in the tumor cell lines tested. Promoter hypermethylation of DcR1 and DcR2 was also found in fresh neuroblastoma tumors, although in a smaller percentage (21–25%) of samples. DR4 and DR5 were also frequently down-regulated in the cell lines, which is in agreement with earlier observations (20 , 21) . Here, we report the association between down-regulation of DR4 and DR5 and promoter hypermethylation in the cell lines. However, in most of the fresh tumors, DR4 and DR5 were expressed, and we did not observe promoter hypermethylation in the nonexpressing tumors.

The observed differences between the fresh tumors versus the cell lines may in part be explained by the fact that neuroblastoma cell lines are raised from aggressive neuroblastomas, invariably stage 3 or 4, often associated with amplification of MYCN and/or loss of heterozygosity for chromosome 1p36. The freshly obtained neuroblastoma tumor samples used here also contained specimens from the less aggressive stages 1, 2, and 4S. However, the limited number of cases for each different stage did not permit a conclusive analysis of a possible relation between tumor stage and DcR1 or DcR2 methylation.

Methylation of promoters was assessed by MSP. MSP has established itself as a robust and highly reproducible technique, which allows the screening of large tumor panels. However, only a limited number of CpG-dinucleotides within the PCR primers can be investigated. This limitation can be overcome by using multiple primer pairs within the same CpG-island, as we did for DR4 and DR5. The results were identical (data not shown). Alternatively, sequencing of areas of the CpG-island after bisulfite treatment of the DNA will give a broader insight in the methylation pattern of the island of interest. However, this technique is not suitable for screening of a large tumor panel, as described in this study.

The frequent down-regulation and key position of casp 8 in the apoptosis pathway complicates the analysis of the functional importance of TRAIL receptor expression in apoptosis. Considering only casp 8-expressing cell lines, we could establish a correlation between DcR1 down-regulation and TRAIL sensitivity. The next step would be to functionally test the effect of regained DcR1 and/or DcR2 expression on apoptosis after demethylation in a TRAIL induction assay. Unfortunately, when we demethylated the cell lines by adding 5-AZA to the cell cultures, the background apoptosis level increased from 2–8% to more than 50%. This obviously precluded a reliable comparison of the TRAIL sensitivity between 5-AZA-treated and nontreated cell lines. Even a 3-fold reduction of the 5-AZA concentration could not bring the background apoptosis back to normal levels (data not shown).

The down-regulation of the DcRs in cancer is a puzzling feature, because it renders cancer cells more susceptible to TRAIL-induced apoptosis and, thus, would counteract tumorigenesis. This could be seen as a protective response against tumor formation or progression. In this view, DcR1 and DcR2 down-regulation represents a "physiological" response of the (pre-) cancerous cell to a cellular state, in which a higher level of apoptotic sensitivity is warranted. In light of the many cancer types with down-regulated DcRs, it may be an important threshold against cancer formation. It will be interesting to test whether DcR1 and DcR2 down-regulation is inducible in vitro by cellular transformation with exogenous oncogenes. A precedent to such a regulatory principle is provided by MYC oncogenes, which are known to render cells prone to apoptosis (28, 29, 30) . Currently, we have no clue as to the identity of the genes responsible for down-regulation of DcR1 and 2. However, our results suggest that promoter methylation plays an important role in the mechanism of down-regulation. The mechanistic involvement of the methylation machinery in a physiological cellular response that counteracts carcinogenesis has not been observed previously.

Aberrant methylation and subsequent down-regulation of potential tumor suppressor genes are found in many different cancer types (reviewed in Refs. 31 , 32 ) and are comparable with genetic mutations or deletions of tumor suppressor genes. In contrast to the down-regulation of the DcRs, these changes contribute to the malignant tumor phenotype. In neuroblastomas, casp 8 hypermethylation and down-regulation have also been postulated to be such an oncogenic event (17) . casp 8 is a downstream target of the TRAIL route to apoptosis. Absence of casp 8 prevents cleavage and activation of pro-caspase 3 and decreases the apoptotic potential of the neuroblast.

It, therefore, appears that promoter hypermethylation in cancer has two faces. The data presented in this paper suggest a regulatory role for DcR methylation in the activation of important steps of the apoptosis pathway. This may render potential tumor cells prone to apoptosis and, thus, protect the organism against cancer. In neuroblastomas, it appears that cancer cells have escaped from this fate by methylation and down-regulation casp 8, which blocks the apoptotic pathway downstream of the TRAIL receptors.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Dutch Cancer Society (to M. M. v. N.), and the Stichting Kindergeneeskundig Kankeronderzoek. Back

2 To whom requests for reprints should be addressed, at Department of Human Genetics, Academic Medical Center, Meibergdreef 9, 1105 AZ, Amsterdam, the Netherlands. E-mail: r.versteeg{at}amc.uva.nl Back

3 The abbreviations used are: TNF, tumor necrosis factor; TRAIL, TNF-related apoptosis inducing ligand; DcR, decoy receptor; DR, death receptor; 5-AZA, 5-aza-2'deoxycytidine; PNET, primitive neuro-ectodermal tumor; FACS, fluorescence-activated cell sorting/sorter; RT-PCR, reverse transcription-PCR; MSP, methylation-specific PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; casp 8, caspase 8. Back

Received 11/30/00. Accepted 1/31/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wiley S. R., Schooley K., Smolak P. J., Din W. S., Huang C. P., Nicholl J. K., Sutherland G. R., Smith T. D., Rauch C., Smith C. A. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity, 3: 673-682, 1995.[Medline]
  2. Pitti R. M., Marsters S. A., Ruppert S., Donahue C. J., Moore A., Ashkenazi A. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J. Biol. Chem., 271: 12687-12690, 1996.[Abstract/Free Full Text]
  3. Kischkel F. C., Lawrence D. A., Chuntharapai A., Schow P., Kim K. J., Ashkenazi A. Apo2L/TRAIL-dependent recruitment of endogenous FADD and caspase-8 to death receptors 4 and 5. Immunity, 12: 611-620, 2000.[Medline]
  4. Sprick M. R., Weigand M. A., Rieser E., Rauch C. T., Juo P., Blenis J., Krammer P. H., Walczak H. FADD/MORT1 and caspase-8 are recruited to TRAIL receptors 1 and 2 and are essential for apoptosis mediated by TRAIL receptor 2. Immunity, 12: 599-609, 2000.[Medline]
  5. Pan G., Ni J., Yu G., Wei Y. F., Dixit V. M. TRUNDD, a new member of the TRAIL receptor family that antagonizes TRAIL signalling. FEBS Lett., 424: 41-45, 1998.[Medline]
  6. Pan G., Ni J., Wei Y. F., Yu G., Gentz R., Dixit V. M. An antagonist decoy receptor and a death domain-containing receptor for TRAIL[see comments]. Science (Wash. DC), 277: 815-818, 1997.[Abstract/Free Full Text]
  7. Sheridan J. P., Marsters S. A., Pitti R. M., Gurney A., Skubatch M., Baldwin D., Ramakrishnan L., Gray C. L., Baker K., Wood W. I., Goddard A. D., Godowski P., Ashkenazi A. Control of TRAIL-induced apoptosis by a family of signaling and decoy receptors[see comments]. Science (Wash. DC), 277: 818-821, 1997.[Abstract/Free Full Text]
  8. MacFarlane M., Ahmad M., Srinivasula S. M., Fernandes-Alnemri T., Cohen G. M., Alnemri E. S. Identification and molecular cloning of two novel receptors for the cytotoxic ligand TRAIL. J. Biol. Chem., 272: 25417-25420, 1997.[Abstract/Free Full Text]
  9. Marsters S. A., Sheridan J. P., Pitti R. M., Huang A., Skubatch M., Baldwin D., Yuan J., Gurney A., Goddard A. D., Godowski P., Ashkenazi A. A novel receptor for Apo2L/TRAIL contains a truncated death domain. Curr. Biol., 7: 1003-1006, 1997.[Medline]
  10. Walczak H., Degli-Esposti M. A., Johnson R. S., Smolak P. J., Waugh J. Y., Boiani N., Timour M. S., Gerhart M. J., Schooley K. A., Smith C. A., Goodwin R. G., Rauch C. T. TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J., 16: 5386-5397, 1997.[Medline]
  11. Wu G. S., Burns T. F., McDonald E. R., III, Jiang W., Meng R., Krantz I. D., Kao G., Gan D. D., Zhou J. Y., Muschel R., Hamilton S. R., Spinner N. B., Markowitz S., Wu G., El Deiry W. S. KILLER/DR5 is a DNA damage-inducible p53-regulated death receptor gene. Nat. Genet., 17: 141-143, 1997.[Medline]
  12. Yamanaka T., Shiraki K., Sugimoto K., Ito T., Fujikawa K., Ito M., Takase K., Moriyama M., Nakano T., Suzuki A. Chemotherapeutic agents augment TRAIL-induced apoptosis in human hepatocellular carcinoma cell lines. Hepatology, 32: 482-490, 2000.[Medline]
  13. Zhang X. D., Franco A. V., Nguyen T., Gray C. P., Hersey P. Differential localization and regulation of death and decoy receptors for TNF-related apoptosis-inducing ligand (TRAIL) in human melanoma cells. J. Immunol., 164: 3961-3970, 2000.[Abstract/Free Full Text]
  14. Ashkenazi A., Dixit V. M. Apoptosis control by death and decoy receptors. Curr. Opin. Cell Biol., 11: 255-260, 1999.[Medline]
  15. Griffith T. S., Lynch D. H. TRAIL: a molecule with multiple receptors and control mechanisms. Curr. Opin. Immunol., 10: 559-563, 1998.[Medline]
  16. Sheikh M. S., Huang Y., Fernandez-Salas E. A., El Deiry W. S., Friess H., Amundson S., Yin J., Meltzer S. J., Holbrook N. J., Fornace A. J., Jr. The antiapoptotic decoy receptor TRID/TRAIL-R3 is a p53-regulated DNA damage-inducible gene that is overexpressed in primary tumors of the gastrointestinal tract. Oncogene, 18: 4153-4159, 1999.[Medline]
  17. Teitz T., Wei T., Valentine M. B., Vanin E. F., Grenet J., Valentine V. A., Behm F. G., Look A. T., Lahti J. M., Kidd V. J. Caspase 8 is deleted or silenced preferentially in childhood neuroblastomas with amplification of MYCN[see comments]. Nat. Med., 6: 529-535, 2000.[Medline]
  18. Teitz T., Lahti J. M., Kidd V. J. Aggressive childhood neuroblastomas do not express caspase-8: an important component of programmed cell death. J. Mol. Med., 79: 428-436, 2001.[Medline]
  19. Hopkins-Donaldson S., Bodmer J. L., Bourloud K. B., Brognara C. B., Tschopp J., Gross N. Loss of caspase-8 expression in highly malignant human neuroblastoma cells correlates with resistance to tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis. Cancer Res., 60: 4315-4319, 2000.[Abstract/Free Full Text]
  20. Eggert A., Grotzer M. A., Zuzak T. J., Wiewrodt B. R., Ikegaki N., Brodeur G. M. Resistance to TRAIL-induced apoptosis in neuroblastoma cells correlates with a loss of caspase-8 expression. Med. Pediatr. Oncol., 35: 603-607, 2000.[Medline]
  21. Eggert A., Grotzer M. A., Zuzak T. J., Wiewrodt B. R., Ho R., Ikegaki N., Brodeur G. M. Resistance to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in neuroblastoma cells correlates with a loss of caspase-8 expression. Cancer Res., 61: 1314-1319, 2001.[Abstract/Free Full Text]
  22. Nicoletti I., Migliorati G., Pagliacci M. C., Grignani F., Riccardi C. J. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. Immunol. Methods, 139: 271-279, 1991.[Medline]
  23. Griffith T. S., Chin W. A., Jackson G. C., Lynch D. H., Kubin M. Z. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol., 161: 2833-2840, 1998.[Abstract/Free Full Text]
  24. Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation-specific, PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826, 1996.[Abstract/Free Full Text]
  25. Lee S. H., Shin M. S., Kim H. S., Lee H. K., Park W. S., Kim S. Y., Lee J. H., Han S. Y., Park J. Y., Oh R. R., Jang J. J., Han J. Y., Lee J. Y., Yoo N. J. Alterations of the DR5/TRAIL receptor 2 gene in non-small cell lung cancers. Cancer Res., 59: 5683-5686, 1999.[Abstract/Free Full Text]
  26. Ozoren N., Fisher M. J., Kim K., Liu C. X., Genin A., Shifman Y., Dicker D. T., Spinner N. B., Lisitsyn N. A., El Deiry W. S. Homozygous deletion of the death receptor DR4 gene in a nasopharyngeal cancer cell line is associated with TRAIL resistance. Int. J. Oncol., 16: 917-925, 2000.[Medline]
  27. Wu W. G., Soria J. C., Wang L., Kemp B. L., Mao L. TRAIL-R2 is not correlated with p53 status and is rarely mutated in non-small cell lung cancer. Anticancer Res., 20: 4525-4529, 2000.[Medline]
  28. Evan G. I., Wyllie A. H., Gilbert C. S., Littlewood T. D., Land H., Brooks M., Waters C. M., Penn L. Z., Hancock D. C. Induction of apoptosis in fibroblasts by c-myc protein. Cell, 69: 119-128, 1992.[Medline]
  29. Fulda S., Lutz W., Schwab M., Debatin K. M. MycN sensitizes neuroblastoma cells for drug-induced apoptosis. Oncogene, 18: 1479-1486, 1999.[Medline]
  30. Lutz W., Fulda S., Jeremias I., Debatin K. M., Schwab M. MycN and IFN-{gamma} cooperate in apoptosis of human neuroblastoma cells. Oncogene, 17: 339-346, 1998.[Medline]
  31. Herman J. G., Baylin S. B. Promoter-region hypermethylation and gene silencing in human cancer. Curr. Top. Microbiol. Immunol., 249: 35-54, 2000.[Medline]
  32. Esteller M., Corn P. G., Baylin S. B., Herman J. G. A gene hypermethylation profile of human cancer. Cancer Res., 61: 3225-3229, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
R. Martinez, F. Setien, C. Voelter, S. Casado, M. P. Quesada, G. Schackert, and M. Esteller
CpG island promoter hypermethylation of the pro-apoptotic gene caspase-8 is a common hallmark of relapsed glioblastoma multiforme
Carcinogenesis, June 1, 2007; 28(6): 1264 - 1268.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Q. Yang, C. M. Kiernan, Y. Tian, H. R. Salwen, A. Chlenski, B. A. Brumback, W. B. London, and S. L. Cohn
Methylation of CASP8, DCR2, and HIN-1 in Neuroblastoma Is Associated with Poor Outcome
Clin. Cancer Res., June 1, 2007; 13(11): 3191 - 3197.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Rubio-Moscardo, D. Blesa, C. Mestre, R. Siebert, T. Balasas, A. Benito, A. Rosenwald, J. Climent, J. I. Martinez, M. Schilhabel, et al.
Characterization of 8p21.3 chromosomal deletions in B-cell lymphoma: TRAIL-R1 and TRAIL-R2 as candidate dosage-dependent tumor suppressor genes
Blood, November 1, 2005; 106(9): 3214 - 3222.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Liu, P. Yue, F. R. Khuri, and S.-Y. Sun
Decoy Receptor 2 (DcR2) Is a p53 Target Gene and Regulates Chemosensitivity
Cancer Res., October 15, 2005; 65(20): 9169 - 9175.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. M. Teodoridis, J. Hall, S. Marsh, H. D. Kannall, C. Smyth, J. Curto, N. Siddiqui, H. Gabra, H. L. McLeod, G. Strathdee, et al.
CpG Island Methylation of DNA Damage Response Genes in Advanced Ovarian Cancer
Cancer Res., October 1, 2005; 65(19): 8961 - 8967.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
P. Horak, D. Pils, G. Haller, I. Pribill, M. Roessler, S. Tomek, R. Horvat, R. Zeillinger, C. Zielinski, and M. Krainer
Contribution of Epigenetic Silencing of Tumor Necrosis Factor-Related Apoptosis Inducing Ligand Receptor 1 (DR4) to TRAIL Resistance and Ovarian Cancer
Mol. Cancer Res., June 1, 2005; 3(6): 335 - 343.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Alaminos, V. Davalos, S. Ropero, F. Setien, M. F. Paz, M. Herranz, M. F. Fraga, J. Mora, N.-K. V. Cheung, W. L. Gerald, et al.
EMP3, a Myelin-Related Gene Located in the Critical 19q13.3 Region, Is Epigenetically Silenced and Exhibits Features of a Candidate Tumor Suppressor in Glioma and Neuroblastoma
Cancer Res., April 1, 2005; 65(7): 2565 - 2571.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
C D E Margetts, D Astuti, D C Gentle, W N Cooper, A Cascon, D Catchpoole, M Robledo, H P H Neumann, F Latif, and E R Maher
Epigenetic analysis of HIC1, CASP8, FLIP, TSP1, DCR1, DCR2, DR4, DR5, KvDMR1, H19 and preferential 11p15.5 maternal-allele loss in von Hippel-Lindau and sporadic phaeochromocytomas
Endocr. Relat. Cancer, March 1, 2005; 12(1): 161 - 172.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Mirandola, C. Ponti, G. Gobbi, I. Sponzilli, M. Vaccarezza, L. Cocco, G. Zauli, P. Secchiero, F. A. Manzoli, and M. Vitale
Activated human NK and CD8+ T cells express both TNF-related apoptosis-inducing ligand (TRAIL) and TRAIL receptors but are resistant to TRAIL-mediated cytotoxicity
Blood, October 15, 2004; 104(8): 2418 - 2424.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Takahashi, N. Shivapurkar, E. Riquelme, H. Shigematsu, J. Reddy, M. Suzuki, K. Miyajima, X. Zhou, B. N. Bekele, A. F. Gazdar, et al.
Aberrant Promoter Hypermethylation of Multiple Genes in Gallbladder Carcinoma and Chronic Cholecystitis
Clin. Cancer Res., September 15, 2004; 10(18): 6126 - 6133.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M. Alaminos, V. Davalos, N.-K. V. Cheung, W. L. Gerald, and M. Esteller
Clustering of Gene Hypermethylation Associated With Clinical Risk Groups in Neuroblastoma
J Natl Cancer Inst, August 18, 2004; 96(16): 1208 - 1219.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Shivapurkar, T. Takahashi, J. Reddy, Y. Zheng, V. Stastny, R. Collins, S. Toyooka, M. Suzuki, G. Parikh, S. Asplund, et al.
Presence of Simian Virus 40 DNA Sequences in Human Lymphoid and Hematopoietic Malignancies and Their Relationship to Aberrant Promoter Methylation of Multiple Genes
Cancer Res., June 1, 2004; 64(11): 3757 - 3760.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Takahashi, N. Shivapurkar, J. Reddy, H. Shigematsu, K. Miyajima, M. Suzuki, S. Toyooka, S. Zochbauer-Muller, J. Drach, G. Parikh, et al.
DNA Methylation Profiles of Lymphoid and Hematopoietic Malignancies
Clin. Cancer Res., May 1, 2004; 10(9): 2928 - 2935.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. R. de Almodovar, C. Ruiz-Ruiz, A. Rodriguez, G. Ortiz-Ferron, J. M. Redondo, and A. Lopez-Rivas
Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) Decoy Receptor TRAIL-R3 Is Up-regulated by p53 in Breast Tumor Cells through a Mechanism Involving an Intronic p53-binding Site
J. Biol. Chem., February 6, 2004; 279(6): 4093 - 4101.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. J. Waxman and P. S. Schwartz
Harnessing Apoptosis for Improved Anticancer Gene Therapy
Cancer Res., December 15, 2003; 63(24): 8563 - 8572.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Rathi, A. K. Virmani, K. Harada, C. F. Timmons, K. Miyajima, R. J. Hay, D. Mastrangelo, A. Maitra, G. E. Tomlinson, and A. F. Gazdar
Aberrant Methylation of the HIC1 Promoter Is a Frequent Event in Specific Pediatric Neoplasms
Clin. Cancer Res., September 1, 2003; 9(10): 3674 - 3678.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Yang, M. S. Merchant, M. E. Romero, M. Tsokos, L. H. Wexler, U. Kontny, C. L. Mackall, and C. J. Thiele
Induction of Caspase 8 by Interferon {gamma} Renders Some Neuroblastoma (NB) Cells Sensitive to Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) but Reveals That a Lack of Membrane TR1/TR2 Also Contributes to TRAIL Resistance in NB
Cancer Res., March 1, 2003; 63(5): 1122 - 1129.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Noesel, M. M.
Right arrow Articles by Versteeg, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Noesel, M. M.
Right arrow Articles by Versteeg, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal