Cancer Research Annual Meeting 2010  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cao, D.
Right arrow Articles by Pizzorno, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, D.
Right arrow Articles by Pizzorno, G.
[Cancer Research 62, 2313-2317, April 15, 2002]
© 2002 American Association for Cancer Research


Experimental Therapeutics

Uridine Phosphorylase (-/-) Murine Embryonic Stem Cells Clarify the Key Role of this Enzyme in the Regulation of the Pyrimidine Salvage Pathway and in the Activation of Fluoropyrimidines1

Deliang Cao, Rosalind L. Russell, Dekai Zhang, Janine J. Leffert and Giuseppe Pizzorno2

Departments of Internal Medicine and Pharmacology, Yale University School of Medicine, New Haven, Connecticut 06520


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have reported the elevation of uridine phosphorylase (UPase) in manysolid tumors and the presence of a variant phosphorolytic activity in breast cancer tissues (M. Liu et al., Cancer Res., 58: 5418–5424, 1998). To better understand the biological and pharmacological significance of these findings, we have developed an UPase gene knockout embryonic stem (ES) cell model by specific gene targeting techniques. In this cellular model, we establish the critical role of UPase as an important anabolic enzyme in 5-fluorouracil (5-FU) activation and pyrimidine salvage pathway regulation. It has long been known that UPase regulates the plasma concentration of uridine; however, little is known of the role of UPase in the activation and metabolism of 5-FU and its derivatives, mainly because of the lack of an appropriate model system. The experimental data indicate that the disruption of UPase activity in murine ES cells leads to a 10-fold increase in 5-FU IC50 and a 2–3-fold reduction in its incorporation into nucleic acids, whereas no differences in toxicity is seen with other pyrimidine nucleoside analogues such as 5-fluorouridine, 2'-deoxy-5-fluorouridine, and 1-ß-D-arabinofuranosylcytosine compared with WT (wild-type) ES cells. Benzylacyclouridine can specifically prevent the WT ES cells from the sensitivity of 5-FU. Our data also shows the effect of UPase on the cytotoxicity of 5'-deoxy-5-fluorouridine (5'DFUR), a 5-FU prodrug. The IC50 is increased almost 16-fold in the knockout cells compared with the wild type cells, demonstrating the role of UPase in catalyzing the conversion of 5'DFUR to 5-FU. These findings additionally elucidate the tumor-specific selectivity of capecitabine, the oral fluoropyrimidine prodrug approved for the treatment of metastatic breast and colorectal cancers.

Not only do the knockout cells present a decreased incorporation of 5-FU into nucleic acids but also an increased reliance on the pyrimidine salvage pathway. The reduced dependence of UPase knockout cells on the pyrimidine de novo synthesis is reflected in the apparent resistance to phosphonacetyl-L-aspartic acid, a specific inhibitor of pyrimidine pathway, with a 5-fold elevation in its IC50 in UPase-nullified cells compared with WT. In summary, we have successfully generated an UPase gene knockout cell model that presents reduced sensitivity to 5-FU, 5'DFUR, and phosphonacetyl-L-aspartic acid, although it does not affect the basic cellular physiology under normal tissue culture conditions. Considering the role of UPase in 5-FU metabolism and the elevated expression of this protein in cancer cells compared with paired normal tissues, additional investigation should be warranted to firmly establish the clinical role of UPase in the tumor selective activation of 5-FU and capecitabine.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
5-FU3 still represents one of the most active antitumor agents in the treatment of solid tumors such as breast, colon, and head and neck cancers. Two main mechanisms of action contribute to the cytotoxic effect of 5-FU: (a) DNA-directed toxicity, where the formed 5-fluoro-dUMP tightly binds to thymidylate synthetase, resulting in inhibition of DNA synthesis and cell growth with a minor role played by DNA incorporation of the fluorodeoxynucleotides leading to the fragmentation of DNA and cell death; and (b) RNA-directed cytotoxicity with 5-FU incorporation into various RNA species, including polysomal RNA, nuclear RNA, and mRNA, thereby disrupting RNA maturation and functions (1, 2, 3) .

Whereas the mechanisms of action have been well established, the contribution of the different pathways to 5-FU activation is still controversial because of the lack of an appropriate model system. 5-FU can be converted to 5-FUMP via the OPRTase pathway in the presence of phosphoribosyl PPi or activated to 5-fluorouridine first and then to 5-FUMP via the UPase-kinase salvage pathway in the presence of R-1-P. 5-FU can also be converted to 5-fluorodeoxyuridine by TPase and then to 5-fluoro-dUMP by TK (1 , 4) . Some investigators have proposed that OPRTase plays a main role in the activation of 5-FU because of the limited pool of R-1-P available in the cells (5) . However, Schwartz et al. (6) indicated that UPase is a critical enzyme in activation of 5-FU. This controversy arises from the presence of both UPase and OPRTase in the experimental models investigated thus far.

The clinical effectiveness of 5-FU is limited by its severe side effects such as myelosuppression, thrombocytopenia, and gastrointestinal lesions. Uridine has been used to reduce 5-FU toxicity leading to an increased therapeutic index (7) . Several preclinical studies and clinical trials have demonstrated the ability of uridine to selectively protect normal tissues from 5-FU host toxicity. However, the clinical use of uridine rescue is hampered by its rapid clearance via degradation initiated by UPase in liver and dose-limiting toxicities resulting from high dose administration of uridine necessary to obtain the desired concentration for tissue protection. BAU, developed as an inhibitor of UPase, has been shown to be able to increase plasma uridine concentration by conserving endogenous uridine leading to similar protection of normal tissues (8, 9, 10) . Finally, UPase was found to be elevated in most human tumors, and we have identified variant forms of UPase, particularly in breast tumors with various degrees of insensitivity to BAU providing the rationale for the increased selectivity of 5-FU-based therapy in these tumors (11) . Currently, we have developed an UPase knockout ES cell model through gene targeting technology. Because of its clear genetic background, this model will provide a significant tool to elucidate the biological function of UPase and its role in 5-FU activation and uridine metabolism in cells. Here we report the effects of UPase disruption on pyrimidine metabolism and 5-FU antiproliferation.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
Undifferentiated WT 129/JV ES murine cells and UPase knockout clones were maintained in gelatinized tissue culture flasks with high glucose DMEM supplemented with 15% heat-inactivated fetal bovine serum, 2 mM glutamine, 0.1 mM ß-mercaptoethanol, and 1000 units/ml of recombinant leukemia inhibitory factors (Life Technology, Inc., Grand Island, NY) at 37°C and 5% CO2.

Construction of MUP Gene Targeting Vector and Selection of UPase Mutants.
A 8.5-kb EcoRI-XhoI genomic DNA fragment containing the whole MUP gene (12) was subcloned into pBluescript KS II vector (Stratagene, La Jolla, CA). To disrupt UPase gene, we replaced with a 1.6-kb NEO gene (a positive selection marker) expression cassette a 2.5-kb fragment of UPase gene, which includes the 3' part of intron 3, the whole exon 4 and intron 4, and the 5' part of exon 5. The MUP/NEO fragment was subsequently inserted into a vector containing herpes simplex virus TK gene cassette, a negative selection marker, to exclude the nonrecombination (nontargeted) mutants, generating the targeting construct (Fig. 1)Citation .



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Targeted disruption of UPase locus. A, partial restriction map of UPase locus in genome, targeting vector, and the targeted allele. A 2.5-kb genomic fragment of MUP (NheI-ApaI) was replaced by a 1.6-kb NEO cassette. TK gene cassette was flanked at 3' end. Arrows indicate the orientations. TV, targeting vector; WT, wild type allele; and MT, mutant allele. A, ApaI; B, BamHI; E, EcoRI; (N), NheI and (X), XbaI, both were blunted; and X, XhoI. KO5' (5'CGGCTTTATACATGGCGTAGCG) and KO3' (5'GTGATGGTTTTCAAGGTCCTTTGC) are primers for PCR screening of mutants. B, Southern blot analysis of the UPase gene locus. The genomic DNA was digested by BamHI, and the blot was hybridized with the 600-bp PCR fragment immediately outside of XhoI cloning site. The WT band is ~18 kb, and the length of the disrupted allele is 4 kb, because of the introduction of a BamHI site in NEO cassette. Left, molecular size markers. Lane 1, WT; Lane 2 single knockout clone; and Lanes 3 and 4, two double knockout clones.

 
The linearized MUP/NEO/TK Bluescript targeting construct was introduced by electroporation into 129/JV ES cells and the clones doubly selected by G418 and ganciclovir for the presence of NEO gene and absence of TK gene. The ES clones carrying the mutant UPase gene were identified by PCR and Southern blot. Double knockout cells (two alleles disrupted) were generated by exposing the clones to high concentrations of G418 up to 5.5 mg/ml (13) .

Western Blot Analysis.
ES cells were solubilized in 2x SDS gel loading buffer [50 mM Tris-Cl (pH 6.8), 100 mM dithiothreitol, 2% (w/v) SDS, 0.1% bromophenol blue, and 10% (v/v) glycerol], and the lysate was separated on a 15% SDS-PAGE and then transferred to polyvinylidene difluoride membrane (Hybond P; Amersham). UPase was detected using a polyclonal anti-UPase antibody generated in our laboratory diluted 1:100 in casein buffer [5% casein, 0.05% Triton X-100, 0.3 M NaCl, 50 mM citric acid, 0.3 M Tris base (pH 7.6)]. The membrane was reprobed by commercial antiactin monoclonal antibody to evaluate the amount of the protein loaded.

Cell Growth and Drug Sensitivity Assay.
Cell growth rate was measured using a Cell Proliferation kit (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt; Boehringer Mannheim, Indianapolis, IN) in 96-well plates and absorbance at 500 nm, indicating the viable cell number, was determined with a Titertek Multiskan MCC340 (Huntsville, AL) microplate reader, using A750 as an internal control. The drug sensitivity assays were performed similarly as above. Next, 3000 cells/well were plated in gelatinized 96-well tissue culture plates. After overnight incubation, cells were treated with different drugs and harvested at indicated time points. Each concentration point was replicated in six wells, and all of the experiments were repeated at least twice.

Enzyme Activity Assays.
UPase activity was measured by uridine conversion to uracil using a Tris-HCl lysate (11) incubated with 200 µM [3 H]uridine and 1 mM potassium phosphate. The UPase product, [3 H]uracil, was separated on silica TLC plates (Kieselgel 60; Merck) using an 85:15:5 mixture of chloroform, methanol, and acetic acid, respectively. Protein amounts were determined with protein assay dye (Bio-Rad Laboratories, Hercules, CA). TPase activity was similarly analyzed using 200 µM [3 H]thymidine as a substrate (11) .

OPRTase activity was assayed by measuring the conversion of [14C]fluorouracil into FUMP in the presence of 200 µM [14C]fluorouracil, 1 mM phosphoribosyl PPI, and 100 µM MgCl2 (3) .

Uridine kinase was determined by the conversion of [3 H]uridine into [3 H]UMP with 200 µM [3 H]uridine, 1 mM ATP, and 100 µM MgCl2 (3) .

R-1-P concentration was measured in the presence of 50 µM [14C]fluorouracil and 5 µg pure recombinant UPase protein followed by TLC separation as indicated above (11) .

Incorporation of [3H]5-FU and [3H]Uridine into Nucleic Acids and Measurement of Ribonucleotide Triphosphate Pools.
Cells (5 x 105/flask) were incubated for 24 h in medium containing [3H]5-FU (5 µM) or [3H]uridine (2 µM), washed twice with cold PBS, and the macromolecular precipitated with 15% trichloroacetic acid. The final precipitates were dissolved in tissue solubilizer (TS-1) and the radioactivity determined.

The cell supernatants obtained with the TCA precipitation were neutralized 1 N trioctylamine in freon. The nucleoside triphosphates were eluted isocratically on an high-performance liquid chromatography anion exchange column (Partisil-10-SAX; Altex) using 0.4 M NH4H2PO4 (pH 4.5) as mobile phase.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Targeted Disruption of the MUP Gene and Abrogation of UPase Expression in ES Cells.
To disrupt the MUP gene and abrogate the expression of its functional product, we replaced a 2.5-kb fragment of the UPase gene, which contains the 3' part of intron 3, the whole exon 4 and intron 4, and the 5' part of exon 5, with a 1.6-kb NEO gene cassette, leading to a 92 and 1/3 amino acid deletion, and a shifting mutation of downstream codons (out of frame). After a TK gene expression cassette was flanked at the 3' end of the UPase gene fragment, the linearized targeting construct was electroporated into murine 129/JV ES cells. The transfected cells were then exposed to G418 and ganciclovir to select for the targeted UPase mutant clones. Analysis of 38 survival clones by PCR and Southern blot hybridization indicated that 13 of them underwent a correct homologous recombination, resulting in the targeted UPase gene disruption (data not shown). Clone DL362 containing the single allele UPase mutation was expanded and exposed at 5.5 mg/ml G418 for 2 weeks to select for UPase double allele knockout clones (13) . The resultant 50 clones were subjected to Southern blot analysis, and 5 of them were found to have the targeted disruption at both alleles (Fig. 1)Citation .

The expression products of the disrupted UPase gene were evaluated in two double knockout clones, DL16 and 22, and their parental single knockout cell clone DL362. A WT parental 129/JV ES clone was also used as a control. A 600-bp UPase cDNA probe, corresponding to exons 3–7, identified a 1.4-kb UPase RNA in WT and single knockout cells. This RNA species was not detectable in the two double knockout clones DL16 and 22. The abundance of UPase mRNA in single knockout cells was ~50% of the WT control cells indicating that the UPase gene disruption results in the reduction of the mRNA transcripts (Fig. 2)Citation . To evaluate whether any translation compensation occurs in single knockout cells and exclude the possibility that the truncated and shifted UPase protein was still expressed in the double allele knockout cells, Western blot analysis was performed using an anti-UPase polyclonal antibody generated in our laboratory (11) . The data indicate that the expression of the UPase protein was abrogated in the two double knockout clones and halved in the single knockout clone DL362 (Fig. 2)Citation . UPase activity was also assayed in these cell extracts indicating that no activity was present in the two double knockout clones, and the uridine conversion was reduced to 50% in single knockout cells compared with the WT control cells (Fig. 2)Citation .



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. UPase gene expression in the knockout clones. A, Northern blot analysis of UPase gene transcripts. Total RNA (10 µg) was used in each lane, and the blot was sequentially probed with mouse UPase and ß-actin cDNA random-labeled with 32P. A 1.4-kb RNA band is seen in WT and single knockout (halved in density) cells but not detectable in double knockout cells. Lane 1, WT; Lane 2, single knockout clone; and Lanes 3 and 4, two double knockout clones. B, Western blot analysis of UPase protein. Total cell lysates were separated on 15% SDS-PAGE, and the protein blot was hybridized sequentially with UPase polyclonal and ß-actin monoclonal antibodies. A Mr 36,000 protein band is seen in WT and single knockout cell lysates but not in the double knockout cell lysate. Lanes 1 and 2, WT; Lanes 3 and 4 single knockout clone; Lanes 5, and 6, double knockout clone DL16; and Lanes 7 and 8, double knockout clone DL22. C, UPase activity assays. The cell lysates from WT and knockout cell clones were used to check the ability to convert [3H]uridine to [3H]uracil. The activity is expressed in nmol/mg protein/min.

 
To analyze the effects of UPase gene disruption on cellular physiological function, the double knockout clones DL16 and 22, the single knockout clone DL362, and a WT clone were cultured and assayed in regular medium to determine any change in their proliferative rate. We did not observe any obvious difference in growth rate between WT and knockout cells (data not shown). Moreover, the sizes of both pyrimidine and purine ribonucleotide pools did not change, and the Na+-dependent active transport of uridine was not affected (data not shown). More interestingly, the intracellular level of R-1-P, a cosubstrate in the phosphorolytic reaction, was not significantly altered in the knockout clones with a concentration of 2 ± 0.15 nmol/mg of proteins in the WT cells and 2.23 ± 0.19 nmol/mg of proteins in the double knockout cells.

UPase Knockout Cells: Effect on Sensitivity to Pyrimidine Analogues.
To elucidate the effects of the disruption of UPase activity on cell drug sensitivity, double knockout clones DL16 and 22, the single knockout clone DL362, and the WT ES clone were tested against five pyrimidine analogues and a DNA intercalating antitumor agent, doxorubicin. A 72-h exposure to 5-FU indicated a reduced sensitivity to this pyrimidine antimetabolite with a 10-fold increase in IC50 from 0.2 µM for the WT cells to 2.0 µM for the two UPase double knockout clones (Fig. 3)Citation . The single knockout cells still maintained sensitivity to 5-FU with an IC50 of 0.35 µM. This difference in sensitivity is reflected in the 5-FU incorporation into the nucleic acids of these double knockout cells with a reduction of 2–3-fold compared with the WT cells (Table 1)Citation . When the cells were exposed simultaneously to 5-FU in the presence of the specific UPase inhibitor BAU (50 µM), we observed a reduction in 5-FU activity in both WT and UPase single knockout ES cells with IC50s similar to the ones determined for the double knockout clones. The main drawback of the antineoplastic activity of 5-FU is its toxic effect against normal tissues, mostly gastrointestinal mucosa and hematopoietic system. One of the strategies to reduce the toxic side effects of 5-FU has been to administer a nontoxic prodrug that can be selectively activated at tumor level. 5'DFUR represents one of these examples (5 , 14) . Our results indicated that WT and UPase single knockout cells were much more sensitive to 5'DFUR than the double knockout cells, with IC50 of 0.5, 2.5, and 8.0 µM for the WT, single knockout, and double knockout cells, respectively (Fig. 4)Citation , establishing the importance of UPase in the activation of 5'DFUR. The abrogation of UPase had no effects on the cytotoxicity of 2'-deoxy-5-fluorouridine, mainly activated by TK, and 1-ß-D-arabinofuranosylcytosine, a deoxycytidine analogue. UPase activity also did not affect the cytotoxic activity of a DNA intercalator and topoisomerase inhibitor such as doxorubicin (data not shown).



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Antiproliferative activity of 5-FU in WT and knockout ES cells. The WT and knockout ES cells were exposed to different concentration of 5-FU for 72 h, and the amount of viable cells are determined by cell proliferation kit (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt). Each column represents the mean of three experiments; bars, ± SD. *, significantly different from the double knockout cells given the same treatment (P < 0.001, unpaired t test), **, significantly different from both single (P < 0.05) and double (P < 0.001) knockout cells (unpaired t test).

 

View this table:
[in this window]
[in a new window]

 
Table 1 Incorporation of radio-labeled 5-FU and uridine

 


View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Role of UPase in the activation of 5'DFUR. WT and knockout ES cells were exposed to different concentration of 5'DFUR for 72 h, and the cell were treated as described in Fig. 4Citation . Each column represents the mean of three separate experiments; bars, ± SD. *, significantly different from the double knockout cells given the same treatment (P < 0.01, unpaired t test); **, significantly different from both single (P < 0.01) and double (P < 0.001) knockout cells (unpaired t test).

 
Role of UPase Activity on Pyrimidine Salvage Pathway.
PALA, a transitional state analogue, intermediate in the condensation of carbamylphosphate with L-aspartic acid, can efficiently inhibit the pyrimidine de novo synthesis and deplete the pyrimidine nucleotide pools via inhibition of aspartate transcarbamylase (15) . Our data demonstrate that the disruption of UPase activity causes an increase in the IC50 of PALA from 50 µM in WT ES cells to >2000 µM for the double knockout cells (Fig. 5)Citation , indicating the diminished role of the de novo pyrimidine synthesis in this knockout cell model. This is confirmed by the increased uridine incorporation (Table 1)Citation and uridine kinase activity (Table 2)Citation . As expected, uridine rescue (50 µM) could efficiently protect both WT and single knockout cells from PALA toxicity (data not shown). The elevated uridine kinase activity observed in the UPase double knockout cells is reflected in an increased sensitivity of these murine ES subpopulations to 5-fluorouridine, a direct substrate for uridine kinase. The 0.05 µM ED50 of 5-fluorouridine in WT ES cells was reduced to 0.02 µM in both UPase double knockout clones. No change in sensitivity to 5-fluorouridine was observed in the UPase single knockout ES cells that did not display any significant alteration in uridine kinase activity. The analysis of TPase, an enzyme that despite a lower efficiency shares substrate specificity with UPase, surprisingly revealed that no detectable activity was present in WT ES cells, and no induction was observed in the UPase knockout ES cells. Similarly, eliminating UPase activity did not cause any alteration in the expression of OPRTase, a key enzyme in the de novo biosynthetic pathway and in the activation of 5-FU (Table 2)Citation .



View larger version (69K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Disruption of UPase activity results in resistance to PALA. WT and knockout ES cells were exposed to different concentrations of PALA for 72 h, and the cells were treated as described in Fig. 4Citation . Each column represents the mean of three separate experiments; bars, ± SD. *, significantly different from the double knockout cells given the same treatment (P < 0.05, unpaired t test); **, significantly different from both single (P < 0.01) and double (P < 0.005) knockout cells (unpaired t test).

 

View this table:
[in this window]
[in a new window]

 
Table 2 Activities of uridine kinase and OPRTase

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Using specific gene targeting methodology, we were successfully able to obtain several UPase knockout ES clones. Northern blot and Western blot analyses as well as enzyme activity assays confirmed the absence of the UPase gene products in the double knockout cells and an ~50% reduction in the single knockout cells. These cell clones together with their parental WT cells compose an ideal cell panel, genetically differing only in UPase activity alone, to evaluate the metabolism and the activity of pyrimidine and antipyrimidine metabolites.

Theoretically, the abrogation of UPase activity, the first enzyme of the pyrimidine degradative pathway, should lead to the accumulation of uridine and consequent expansion of pyrimidine nucleotide pools in knockout cells. However, we did not find significant changes in ribonucleotide pools, in the intracellular level of R-1-P, and in the activity of the enzymes involved in pyrimidine regulation except for uridine kinase that was found elevated in knockout cells.

Uridine homeostasis is apparently maintained by a reduced contribution of the pyrimidine de novo synthesis as indicated by a reduced sensitivity of the double knockout cells to PALA and by a greater reliance on the pyrimidine salvage pathway as confirmed by an increased incorporation of preformed pyrimidines (uridine) in the nucleic acids.

Many investigators have reported that UPase is mainly a catabolic enzyme leading to the formation of ß-alanine by catalyzing uridine phosphorolysis rather than the ribosylation of uracil (5 , 16 , 17) . Unlike purine bases that can be salvaged by adenine phosphoribosyltransferase and hypoxantine-guanine phosphoribosyltransferase in a single step reaction, pyrimidine salvage is thought to occur only at the nucleoside level (16) . However, recent observations have indicated that UPase may function as an anabolic enzyme using activated ribose to salvage uracil into uridine nucleotides (with uridine as an intermediate) even in the presence of excess inorganic phosphate (6 , 18 , 19) .

Although two main pathways contribute to 5-FU activation, either via the OPRTase pathway in the presence of phosphoribosyl PP, or via UPase-initiated salvage pathway with R-1-P as cosubstrate, it is still controversial as to which pathway plays a predominant role. Our results in UPase knockout ES cells support the hypothesis that UPase substantially contributes to the activation of 5-FU as indicated by a 10-fold increase in IC50 for 5-FU, and a reduced 5-FU sensitivity in WT and single knockout cells in the presence of the UPase inhibitor BAU.

We have indicated the role of R-1-P as the rate-limiting factor (5 , 20) in vivo of the anabolic reactions catalyzed by UPase, and contemplated the possibility that changes in the balance between de novo pyrimidine synthesis and salvage pathway could influence the intracellular concentration of R-1-P. As mentioned above, the R-1-P level was not significantly altered in double knockout cells compared with the WT ES population. This finding indirectly reinforces the hypothesis of an interaction between purine and pyrimidine metabolism indicating that inosine and guanosine could actually replace R-1-P as ribose donors and suggesting that in our in vitro model R-1-P does not represent a rate-limiting factor in 5-FU activation (6 , 17) .

Our studies have also confirmed the role of UPase in the activation of 5'DFUR, a nontoxic prodrug of 5-FU designed to be selectively activated in tumor cells. Several investigators have postulated a correlation between growth inhibition by 5'DFUR and the activity of UPase (5 , 21 , 22) . Our data support this hypothesis showing that the sensitivity of the WT cells to 5'DFUR is almost 16-fold higher than UPase double knockout cells, and the single knockout cells had an intermediate sensitivity with an IC50 3-fold higher than the double knockout cells. These data clarify the activation mechanism and shed new light on the tumor-specific selectivity of capecitabine, an oral fluoropyrimidine prodrug approved recently as a first line agent for the treatment of metastatic colorectal cancer and metastatic breast cancer resistant to paclitaxel and anthracycline-containing chemotherapy. To exert its antineoplastic activity, capecitabine must be activated initially in the liver and subsequently in tumors by a series of enzymatic reactions to generate 5-FU. Capecitabine is first converted by hepatic carboxyl esterase to 5'-deoxy-5-fluorocytidine and then to 5'DFUR by cytidine deaminase. In tumor tissues, 5'DFUR is then selectively metabolized to form 5-FU by phosphorolytic activity (23) . Thus far this last metabolic step was totally ascribed to the enzymatic activity of TPase, a protein that has been shown to be overexpressed in some human tumors (24) . Our laboratory and others have reported the elevation of UPase activity and its expression in different solid tumors including breast and colorectal compared with adjacent normal tissues (11 , 25) . Here, we have clearly demonstrated the critical role of UPase in the activation of 5'DFUR, strengthening the rationale of tumor-specific activation of capecitabine, attributable not only to TPase elevation but also and probably mostly because of the presence of increased neoplastic UPase activity.

In conclusion, we have successfully generated a UPase gene knockout cell model by gene targeting technology. This disruption does not affect the basic cell physiology under normal tissue culture conditions but significantly alters the cell sensitivity to 5-FU, 5'DFUR and PALA, thereby indicating that UPase plays a significant role in 5-FU activation and capecitabine tumor selectivity. Our results also question the hypothesis that R-1-P is the rate-limiting factor of UPase-catalyzed anabolic reactions and possibly confirm the role of purines as ribose donors. These findings will have significant importance in the clinical selection of antitumor agents, and in the development of biochemical modulators and new fluoropyrimidine prodrugs.


    ACKNOWLEDGMENTS
 
We thank Dr. James McGrath and his staff from the Department of Comparative Medicine at Yale University School of Medicine for his generous assistance in the development of the UPase knockout model and for the helpful discussions.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by National Cancer Institute Grant CA67035 (to G. P.), the United Army Medical Research Breast Cancer Research Program (to D. C.), and the Anna Fuller Foundation Fellowship (to D. Z.) Back

2 To whom requests for reprints should be addressed, at Department of Internal Medicine (Oncology), Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06520. Phone: (203) 785-4549; Fax: (203) 785-7670; E-mail: Giuseppe.Pizzorno{at}yale.edu Back

3 The abbreviations used are: 5-FU, 5-fluorouracil; UPase, uridine phosphorylase; ES, embryonic stem; BAU, benzylacyclouridine; 5'DFUR, 5'-deoxy-5-fluorouridine; PALA, phosphonacetyl-L-aspartic acid; FUMP, fluorouridine monophosphate; OPRTase, orotate phosphoribosyl-transferase; R-1-P, ribose-1-phosphate; TPase, thymidine phosphorylase; MUP, murine UPase; NEO, neomycin resistance; TK, thymidine kinase; WT, wild-type. Back

Received 9/ 6/01. Accepted 2/ 6/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Pizzorno G., Handschumacher R. E., Cheng Y. C. Pyrimidine and purine antimetabolites 5th Edition Holland J. E. Frei E. eds. . Cancer Medicine, : 625-647, BC Decker Hamilton, Canada 2000.
  2. Kufe D. W., Major P. P. 5-Fluorouracil incorporation into human breast carcinoma RNA correlates with cytotoxicity. J. Biol. Chem., 256: 9802-9805, 1981.[Abstract/Free Full Text]
  3. Pizzorno G., Sun Z., Handschumacher R. E. Aberrant cell cycle inhibition pattern in human colon carcinoma cell lines after exposure to 5-fluorouracil. Biochem. Pharmacol., 49: 553-557, 1995.[Medline]
  4. Pinedo H. M., Peters G. F. Fluorouracil: biochemistry and pharmacology. J. Clin. Oncol., 6: 1653-1664, 1988.[Abstract/Free Full Text]
  5. Peters G. J., Laurensse E., Leyva A., Lankelma J., Pinedo H. M. Sensitivity of human, murine, and rat cells to 5-fluorouracil and 5'-deoxy-5-fluorouridine in relation to drug-metabolizing enzymes. Cancer Res., 46: 20-28, 1986.[Abstract/Free Full Text]
  6. Schwartz P. M., Moir R. D., Hyde C. M., Turek P. J., Handschumacher R. E. Role of uridine phosphorylase in the anabolism of 5-fluorouracil. Biochem. Pharmacol., 34: 3585-3589, 1985.[Medline]
  7. van Groeningen C. J., Peters G. J., Leyva A., Laurensse E., Pinedo H. M. Reversal of 5-fluorouracil-induced myelosuppression by prolonged administration of high-dose uridine. J. Natl. Cancer Inst., 81: 157-162, 1989.[Abstract/Free Full Text]
  8. Darnowski J. W., Handschumacher R. E., Wiegand R. A., Goulette F. A., Calabresi P. Tissue-specific expansion of uridine pools in mice. Effects of benzylacyclouridine, dipyridamole and exogenous uridine. Biochem. Pharmacol., 41: 2031-2036, 1991.[Medline]
  9. Darnowski J. W., Handschumacher R. E. Enhancement of fluorouracil therapy by the manipulation of tissue uridine pools. Pharmacol. Ther., 41: 381-392, 1989.[Medline]
  10. Pizzorno G., Yee L., Burtness B. A., Marsh J. C., Darnowski J. W., Chu M. Y., Chu S. H., Chu E., Leffert J. J., Handschumacher R. E., Calabresi P. Phase I clinical and pharmacological studies of benzylacyclouridine, a uridine phosphorylase inhibitor. Clin. Cancer Res., 4: 1165-1175, 1998.[Abstract]
  11. Liu M., Cao D., Russell R., Handschumacher R. E., Pizzorno G. Expression, characterization, and detection of human uridine phosphorylase and identification of variant uridine phosphorolytic activity in selected human tumors. Cancer Res., 58: 5418-5424, 1998.[Abstract/Free Full Text]
  12. Cao D., Nimmakayalu M. A., Wang F., Zhang D., Handschumacher R. E., Bray-Ward P., Pizzorno G. Genomic structure, chromosomal mapping, and promoter region analysis of murine uridine phosphorylase gene. Cancer Res., 59: 4997-5001, 1999.[Abstract/Free Full Text]
  13. Mortensen R. M., Conner D. A., Chao S., Geisterfer-Lowrance A. A., Seidman J. G. Production of homozygous mutant ES cells with a single targeting construct. Mol. Cell Biol., 12: 2391-2395, 1992.[Abstract/Free Full Text]
  14. Nio Y., Kimura H., Tsubono M., Tseng C. C., Kawabata K., Masai Y., Hayashi H., Meyer C., Fukumoto M., Tobe T. Antitumor activity of 5'-deoxy-5-fluorouridine in human digestive organ cancer xenografts and pyrimidine nucleoside phosphorylase activity in normal and neoplastic tissues from human digestive organs. Anticancer Res., 12: 1141-1146, 1992.[Medline]
  15. Moyer J. D., Smith P. A., Levy E. J., Handschumacher R. E. Kinetics of N-(phosphonacetyl)-L-aspartate, and pyrazofurin depletion of pyrimidine ribonucleotide and deoxyribonucleotide pools and their relationship to nucleic acid synthesis in intact and permeabilized cells. Cancer Res., 42: 4525-4531, 1982.[Abstract/Free Full Text]
  16. Fairbanks L. D., Bofill M., Ruckemann K., Simmonds H. A. Importance of ribonucleotide availability to proliferating T-lymphocytes from healthy humans. Disproportionate expansion of pyrimidine pools and contrasting effects of de novo synthesis inhibitors. J. Biol. Chem., 270: 29682-29689, 1995.[Abstract/Free Full Text]
  17. Cappiello M., Mascia L., Scolozzi C., Giorgelli F., Ipata P. L. In vitro assessment of salvage pathways for pyrimidine bases in rat liver and brain. Biochim. Biophys. Acta, 1425: 273-281, 1998.[Medline]
  18. Mascia M., Cotrufo T., Cappiello M., Ipata P. L. Ribose 1-phosphate and inosine activate uracil salvage in rat brain. Biochim. Biophys. Acta, 1472: 93-98, 1999.[Medline]
  19. Mascia M., Ipata P. L. Activation pathways of 5-fluorouracil in rat organs and in PC12 cells. Biochem. Pharmacol., 62: 213-218, 2001.[Medline]
  20. McIvor R. S., Wohlhueter R. M., Plagemann P. P. Uridine phosphorylase from Novikoff rat hepatoma cells: purification, kinetic properties, and its role in uracil anabolism. J. Cell. Physiol., 122: 397-404, 1985.[Medline]
  21. Armstrong R. D., Diasio R. B. Metabolism and biological activity of 5'-deoxy-5-fluorouridine, a novel fluoropyrimidine. Cancer Res., 40: 3333-3338, 1980.[Abstract/Free Full Text]
  22. Ishitsuka H., Miwa M., Takemoto K., Fukuoka K., Itoga A., Maruyama H. B. Role of uridine phosphorylase for antitumor activity of 5'-deoxy-5-fluorouridine. Gann, 71: 112-123, 1980.[Medline]
  23. Takimoto C. H. The clinical pharmacology of the oral fluoropyrimidines. Curr. Probl. Cancer, 25: 134-213, 2001.[Medline]
  24. Griffiths L., Stratford I. J. , Platelet-derived endothelial cell growth factor thymidine phosphorylase in tumor growth and response to therapy. Br. J. Cancer, 76: 689-6993, 1997.[Medline]
  25. Kanzaki A., Takebayashi Y., Bando H., Eliason J. F., Watanabe S., Miyashita H., Fukumoto M., Toi M., Uchida T. Expression of uridine and thymidine phosphorylase genes in human breast carcinoma. Int. J. Cancer, 97: 631-635, 2002.[Medline]



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
X. Kong, H. Fan, X. Liu, R. Wang, J. Liang, N. Gupta, Y. Chen, F. Fang, and Y. Chang
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator-1{alpha} Enhances Antiproliferative Activity of 5'-Deoxy-5-Fluorouridine in Cancer Cells through Induction of Uridine Phosphorylase
Mol. Pharmacol., October 1, 2009; 76(4): 854 - 860.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
X. Zu, R. Yan, S. Robbins, P. A. Krishack, D.-F. Liao, and D. Cao
Reduced 293T Cell Susceptibility to Acrolein Due to Aldose Reductase-like-1 Protein Expression
Toxicol. Sci., June 1, 2007; 97(2): 562 - 568.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
L. Wan, D. Cao, J. Zeng, R. Yan, and G. Pizzorno
Modulation of Uridine Phosphorylase Gene Expression by Tumor Necrosis Factor-{alpha} Enhances the Antiproliferative Activity of the Capecitabine Intermediate 5'-Deoxy-5-fluorouridine in Breast Cancer Cells
Mol. Pharmacol., April 1, 2006; 69(4): 1389 - 1395.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Cao, J. J. Leffert, J. McCabe, B. Kim, and G. Pizzorno
Abnormalities in Uridine Homeostatic Regulation and Pyrimidine Nucleotide Metabolism as a Consequence of the Deletion of the Uridine Phosphorylase Gene
J. Biol. Chem., June 3, 2005; 280(22): 21169 - 21175.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cao, D.
Right arrow Articles by Pizzorno, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, D.
Right arrow Articles by Pizzorno, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online