| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Division of Experimental Therapy, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
We showed previously that mouse fibroblast lines lacking functional P-gp and Mrp1 also overexpress mouse Bcrp1 when selected for resistance to topotecan, mitoxantrone, or doxorubicin (3) . Of these, the doxorubicin-selected line KOT52/D320 showed much greater resistance to anthracyclines and bisantrene than the mitoxantrone- or topotecan-selected lines, although the levels of Bcrp1 mRNA were comparable. We now show that this subline and two other fibroblast cell lines independently selected for doxorubicin resistance all harbor mutations altering amino acid 482. Although these mutations result in amino acid substitutions different from those seen in the human cell lines, their effects on drug resistance are remarkably similar.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RNA and DNA Analysis.
Total RNAs were isolated from cell lines and tissues with phenol/guanidine isothiocyanate (Trizol; Life Technologies, Inc., Paisley, Scotland). DNAs were isolated by proteinase K/SDS digestion and phenol-chloroform extraction. RNA and DNA blots on Hybond-N (Amersham Pharmacia Biotech, Little Chalfont, England) were probed with 32P-labeled antisense RNA probes for Bcrp1 or Mrp1, or random-primed cDNA probes for the 18S rRNA or Pim-1, in Ultrahyb buffer (Ambion, Austin, TX) according to the manufacturer’s recommendations. Signal levels were quantified on a phosphorimager (BAS Reader 2000; Fuji, Saitama City, Japan).
Cytotoxicity Assays.
Cells were seeded in 96-well plates at a density (400 or 1000 cells/well, depending on the cell line) that allowed unimpeded growth for at least 4 days. After attachment (4 h), the cells were exposed to a concentration series of drug along the long plate axis, each concentration in quadruplicate, with or without a Bcrp1 inhibitor. After 4 days, while cells were still subconfluent in the untreated wells, proliferation was quantified by fluorescence of Sybr Green I nucleic acid stain (Molecular Probes, Eugene, OR) using a plate reader (Cytofluor 4000; PerSeptive Biosystems, Framingham, MA) with 485 nm excitation and 530 nm emission filters. The Bcrp1 inhibitors included in some assays had no effect alone on cell proliferation at the concentrations used: 200 nM Ko1434
or 400 nM GF120918. These concentrations are adequate to inhibit nearly all of the transport activity of wild-type Bcrp1 for the drugs mitoxantrone and topotecan, representing 
8 times the respective effective concentration for 90% reversal of drug resistance concentrations.4
Drug Accumulation Assays.
Cells were seeded in 24-well plates at 25,000/well. The following day, drug (20 µM daunorubicin or mitoxantrone) or dye (1 µM rhodamine 123) was added in complete medium, and plates were incubated for 1 h at 37°C. All of the subsequent operations were performed on ice to minimize transporter activity, including washing, trypsinization, and centrifugation. Relative intracellular drug or dye levels were determined by flow cytometry (rhodamine 123: 488 nm excitation, 530 nm emission; daunorubicin: 488 nm excitation, 670 nm emission; and mitoxantrone: 633 nm excitation, 661 nm emission).
Sequence Analysis.
Bcrp1 cDNA was synthesized by reverse transcription from cell line total RNAs using specific antisense primer Bcrp1-z: AAGGTAAGTCTAGACAAAGTGCCCATATTTAATTGGAGTAC. Complete coding sequences were amplified with Pfx high fidelity polymerase (Life Technologies, Inc.) using primers Bcrp1-z and Bcrp1-x: GAGTGAGATCTAGAAGGCATAAATCCTAAAGATGTCTTCC. PCR products were sequenced completely on both strands using BigDye Terminator chemistry (ABI-Prism) and additional specific primers. To confirm the presence of the mutations in codon 482, a 420-bp segment was amplified from the cell line cDNAs using primers M13-Bcrp1-S3: TGTAAAACGACGGCCAGTACTTGCTCGGGAACCCTCAAGC and M13R-Bcrp1-AS6: CAGGAAACAGCTATGACCCTATGGCCAGTGCCATGGAACTG. The resulting PCR products were sequenced on both strands using BigDye primer chemistry (ABI-Prism) with M13 and M13-reverse primers.
Transduction of MEF3.8 Cells with Wild-type Bcrp1.
The LZRS-Bcrp1-IRES-GFP construct has been described (8)
. Ecotropic recombinant retrovirus supernatants were produced by calcium-phosphate transfection of Phoenix packaging cells (14)
with the pLZRS-Bcrp1-IRES-GFP construct. MEF3.8 cells were transduced with the supernatants by coincubation for 4 h in the presence of 4 µg/ml Polybrene. After 24 h, 70% of the cells were positive for GFP is GFP+. Single GFP+ cells were sorted into 96-well plates containing MEF3.8-conditioned medium. After expansion, clones were screened for expression of functional Bcrp1 on the basis of reduced mitoxantrone accumulation.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
100 times the starting IC50), over a cumulative period of 8 months or 50 passages. The derivation of the doxorubicin-resistant line KOT52/D320, the topotecan-selected line MEF3.8/T6400, and the mitoxantrone-selected line MEF3.8/M32 has been described (3)
. The latter fibroblast cell lines lack both P-gp and Mrp1, their drug-sensitive parent lines (KOT52 and MEF3.8) having been derived from Mdr1a/1b-/-Mrp1-/- mice. Note that the naming convention for all of these drug-resistant sublines includes the initial of the selecting drug and the concentration, in nM, to which the cells were adapted.
Each of the three doxorubicin-resistant cell lines had highly elevated levels of Bcrp1 mRNA compared with the drug-sensitive parent cell lines, similar to mitoxantrone- or topotecan-selected cell lines (Fig. 1A)
, and each had markedly amplified the Bcrp1 gene locus (Fig. 2A)
. Results are presented for both early and late passages during doxorubicin selection (see legend for Fig. 1
). It is interesting to note that in the resistant lines, Bcrp1 mRNA levels and the gene copy number were not closely correlated, and also did not increase proportionately with adaptation to higher concentrations of doxorubicin (see below for additional discussion).
|
|
. As documented previously (1, 2, 3)
, two such Bcrp1/BCRP transcripts are present in normal mouse and human tissues in ratios that vary with the source. Their physiological significance, if any, is not known, but neither transcript appears to be specifically associated with resistance to any particular drug in drug-selected cell lines, either in the present case or others known. Instability of transcript ratios is not surprising given the corresponding flux in Bcrp1 gene amplification and deletion.
Functional Mrp1 is present in the 88.6 line and its drug-resistant sublines, and mouse Mrp1 can confer resistance to anthracyclines, albeit poorly (15
, 17)
. However, the level of Mrp1 mRNA was not elevated in the doxorubicin-selected sublines (Fig. 1B)
. The KOT52 line and its derivatives have no functional Mrp1 (see above). Neither of two other candidate anthracycline transporters, Mrp2 and Mrp3, could be detected in any of the fibroblast cell lines by Northern analysis, although both mRNAs were readily detected in tissue controls (not shown). Thus, of the known or suspected transporters of anthracyclines, only Bcrp1 is likely to play a part in the observed drug resistance.
Drug Resistance Phenotype of the Doxorubicin-selected Cell Lines.
The cross-resistance properties of early and late passages of the three doxorubicin-resistant sublines are presented in Table 1
. Data published previously for the mitoxantrone- and topotecan-resistant MEF3.8 lines (3)
are reproduced for comparison. The data for the parent lines are in agreement with values we have determined previously (3
, 15)
. It should be noted that the 88.6 cell line expresses some Mrp1 and is consequently somewhat more resistant to various drugs than the KOT52 or MEF3.8 lines. Therefore, relative resistance factors of the 88.6-derived sublines are somewhat lower in these cases.
|
. This is in sharp contrast to the mitoxantrone-selected MEF3.8/M32 and topotecan-selected MEF3.8/T6400 lines, where resistance factors for doxorubicin and bisantrene were 8–20-fold lower than for mitoxantrone.
The differences in anthracycline resistance between these two groups of cell lines were reflected in their relative cellular accumulation of daunorubicin (Fig. 3)
. All of the drug-resistant lines showed low accumulation of mitoxantrone (Fig. 3A)
consistent with high Bcrp1 levels. However, the three doxorubicin-selected cell lines exhibited much lower relative accumulation of daunorubicin than the mitoxantrone- or topotecan-selected lines, or the Bcrp1-transduced MEF3.8 clone A2 (Fig. 3B)
. Note the extensive reversal of this low daunorubicin accumulation, shown in Fig. 3B
, by the highly potent and specific Bcrp1/BCRP inhibitor Ko143, a fumitremorgin C analogue that we developed recently.4
Similar reversals were obtained with the structurally unrelated Bcrp1/BCRP inhibitor GF120918 (Ref. 18
; not shown). Therefore, we conclude that differences in drug resistance between the doxorubicin-selected sublines and the mitoxantrone- or topotecan-selected sublines are mostly the result of differences in the behavior of Bcrp1.
|
; Table 2
). However, the resulting amino acid changes differed from those seen in the human lines, arginine being replaced by methionine in the 88.6/D800-A and KOT52/D320 lines and by serine in the 88.6/D800-B line. The mutations were not evident in the sequence electropherograms of cDNAs from earlier passages of these cell lines, i.e., KOT52/D80, 88.6/D200-A, and 88.6/D200-B (Table 2)
. In contrast, the late passage 88.6/D800-A and 88.6/D800-B lines retained little or no wild-type Bcrp1 mRNA. The KOT52/D320 line contained mutant Bcrp1 mRNA as a minority species (30% of the total Bcrp1 mRNA), of which the relative abundance increased after additional selection for greater resistance to doxorubicin (Fig. 4)
. cDNAs from the topotecan- or mitoxantrone-selected cell lines and all of the drug-sensitive parent cell lines coded for arginine at position 482. No other differences with the sequence of mouse liver Bcrp1 cDNA (3)
were detected in any of the cell lines.
|
|
and 2
), and accompanying doxorubicin resistance (Table 1)
, well before the mutations in codon 482 became apparent (Fig. 4
; Table 2
). This must mean that wild-type Bcrp1 can also mediate significant resistance to doxorubicin, a point that was confirmed using MEF3.8 cells transduced with a retroviral Bcrp1 expression construct. The latter cell line allows the contribution of Bcrp1 to resistance to various drugs to be assessed in the absence of the confounding influences of P-gp and Mrp1, and against a very low background of endogenous Bcrp1. Ectopic Bcrp1 expression in this system conferred modest but significant (4-fold) resistance to doxorubicin (Table 3)
. In comparison, resistance conferred to mitoxantrone or topotecan was roughly 10-fold higher. The same cells showed corresponding differences in accumulation of mitoxantrone and daunorubicin. Comparable drug resistance and drug accumulation results were obtained for Bcrp1-transduced KOT52 cells (not shown).
|
and 2
; Table 1
).
The consequences of such changes for drug resistance can be seen in a comparison of late versus early passages of the 88.6-derived sublines (Table 1)
. During adaptation to a 4-fold increase in doxorubicin concentration (from 200 nM to 800 nM), both sublines became at least 5-fold more resistant to anthracyclines, as expected, and resistance to bisantrene also increased by at least this much. However, resistance to mitoxantrone increased only 2-fold over the same period, whereas resistance to topotecan was substantially decreased, by at least 2-fold. Some of these trends can also be discerned in the history of the KOT52/D320 line although they are obscured to a considerable extent by the presence of a majority of residual wild-type Bcrp1 mRNA in this line. Note that in all of the cases the level of total Bcrp1 mRNA either remained the same or even decreased (Fig. 1)
. Finally, each of the doxorubicin-selected cell lines remained sensitive to the hydrophobic drugs vincristine and paclitaxel (Table 1)
.
Clearly, the mouse Bcrp1 R482M and R482S mutants confer enhanced resistance to anthracyclines compared with the wild-type transporter. The same is true for bisantrene, a structurally related drug. Comparison of the changes in Bcrp1 mRNA levels (Fig. 1)
and the corresponding changes in mitoxantrone resistance suggests that the mutations also enhance resistance to this drug. Resistance to topotecan was at least 10-fold lower, relative to the anthracyclines and bisantrene, in the 88.6-derived R482M and R482S mutant lines, as was found for the human R482G mutant (13)
. In this context it is also noteworthy that cell lines carrying either the R482M or R482S Bcrp1 mutants showed greatly reduced (and Ko143-reversible) accumulation of the dye rhodamine 123 (Fig. 3C)
, as was observed previously for the R482G and R482T mutants of human BCRP (13)
. In contrast, wild-type Bcrp1 did not appreciably lower cellular rhodamine 123 accumulation (Fig. 3C)
.
Efficient Inhibition of Mutant Bcrp1 by Ko143 or GF120918.
Despite these differences in substrate specificity, the drug resistance mediated by mutant Bcrp1 in the doxorubicin-selected cell lines was still effectively reversed (Table 4)
by application of the potent Bcrp1 inhibitor Ko143. This compound had relatively little effect on the drug sensitivity of the parent cell lines KOT52 and 88.6, where Bcrp1 levels are low, but in almost all of the cases it dramatically decreased (or eliminated) the resistance of the three doxorubicin-selected sublines to four drugs, to levels near those of the parent cell lines. Similar results were obtained with the structurally unrelated BCRP inhibitor GF120918 (not shown). As already noted above, these inhibitors also effectively reversed the low cellular accumulation of mitoxantrone, daunorubicin, and rhodamine 123 in the mutant cell lines (Fig. 3)
.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Honjo et al. (13) found previously that human BCRP was mutated at R482 to glycine or threonine in, respectively, mitoxantrone-selected and doxorubicin-selected cell lines. Likewise, these mutations resulted in higher resistance to doxorubicin, possibly lower resistance to topotecan in the R482G mutant, and the capacity to efflux rhodamine 123. The independent mutation of R482 in five different human and mouse cell lines selected for resistance to doxorubicin or mitoxantrone clearly cannot be a coincidence. In all likelihood, substitution of R482 is one of the few, if not the only, readily obtainable mutation in Bcrp1/BCRP that enhances transport of these drugs. The results underscore the conclusion that this amino acid has a key role in determining the substrate specificity in BCRP from both species, possibly by virtue of its tentative strategic location at the cytoplasmic end of transmembrane domain 3 (13) .
It is interesting that the amino acid changes observed thus far [threonine and glycine in human BCRP, methionine (twice), and serine in mouse Bcrp1] represent four of the six amino acid alternatives possible by single-base mutations in codon 482 (AGG) and that all four are uncharged. The other possibilities are tryptophan and lysine. Tryptophan is also uncharged but perhaps too bulky to be accommodated. Lysine, like arginine, is basic and may represent too conservative a change to affect BCRP function noticeably. Of course, it may also be a matter of chance that these two substitutions did not occur yet. In any case, the results suggest that it may be the loss of basic arginine at position 482 that is critical for altering the substrate specificity of Bcrp1/BCRP and not the exact identity of the replacing amino acid. We note in passing that in a zebra fish (Danio rerio) BCRP homologue, arginine is retained at the position equivalent to R482 although the surrounding amino acids are not so well conserved (see contig formed by GenBank expressed sequence tags BF156737, AI497110, and AW018623). This suggests that R482 may also be important for the normal physiological function of BCRP in vertebrates.
Amplification and overexpression of the Bcrp1 gene preceded appearance of the mutations in all three of the doxorubicin-selected cell lines examined herein. Thus, although mutations at the R482 hot spot are evidently highly advantageous for resistance to anthracyclines, wild-type Bcrp1 can also contribute significantly to resistance to these drugs in vitro, and this was confirmed in transduced cells expressing ectopic Bcrp1. To date, no obvious differences have been seen in the substrate specificity or drug resistance conferred by mouse Bcrp1 and human BCRP, if the effects of mutations at R482 are taken into account. Indeed, all of our findings thus far reinforce the similarities of the mouse and human transporters. Hence, although the question remains open as to whether wild-type (or perhaps even R482 mutant) BCRP is a significant source of clinical resistance to anthracyclines in tumors, it is a possibility that cannot be ignored. It is equally possible that wild-type BCRP has a significant impact on the pharmacokinetics of anthracyclines, at least in certain tissues, as is the case for topotecan (8 , 9) . Anthracyclines are good substrates of P-gp, so it is noteworthy that at least one good inhibitor of both P-gp and BCRP (GF120918) is potentially available for reversal of resistance to anthracyclines or modulation of their pharmacokinetics. In this regard, it is significant that the anthracycline resistance of the Bcrp1 mutants considered here was still effectively inhibited by GF120918 and the specific BCRP inhibitor Ko143, although we have not investigated in great detail whether the efficiency of inhibition might have been reduced for some drugs. Both GF120918 and Ko1434 can be used p.o. in vivo at dosages high enough to inhibit BCRP/Bcrp1 function (8 , 9) . Thus, it is clear that potential clinical use of these BCRP inhibitors is unlikely to be seriously compromised by the presence of mutations at R482, should they occur in doxorubicin-treated tumors.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by Dutch Cancer Society Grant NKI 97-1433. 
2 To whom requests for reprints should be addressed, at Division of Experimental Therapy, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, the Netherlands. Phone: 31-20-512-2046; Fax: 31-20-512-2050; E-mail: a.schinkel{at}nki.nl
3 The abbreviations used are: ABC, ATP-binding cassette; BCRP, breast cancer resistance protein; Bcrp1, mouse cognate of breast cancer resistance protein; MRP, multidrug resistance protein; P-gp, P-glycoprotein; GFP, green fluorescent protein.
4 J. D. Allen, A. van Loevezijn, J. M. Lakhai, M. van der Valk, O. van Tellingen, G. Reid, J. H. M. Schellens, G-J. Koomen, and A. H. Schinkel. Potent and specific inhibition of the breast cancer resistance protein multidrug transporter in vitro and in mouse intestine by a novel analogue of fumitremorgin C, Mol. Cancer Ther., in press.
Received 11/14/01. Accepted 2/14/02.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  U. D. Lichtenauer, I. Shapiro, K. Geiger, M. Quinkler, M. Fassnacht, R. Nitschke, K.-D. Ruckauer, and F. Beuschlein Side Population Does Not Define Stem Cell-Like Cancer Cells in the Adrenocortical Carcinoma Cell Line NCI h295R Endocrinology, March 1, 2008; 149(3): 1314 - 1322. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Kruger, C. D. Kaplan, Y. Luo, H. Zhou, D. Markowitz, R. Xiang, and R. A. Reisfeld Characterization of stem cell-like cancer cells in immune-competent mice Blood, December 1, 2006; 108(12): 3906 - 3912. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Sarkadi, L. Homolya, G. Szakacs, and A. Varadi Human Multidrug Resistance ABCB and ABCG Transporters: Participation in a Chemoimmunity Defense System. Physiol Rev, October 1, 2006; 86(4): 1179 - 1236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Chearwae, S. Shukla, P. Limtrakul, and S. V. Ambudkar Modulation of the function of the multidrug resistance-linked ATP-binding cassette transporter ABCG2 by the cancer chemopreventive agent curcumin. Mol. Cancer Ther., August 1, 2006; 5(8): 1995 - 2006. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Shafran, I. Ifergan, E. Bram, G. Jansen, I. Kathmann, G. J. Peters, R. W. Robey, S. E. Bates, and Y. G. Assaraf ABCG2 Harboring the Gly482 Mutation Confers High-Level Resistance to Various Hydrophilic Antifolates Cancer Res., September 15, 2005; 65(18): 8414 - 8422. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Q. Xia, N. Liu, D. Yang, G. Miwa, and L.-S. Gan EXPRESSION, LOCALIZATION, AND FUNCTIONAL CHARACTERISTICS OF BREAST CANCER RESISTANCE PROTEIN IN CACO-2 CELLS Drug Metab. Dispos., May 1, 2005; 33(5): 637 - 643. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. F. K. Ejendal and C. A. Hrycyna Differential Sensitivities of the Human ATP-Binding Cassette Transporters ABCG2 and P-Glycoprotein to Cyclosporin A Mol. Pharmacol., March 1, 2005; 67(3): 902 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Kobayashi, I. Ieiri, T. Hirota, H. Takane, S. Maegawa, J. Kigawa, H. Suzuki, E. Nanba, M. Oshimura, N. Terakawa, et al. FUNCTIONAL ASSESSMENT OF ABCG2 (BCRP) GENE POLYMORPHISMS TO PROTEIN EXPRESSION IN HUMAN PLACENTA Drug Metab. Dispos., January 1, 2005; 33(1): 94 - 101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Pavek, G. Merino, E. Wagenaar, E. Bolscher, M. Novotna, J. W. Jonker, and A. H. Schinkel Human Breast Cancer Resistance Protein: Interactions with Steroid Drugs, Hormones, the Dietary Carcinogen 2-Amino-1-methyl-6-phenylimidazo(4,5-b)pyridine, and Transport of Cimetidine J. Pharmacol. Exp. Ther., January 1, 2005; 312(1): 144 - 152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Burger, H. van Tol, A. W. M. Boersma, M. Brok, E. A. C. Wiemer, G. Stoter, and K. Nooter Imatinib mesylate (STI571) is a substrate for the breast cancer resistance protein (BCRP)/ABCG2 drug pump Blood, November 1, 2004; 104(9): 2940 - 2942. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Bates, W. Y. Medina-Perez, G. Kohlhagen, S. Antony, T. Nadjem, R. W. Robey, and Y. Pommier ABCG2 Mediates Differential Resistance to SN-38 (7-Ethyl-10-hydroxycamptothecin) and Homocamptothecins J. Pharmacol. Exp. Ther., August 1, 2004; 310(2): 836 - 842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. van Zon, M. H. Mossink, M. Schoester, R. J. Scheper, P. Sonneveld, and E. A. C. Wiemer Efflux Kinetics and Intracellular Distribution of Daunorubicin Are Not Affected by Major Vault Protein/Lung Resistance-Related Protein (Vault) Expression Cancer Res., July 15, 2004; 64(14): 4887 - 4892. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gupta, Y. Zhang, J. D. Unadkat, and Q. Mao HIV Protease Inhibitors Are Inhibitors but Not Substrates of the Human Breast Cancer Resistance Protein (BCRP/ABCG2) J. Pharmacol. Exp. Ther., July 1, 2004; 310(1): 334 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cisternino, C. Mercier, F. Bourasset, F. Roux, and J.-M. Scherrmann Expression, Up-Regulation, and Transport Activity of the Multidrug-Resistance Protein Abcg2 at the Mouse Blood-Brain Barrier Cancer Res., May 1, 2004; 64(9): 3296 - 3301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. W. Robey, K. Steadman, O. Polgar, K. Morisaki, M. Blayney, P. Mistry, and S. E. Bates Pheophorbide a Is a Specific Probe for ABCG2 Function and Inhibition Cancer Res., February 15, 2004; 64(4): 1242 - 1246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Volk and E. Schneider Wild-Type Breast Cancer Resistance Protein (BCRP/ABCG2) is a Methotrexate Polyglutamate Transporter Cancer Res., September 1, 2003; 63(17): 5538 - 5543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wierdl, A. Wall, C. L. Morton, J. Sampath, M. K. Danks, J. D. Schuetz, and P. M. Potter Carboxylesterase-Mediated Sensitization of Human Tumor Cells to CPT-11 Cannot Override ABCG2-Mediated Drug Resistance Mol. Pharmacol., August 1, 2003; 64(2): 279 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nakanishi, J. E. Karp, M. Tan, L. A. Doyle, T. Peters, W. Yang, D. Wei, and D. D. Ross Quantitative Analysis of Breast Cancer Resistance Protein and Cellular Resistance to Flavopiridol in Acute Leukemia Patients Clin. Cancer Res., August 1, 2003; 9(9): 3320 - 3328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-S. Chen, R. W. Robey, M. G. Belinsky, I. Shchaveleva, X.-Q. Ren, Y. Sugimoto, D. D. Ross, S. E. Bates, and G. D. Kruh Transport of Methotrexate, Methotrexate Polyglutamates, and 17{beta}-Estradiol 17-({beta}-D-glucuronide) by ABCG2: Effects of Acquired Mutations at R482 on Methotrexate Transport Cancer Res., July 15, 2003; 63(14): 4048 - 4054. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Lockhart, R. G. Tirona, and R. B. Kim Pharmacogenetics of ATP-binding Cassette Transporters in Cancer and Chemotherapy Mol. Cancer Ther., July 1, 2003; 2(7): 685 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Rajendra, M. K. Gounder, A. Saleem, J. H. M. Schellens, D. D. Ross, S. E. Bates, P. Sinko, and E. H. Rubin Differential Effects of the Breast Cancer Resistance Protein on the Cellular Accumulation and Cytotoxicity of 9-Aminocamptothecin and 9-Nitrocamptothecin Cancer Res., June 15, 2003; 63(12): 3228 - 3233. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Allen, S. C. van Dort, M. Buitelaar, O. van Tellingen, and A. H. Schinkel Mouse Breast Cancer Resistance Protein (Bcrp1/Abcg2) Mediates Etoposide Resistance and Transport, but Etoposide Oral Availability Is Limited Primarily by P-glycoprotein Cancer Res., March 15, 2003; 63(6): 1339 - 1344. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Ozvegy, A. Varadi, and B. Sarkadi Characterization of Drug Transport, ATP Hydrolysis, and Nucleotide Trapping by the Human ABCG2 Multidrug Transporter. MODULATION OF SUBSTRATE SPECIFICITY BY A POINT MUTATION J. Biol. Chem., December 6, 2002; 277(50): 47980 - 47990. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. W. Jonker, M. Buitelaar, E. Wagenaar, M. A. van der Valk, G. L. Scheffer, R. J. Scheper, T. Plosch, F. Kuipers, R. P. J. O. Elferink, H. Rosing, et al. The breast cancer resistance protein protects against a major chlorophyll-derived dietary phototoxin and protoporphyria PNAS, November 26, 2002; 99(24): 15649 - 15654. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Volk, K. M. Farley, Y. Wu, F. Li, R. W. Robey, and E. Schneider Overexpression of Wild-Type Breast Cancer Resistance Protein Mediates Methotrexate Resistance Cancer Res., September 1, 2002; 62(17): 5035 - 5040. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
