| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Department of Human Genetics [M. M. v. N., S. v. B., G. S. S., R. V.], and Department of Pediatric Oncology Emma Kinderziekenhuis [M. M. v. N., P. A. V.], Academic Medical Center, 1105 AZ, Amsterdam, the Netherlands; The Johns Hopkins Oncology Center, Tumor Biology Laboratory, Baltimore, Maryland 21231 [S. B. B., J. G. H., M. M. v. N.]; and Department of Pediatric Oncology/Hematology, Sophia Children’s Hospital/Erasmus University Rotterdam, 3015 GJ, Rotterdam, the Netherlands [M. M. v. N., R. P.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Normal tissues usually express all four of the TRAIL receptors, and this balance prevents TRAIL-induced apoptosis. Cancer cells, on the other hand, often lack expression of the DcRs (6 , 7 , 12) . The unbalance in favor of pro-apoptotic receptors was postulated to determine their increased sensitivity to TRAIL-induced apoptosis. Support for this hypothesis was found in transfection assays in which reexpression of DcR1 in melanoma cells that lacked endogenous DcR1 altered their TRAIL-sensitive phenotype into a TRAIL-resistant one (13) . However, later studies involving multiple cancer cell lines of various origin, and leukemia samples from patients, could not establish a correlation between down-regulation of the DcRs and TRAIL sensitivity, or even a reverse correlation (14, 15, 16) . These conflicting data concerning the role of the DcRs in apoptosis have not yet been clarified.
Apoptotic defects are thought to play a major role in pediatric neuroblastomas. Neuroblastomas are exceptional tumors because they are resistant to TRAIL induction of apoptosis. It has been shown that down-regulation of casp 8 is important in this TRAIL-resistant phenotype (17, 18, 19, 20, 21) . However, not all neuroblastomas have down-regulated casp 8, and little is known about the correlation between expression of the TRAIL receptors and TRAIL sensitivity in neuroblastomas. Here, we studied the expression and methylation status of all four of the TRAIL receptors in a group of pediatric tumor cell lines (nine neuroblastomas and three peripheral PNETs) and cell lines from adult brain, colon, and skin tumors. Our data suggest that hypermethylation of DcR1 and DcR2 is involved in down-regulation of gene expression in tumor cell lines and fresh neuroblastoma tumors.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
TRAIL Treatment, Propidium Iodide Staining, and FACS Analysis.
TRAIL (Prepro Tech Inc., Rocky Hill, NJ; final concentration, 20 ng/ml) treatment was performed in 24-well plates (1–2 x 106 cells/ml of medium). After 24 h, cells were harvested, the medium was removed, and the cells were washed once with PBS and centrifuged at 200 x g. Apoptotic cells were determined by the propidium iodide method (22)
. Briefly, 500 µl of a hypotonic buffer (50 µg/ml propidium iodide in 0.1% sodium citrate plus Triton X-100; Sigma Chemical Co.) was added directly to the cell pellet. The tubes were placed at 4°C in the dark, overnight, before flow cytometry analyses. The propidium iodide fluorescence of individual nuclei was measured using a FACScan flow cytometer (Beckman). At least 1 x 104 cells of each sample were analyzed in triplicate for each sample. Apoptotic nuclei appeared as a broad hypodiploid DNA peak, as compared with the diploid DNA peak (G0 or resting cells) or hyperdiploid DNA peak (G2 or dividing cells). Induction of apoptosis after stimulation with TRAIL was defined as a 2-fold induction or more of baseline apoptosis.
RT-PCR Detection of mRNA.
Total RNA was isolated from cell lines using RNAzol B (Cinna, Biotecx Laboratories Inc.) according to the manufacturer’s protocol. First-strand cDNA synthesis was performed on 2 µg of total RNA in a volume of 20 µl using Superscript II (Life Technologies, Inc.) and oligo(dT). The specific primers used for mRNA amplification were as follows: DR4 (Accession no. GI2460427) forward (315), CCAACAAGACCTAGCTCCCCAGC, and reverse (793), AAGACTACGGCTGCAACTGTGACTCC; DR5 (Accession no. GI1945071) forward (295), GTCCTGCTGCAGGTCGTACC, and reverse (681), GATGTCACTCCAGGGCGTAC; DcR1 (Accession no. GI2338421) forward (205; Ref. 23
), CCCAAAGACCCTAAAGTTCGTC, and reverse (447), GCAAGAAGGTTCATTGTTGGA; DcR2 (Accession no. GI4106963) forward (183), ACCCCAAGATCCTTAAGTTCG, reverse (426), CAAGAAGGCAAATTGTTGGAA; and casp 8 (Accession no. GI4502582) forward (516), GGAAAGGGAACTTCAGACACC, and reverse (850), TCAGCAGGCTCTTGTTGATTT.
Analysis of expression was performed in a 25-µl PCR reaction containing 1 µl of cDNA, 1 µl of dNTP (2.5 mM each), 0.5 µl each of the specific primers (150 ng/µl), and 0.25 µl of Taq DNA polymerase (5 units/µl; Boehringer). PCR conditions were as follows: 1 cycle, 5 min/95°C; 35 cycles, 1 min/95°C, 1 min/60°C, and 1 min/72°C; and 1 cycle, 5 min/72°C. PCR products were loaded on a 4% agarose gel (Metaphor; BioWhittaker Molecular Applications, Rockland, ME), stained with Gelstar nucleic acid gel stain (BioWhittaker Molecular Applications), and directly visualized under UV illumination.
MSP.
Genomic DNA was isolated from cell lines and primary tissues, using standard procedures. Approximately 1 µg of DNA was bisulfite-modified, as described previously (24)
. This treatment converts all unmethylated cytosines into uracil. In the subsequent MSP reaction, all of the uracils become thymidines. The PCR requires primer pairs that specifically recognize methylated or unmethylated sequences. These primers were designed in the 5' untranslated region CpG island of the published sequences. The primer sequences are (5'- to -3'): DcR1, GAATTTTTTTATGTGTATGAATTTAGTTAAT (unmethylated sense), TTACGCGTACGAATTTAGTTAAC (methylated sense), CCATCAAACAACCAAAACA (unmethylated antisense), ATCAACGACCGACCGAAACG (methylated antisense); DcR2, TTGGGGATAAAGTGTTTTGATT (unmethylated sense), GGGATAAAGCGTTTCGATC (methylated sense), AAACCAACAACAAAACCACA (unmethylated antisense), CGACAACAAAACCGCG (methylated antisense); DR4, GTAGTGATTTTGAATTTTGGGAGTGTAGT (unmethylated sense), TTCGAATTTCGGGAGCGTAGC (methylated sense), CTCATAATTCAATCCCCACAA (unmethylated antisense), GTAATTCAATCCTCCCCGCGA (methylated antisense); DR5, TGTTTGAGTAGTGAAAGATTAGTTTGTGTT (unmethylated sense), GAGTAGTGAAAGATTAGTTCGCGTC (methylated sense), ACAACCAAAACATTCTATCCCCA (unmethylated antisense), CCGAAACGTTCTATCCCCG (methylated antisense); and casp 8 (17)
, TAGGGGATTTGGAGATTGTGA (unmethylated sense), TAGGGGATTCGGAGATTGCGA (methylated sense), CCATATATATCTACATTCAAAACAA (unmethylated antisense), CGTATATCTACATTCGAAACGA (methylated antisense).
PCR reactions are hot-started at 95°C for 15 min, by using 0.25 µl (5 units/µl) of HotStarTaq DNA polymerase (Qiagen). Reactions were performed at 60°C annealing temperature. Each PCR reaction was loaded on a 6% nondenaturing polyacrylamide gel, stained with ethidium bromide and directly visualized under UV illumination. Genomic DNA, treated with Sss1 methylase (New England Biolabs; as instructed by manufacturer’s protocol) and after bisulfite modification, was used as positive control for methylated DNA.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Nontransformed, cultured fibroblasts were used as controls. Expression of the receptors was measured by RT-PCR. In the fibroblasts, we found expression of both DcR1 and DcR2. In the tumor cell line panel, DcR1 was down-regulated in 13 (87%) of 15 and DcR2 in 10 (66%) of 15 cell lines (Fig. 1)
. This frequent down-regulation of expression of DcR1 and DcR2 in pediatric tumor cell lines was previously reported for cell lines of adult type of cancers (6, 7, 8
, 13)
. DR4 and DR5 expression was variable. DR4 was expressed in 8 (53%) of 15 cell lines and DR5 was expressed in 12 (80%) of 15 cell lines. Almost all of the cell lines (13 of 15), therefore, expressed at least one of the DRs, DR4 or DR5.
|
|
). However, in six neuroblastoma cell lines, we did not observe any induction of apoptosis after stimulation with TRAIL. Recently, it was shown that many neuroblastomas lack expression of casp 8 and, therefore, are unable to respond to TRAIL (17, 18, 19, 20, 21)
. This casp 8 down-regulation was found to be associated with promoter hypermethylation. We, therefore, checked the casp 8 expression and promoter methylation status for the complete panel. Indeed, casp 8 was not expressed in the TRAIL-resistant neuroblastoma cell lines, whereas robust expression was observed in all TRAIL-responsive cell lines (SK-N-AS, GI-ME-N, SJNB-8, and all non-neuroblastoma cell lines; Fig. 1
and Table 1
). We used MSP to analyze promoter hypermethylation (24)
. Cell lines IMR32, LA-N-1, NMB, KCNR, and LA-N-5 were found to be completely methylated and lacked expression of casp 8. All of the other cell lines with partially or completely unmethylated promoters expressed casp 8 and responded to TRAIL (Fig. 2
and Table 1
). LA-N-6 was an exception because it was not completely methylated, and yet it also did not express casp 8.
|
). All of the cell lines in this subgroup were TRAIL sensitive. They all lacked DcR1 expression, and four of eight lacked DcR2 expression. This means that in this subgroup, down-regulation of DcR1 correlated with TRAIL sensitivity, and DcR2 did not.
Methylation of the TRAIL Receptors.
The almost complete absence of either of the two DcRs, DcR1 and DcR2, in many different tumor types and the variable expression of the DRs urged us to analyze the mechanisms involved in their down-regulation. We looked for promoter hypermethylation, which can selectively down-regulate gene expression, as a mechanism. DcR1 and DcR2 both contained CpG-rich areas near the translation start site. We first analyzed the methylation status of the promoter regions in normal human tissues (heart, liver, lung, muscle, ovary, spleen, kidney) and untransformed fibroblasts (Fig. 3)
. All normal tissues and fibroblasts were completely unmethylated for all four of the TRAIL receptors, except for a faintly methylated DcR2 product in liver tissue, which represented less that 5% of the total DNA. In the tumor cell lines, we found dense promoter methylation (>95%) for DcR1 in 9 (69%) of 13 of nonexpressing cell lines (6 of 7 neuroblastoma cell lines and 3 of 6 non-neuroblastoma cell lines; Fig. 2
and Table 1
). DcR2 was densely methylated in 9 (90%) of 10 nonexpressing cell lines (6 of 7 neuroblastoma cell lines and 3 of 3 non-neuroblastoma cell lines). In addition, methylation of DR4 and DR5 was frequent. DR4 was methylated in 5 (71%) of 7 nonexpressing cell lines, and DR5 in 2 (66%) of 3. Partially methylated gene promoters did not correlate well with a down-regulation of expression, as was also true for casp 8. However, complete promoter methylation correlated in all cases with a lack of expression.
|
. The same 5-AZA-treated cell lines also showed demethylation and reexpression of the DR4 and DR5 genes (data not shown). These results suggest that hypermethylation of the TRAIL receptor promoters plays a causative role in down-regulation of expression. Thus, in neuroblastoma cell lines, five genes within the TRAIL pathway (DcR1, DcR2, DR4, DR5, and casp 8) are subject to epigenetic down-regulation of expression.
|
Methylation of Dcr1, DcR2, DR4, and DR5 in Fresh Neuroblastoma Tumors.
To establish the role of promoter methylation and expression of DcR1 and DcR2 in fresh tumors, we analyzed a panel of 28 neuroblastoma tumors. The neuroblastoma tumor panel contained a variety of all INSS (International Neuroblastoma Staging System) stages 1–4 and 4S, and was randomly chosen from our neuroblastoma tumor bank. Areas of dense tumor tissue (>90%) were selected. To this purpose, we made serial sections of tumor samples and did a microscopic analysis of each fifth section. Sections without detectable normal infiltrating tissue were marked, and DNA and RNA were isolated from the sections in between them. Expression of the studied genes in the tumors was comparable with that in the cell lines. DcR1 was weakly expressed in 5 (18%) of 28 and DcR2 in 8 (29%) of 28 tumors. DcR1 was methylated in 6 (21%) of 28 tumors and DcR2 was methylated in 7 (25%) of 28 tumors (Fig. 5)
. Five of six tumors with methylated DcR1 did not express this gene, as assessed by RT-PCR. The sixth sample showed weak expression only. For DcR2, three of the four methylated samples did not express the gene. These data show that methylated tumor samples have an absent or very weak DcR1 or DcR2 expression. However, many tumors without methylation of the promoter of DcR1 or DcR2 also lack expression of these genes. This suggests that other mechanisms beside methylation operate in tumors to mediate DcR1 and DcR2 down-regulation.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The observed differences between the fresh tumors versus the cell lines may in part be explained by the fact that neuroblastoma cell lines are raised from aggressive neuroblastomas, invariably stage 3 or 4, often associated with amplification of MYCN and/or loss of heterozygosity for chromosome 1p36. The freshly obtained neuroblastoma tumor samples used here also contained specimens from the less aggressive stages 1, 2, and 4S. However, the limited number of cases for each different stage did not permit a conclusive analysis of a possible relation between tumor stage and DcR1 or DcR2 methylation.
Methylation of promoters was assessed by MSP. MSP has established itself as a robust and highly reproducible technique, which allows the screening of large tumor panels. However, only a limited number of CpG-dinucleotides within the PCR primers can be investigated. This limitation can be overcome by using multiple primer pairs within the same CpG-island, as we did for DR4 and DR5. The results were identical (data not shown). Alternatively, sequencing of areas of the CpG-island after bisulfite treatment of the DNA will give a broader insight in the methylation pattern of the island of interest. However, this technique is not suitable for screening of a large tumor panel, as described in this study.
The frequent down-regulation and key position of casp 8 in the apoptosis pathway complicates the analysis of the functional importance of TRAIL receptor expression in apoptosis. Considering only casp 8-expressing cell lines, we could establish a correlation between DcR1 down-regulation and TRAIL sensitivity. The next step would be to functionally test the effect of regained DcR1 and/or DcR2 expression on apoptosis after demethylation in a TRAIL induction assay. Unfortunately, when we demethylated the cell lines by adding 5-AZA to the cell cultures, the background apoptosis level increased from 2–8% to more than 50%. This obviously precluded a reliable comparison of the TRAIL sensitivity between 5-AZA-treated and nontreated cell lines. Even a 3-fold reduction of the 5-AZA concentration could not bring the background apoptosis back to normal levels (data not shown).
The down-regulation of the DcRs in cancer is a puzzling feature, because it renders cancer cells more susceptible to TRAIL-induced apoptosis and, thus, would counteract tumorigenesis. This could be seen as a protective response against tumor formation or progression. In this view, DcR1 and DcR2 down-regulation represents a "physiological" response of the (pre-) cancerous cell to a cellular state, in which a higher level of apoptotic sensitivity is warranted. In light of the many cancer types with down-regulated DcRs, it may be an important threshold against cancer formation. It will be interesting to test whether DcR1 and DcR2 down-regulation is inducible in vitro by cellular transformation with exogenous oncogenes. A precedent to such a regulatory principle is provided by MYC oncogenes, which are known to render cells prone to apoptosis (28, 29, 30) . Currently, we have no clue as to the identity of the genes responsible for down-regulation of DcR1 and 2. However, our results suggest that promoter methylation plays an important role in the mechanism of down-regulation. The mechanistic involvement of the methylation machinery in a physiological cellular response that counteracts carcinogenesis has not been observed previously.
Aberrant methylation and subsequent down-regulation of potential tumor suppressor genes are found in many different cancer types (reviewed in Refs. 31 , 32 ) and are comparable with genetic mutations or deletions of tumor suppressor genes. In contrast to the down-regulation of the DcRs, these changes contribute to the malignant tumor phenotype. In neuroblastomas, casp 8 hypermethylation and down-regulation have also been postulated to be such an oncogenic event (17) . casp 8 is a downstream target of the TRAIL route to apoptosis. Absence of casp 8 prevents cleavage and activation of pro-caspase 3 and decreases the apoptotic potential of the neuroblast.
It, therefore, appears that promoter hypermethylation in cancer has two faces. The data presented in this paper suggest a regulatory role for DcR methylation in the activation of important steps of the apoptosis pathway. This may render potential tumor cells prone to apoptosis and, thus, protect the organism against cancer. In neuroblastomas, it appears that cancer cells have escaped from this fate by methylation and down-regulation casp 8, which blocks the apoptotic pathway downstream of the TRAIL receptors.
|
FOOTNOTES |
|---|
1 Supported by the Dutch Cancer Society (to M. M. v. N.), and the Stichting Kindergeneeskundig Kankeronderzoek. 
2 To whom requests for reprints should be addressed, at Department of Human Genetics, Academic Medical Center, Meibergdreef 9, 1105 AZ, Amsterdam, the Netherlands. E-mail: r.versteeg{at}amc.uva.nl
3 The abbreviations used are: TNF, tumor necrosis factor; TRAIL, TNF-related apoptosis inducing ligand; DcR, decoy receptor; DR, death receptor; 5-AZA, 5-aza-2'deoxycytidine; PNET, primitive neuro-ectodermal tumor; FACS, fluorescence-activated cell sorting/sorter; RT-PCR, reverse transcription-PCR; MSP, methylation-specific PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; casp 8, caspase 8.
Received 11/30/00. Accepted 1/31/02.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
cooperate in apoptosis of human neuroblastoma cells. Oncogene, 17: 339-346, 1998.[Medline]
This article has been cited by other articles:
|
|
 |
|
  R. Martinez, F. Setien, C. Voelter, S. Casado, M. P. Quesada, G. Schackert, and M. Esteller CpG island promoter hypermethylation of the pro-apoptotic gene caspase-8 is a common hallmark of relapsed glioblastoma multiforme Carcinogenesis, June 1, 2007; 28(6): 1264 - 1268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Yang, C. M. Kiernan, Y. Tian, H. R. Salwen, A. Chlenski, B. A. Brumback, W. B. London, and S. L. Cohn Methylation of CASP8, DCR2, and HIN-1 in Neuroblastoma Is Associated with Poor Outcome Clin. Cancer Res., June 1, 2007; 13(11): 3191 - 3197. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Rubio-Moscardo, D. Blesa, C. Mestre, R. Siebert, T. Balasas, A. Benito, A. Rosenwald, J. Climent, J. I. Martinez, M. Schilhabel, et al. Characterization of 8p21.3 chromosomal deletions in B-cell lymphoma: TRAIL-R1 and TRAIL-R2 as candidate dosage-dependent tumor suppressor genes Blood, November 1, 2005; 106(9): 3214 - 3222. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Liu, P. Yue, F. R. Khuri, and S.-Y. Sun Decoy Receptor 2 (DcR2) Is a p53 Target Gene and Regulates Chemosensitivity Cancer Res., October 15, 2005; 65(20): 9169 - 9175. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Teodoridis, J. Hall, S. Marsh, H. D. Kannall, C. Smyth, J. Curto, N. Siddiqui, H. Gabra, H. L. McLeod, G. Strathdee, et al. CpG Island Methylation of DNA Damage Response Genes in Advanced Ovarian Cancer Cancer Res., October 1, 2005; 65(19): 8961 - 8967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Horak, D. Pils, G. Haller, I. Pribill, M. Roessler, S. Tomek, R. Horvat, R. Zeillinger, C. Zielinski, and M. Krainer Contribution of Epigenetic Silencing of Tumor Necrosis Factor-Related Apoptosis Inducing Ligand Receptor 1 (DR4) to TRAIL Resistance and Ovarian Cancer Mol. Cancer Res., June 1, 2005; 3(6): 335 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Alaminos, V. Davalos, S. Ropero, F. Setien, M. F. Paz, M. Herranz, M. F. Fraga, J. Mora, N.-K. V. Cheung, W. L. Gerald, et al. EMP3, a Myelin-Related Gene Located in the Critical 19q13.3 Region, Is Epigenetically Silenced and Exhibits Features of a Candidate Tumor Suppressor in Glioma and Neuroblastoma Cancer Res., April 1, 2005; 65(7): 2565 - 2571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C D E Margetts, D Astuti, D C Gentle, W N Cooper, A Cascon, D Catchpoole, M Robledo, H P H Neumann, F Latif, and E R Maher Epigenetic analysis of HIC1, CASP8, FLIP, TSP1, DCR1, DCR2, DR4, DR5, KvDMR1, H19 and preferential 11p15.5 maternal-allele loss in von Hippel-Lindau and sporadic phaeochromocytomas Endocr. Relat. Cancer, March 1, 2005; 12(1): 161 - 172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Mirandola, C. Ponti, G. Gobbi, I. Sponzilli, M. Vaccarezza, L. Cocco, G. Zauli, P. Secchiero, F. A. Manzoli, and M. Vitale Activated human NK and CD8+ T cells express both TNF-related apoptosis-inducing ligand (TRAIL) and TRAIL receptors but are resistant to TRAIL-mediated cytotoxicity Blood, October 15, 2004; 104(8): 2418 - 2424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Takahashi, N. Shivapurkar, E. Riquelme, H. Shigematsu, J. Reddy, M. Suzuki, K. Miyajima, X. Zhou, B. N. Bekele, A. F. Gazdar, et al. Aberrant Promoter Hypermethylation of Multiple Genes in Gallbladder Carcinoma and Chronic Cholecystitis Clin. Cancer Res., September 15, 2004; 10(18): 6126 - 6133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Alaminos, V. Davalos, N.-K. V. Cheung, W. L. Gerald, and M. Esteller Clustering of Gene Hypermethylation Associated With Clinical Risk Groups in Neuroblastoma J Natl Cancer Inst, August 18, 2004; 96(16): 1208 - 1219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Shivapurkar, T. Takahashi, J. Reddy, Y. Zheng, V. Stastny, R. Collins, S. Toyooka, M. Suzuki, G. Parikh, S. Asplund, et al. Presence of Simian Virus 40 DNA Sequences in Human Lymphoid and Hematopoietic Malignancies and Their Relationship to Aberrant Promoter Methylation of Multiple Genes Cancer Res., June 1, 2004; 64(11): 3757 - 3760. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Takahashi, N. Shivapurkar, J. Reddy, H. Shigematsu, K. Miyajima, M. Suzuki, S. Toyooka, S. Zochbauer-Muller, J. Drach, G. Parikh, et al. DNA Methylation Profiles of Lymphoid and Hematopoietic Malignancies Clin. Cancer Res., May 1, 2004; 10(9): 2928 - 2935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. R. de Almodovar, C. Ruiz-Ruiz, A. Rodriguez, G. Ortiz-Ferron, J. M. Redondo, and A. Lopez-Rivas Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) Decoy Receptor TRAIL-R3 Is Up-regulated by p53 in Breast Tumor Cells through a Mechanism Involving an Intronic p53-binding Site J. Biol. Chem., February 6, 2004; 279(6): 4093 - 4101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Waxman and P. S. Schwartz Harnessing Apoptosis for Improved Anticancer Gene Therapy Cancer Res., December 15, 2003; 63(24): 8563 - 8572. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Rathi, A. K. Virmani, K. Harada, C. F. Timmons, K. Miyajima, R. J. Hay, D. Mastrangelo, A. Maitra, G. E. Tomlinson, and A. F. Gazdar Aberrant Methylation of the HIC1 Promoter Is a Frequent Event in Specific Pediatric Neoplasms Clin. Cancer Res., September 1, 2003; 9(10): 3674 - 3678. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Yang, M. S. Merchant, M. E. Romero, M. Tsokos, L. H. Wexler, U. Kontny, C. L. Mackall, and C. J. Thiele Induction of Caspase 8 by Interferon {gamma} Renders Some Neuroblastoma (NB) Cells Sensitive to Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) but Reveals That a Lack of Membrane TR1/TR2 Also Contributes to TRAIL Resistance in NB Cancer Res., March 1, 2003; 63(5): 1122 - 1129. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal |
