Cancer Research AACR Membership  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hernandez-Saavedra, D.
Right arrow Articles by McCord, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hernandez-Saavedra, D.
Right arrow Articles by McCord, J. M.
[Cancer Research 63, 159-163, January 2003]
© 2003 American Association for Cancer Research


Molecular Biology and Genetics

Paradoxical Effects of Thiol Reagents on Jurkat Cells and a New Thiol-sensitive Mutant Form of Human Mitochondrial Superoxide Dismutase1

Daniel Hernandez-Saavedra and Joe M. McCord2

Webb-Waring Institute for Cancer, Aging, and Antioxidant Research, University of Colorado Health Sciences Center, Denver, Colorado 80262


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The imbalance between oxidants and antioxidants in cells often results in pathological processes and/or diseases. This delicate balance is achieved in part by antioxidant enzymes such as glutathione peroxidase, catalase, and superoxide dismutase (SOD), as well as by low-molecular-weight reductants such as glutathione. We evaluated the effect of thiol reagents on the proliferation of the Jurkat human T-cell leukemia-derived cell line. The cells show a multiphasic behavior when grown in the presence of thiols. Low concentrations of N-2-mercaptopropionyl glycine (0.03 mM) cause growth arrest, and intermediate concentrations (0.3–1.0 mM) induce apoptosis. Similarly, 1 mM N-acetylcysteine or glutathione induce apoptosis in more than 40% of the cells. Surprisingly, the cells grow well in higher concentrations (3–10 mM) of these reagents. Because the I58T variant of human SOD2 is thiol-sensitive, we measured SOD in Jurkat cells grown in the presence of thiol agents, observing markedly less SOD activity. In cell-free extracts, thiols quickly eliminated the SOD2 activity. Jurkat cells contain little SOD2 activity, with a different electrophoretic mobility from that of normal lymphocytes. Single-strand conformational polymorphism analysis of the Jurkat sod2 gene revealed a pattern different from the wild-type gene, suggesting a mutation in the sod2 gene. This was confirmed by cloning and sequencing the gene. Jurkat cells are heterozygous for a new mutation, L60F, in exon 3 of the mature protein. Our findings suggest a possible association between decreased SOD2 activity and malignant phenotype.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Redox status of cells can determine when cells rest, proliferate, or die. Healthy cells have a well-regulated redox balance. Superoxide anion can elicit proliferation of resting cells; higher concentrations, however, may induce apoptosis and necrosis (1) . The roles of reducing agents with regard to quiescence, proliferation, and apoptosis are not well understood.

Thiol compounds acting as redox modulators may affect the proliferation rates of actively growing cells, such as cancer and transformed cells. The Jurkat T-cell leukemia cell line grows in culture without stimulation, as cancerous and transformed cells do. The redox status of transformed cells has been correlated with their content of antioxidants. Oberley and Oberley (2) and Sun (3) have found low levels of the mitochondrial manganese SOD23 in nearly all of the cancer cell lines studied, as well as in the primary malignant tissues. Furthermore, in childhood acute lymphoblastic leukemia, SOD levels have been reported to be about one-half those of normal cells (4 , 5) . These deficiencies are presumably associated with an increase in the oxidative status of the cell, but the mechanisms that account for the regulation of these important antioxidants enzymes in mammalian cells are still unknown.

Mutations in SODs have been associated with human diseases. Seventy-one different mutations in the cytoplasmic SOD1 have been correlated with amyotrophic lateral sclerosis (6) . A specific mutation (R213G) in extracellular SOD3 that decreases binding affinity for extracellular surfaces is found in ~7% of the population at large, but in ~16% of patients with renal failure (7) .

The roles of thiols such as NAC have been controversial with regard to cellular responses such as proliferation and apoptosis. NAC and GSH, presumably acting as antioxidants, have been used to rescue T-lymphocytes from apoptosis (8) . However, later studies demonstrated that some thiol compounds could paradoxically elicit apoptosis by acting as pro-oxidants (9) . To understand how changes in the redox status of cells affect their proliferative rates, we conducted experiments using the human T-ell leukemia cell line Jurkat. The cells were subjected to a shift in their redox status by treatment with thiol agents such as MPG, GSH, and NAC. We hypothesized that the redox status of lymphocytes or Jurkat cells would determine whether they proliferate or die by apoptosis or necrosis. Thus, a thiol-induced shift toward a more reducing environment in proliferating lymphocytes might be expected to stop growth and induce quiescence. In fact, the response of Jurkat cells to increasing concentrations of thiols proved to be far more complex.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Medium and Reagents.
RPMI culture medium, MPG, GSH, NAC, and cytochrome c were purchased from Sigma, Co. FBS, and calcium-magnesium-free Hank’s buffer balanced salt solution (CMF-HBSS) were from Life Technologies, Inc. Xanthine oxidase was purified from milk as described by Waud et al. (10)

Cell Lines and Cell Cultures.
The human T-cell leukemia cell line Jurkat (clone E6–1) was purchased from the American Type Culture Collection. Jurkat cells were grown and maintained in RPMI 1640 supplemented with 10% heat-inactivated FBS. The cells were cultured at 37°C under 5% CO2 atmosphere and 100% humidity and subcultured every 4 days. Jurkat cells (7.5 x 104) were placed into 24-ell plates to a final volume of 1 ml/well under various experimental conditions. Growth was measured by direct counting with a hemocytometer. Viability was assessed by trypan blue exclusion.

HPBL Isolation.
HPBLs were purified using Ficoll gradients (Accu-Prep, Accurate Chemical, and Scientific Corp.). The blood was centrifuged for 20 min at 2200 rpm and the leukocyte "buffy coat" layer resuspended in 30 ml of Hank’s buffer. The cell suspension was underlaid carefully with 20 ml of Ficoll-Hypaque and centrifuged for 30 min at 1750 rpm. The layer containing the HPBLs at the interphase of the gradient was recovered and resuspended in Hank’s buffer to 40 ml. The cell suspension was centrifuged for 10 min at 800 rpm and the pellet washed twice with Hank’s buffer, then resuspended in 20 ml of Hank’s buffer and underlaid with 10 ml of FBS (non-heat-inactivated) containing 3 mM EDTA. After 20 min of centrifugation, the supernatant was decanted and the platelet-free HPBL pellet resuspended in 50 ml of OPTI-MEM (Life Technologies, Inc.) containing 5% autologous serum (reserved from the whole-blood sample) and 1% L-glutamine/penicillin/streptomycin solution (Sigma Co.) The cells were adjusted to 5 x 105/ml and transferred to T-150 flasks. The cell suspensions were incubated at 37°C in 5% CO2, 95% air and 100% humidity for 2 h and transferred to new T-150 flasks and incubated under the same conditions for an additional 4 h. If red cell contamination was evident in the HPBL pellet, 9 ml of sterile distilled H2O were added and resuspended, passing through a sterile transfer for 20 s. One ml of 10x Hank’s buffer was added and the final volume adjusted to 20 ml with Hank’s buffer. The cell suspension was centrifuged for 10 min at 800 rpm, and the final red cell-free pellet was resuspended in 50 ml of OPTI-MEM with 4% FBS (heat-inactivated) and 1% L-glutamine/penicillin/streptomycin solution. The final lymphocyte population was more than 95% pure as judged by light microscopy.

Thiol Treatment.
Stock solutions of GSH, MPG, and NAC (100 µM) were freshly prepared in RPMI before the start of the experiments, and 7.5 x 104 cells were grown in the presence of increasing thiol concentrations in a volume of 1 ml/well. Growth and viability were measured as described above.

Apoptosis and Necrosis.
Apoptosis and necrosis were determined after 24 and 48 h of incubation by morphological assessment with acridine orange-ethidium bromide staining and fluorescence microscopy (11) . Cells were centrifuged in a volume of 100 µl for 15 s at 12,000 rpm. The supernatant was aspirated and the pellet resuspended in 20 µl of PBS and 2 µl of a mixture containing 100 µg/ml each of acridine orange and ethidium bromide. Aliquots of 10 µl of stained cells were observed with fluorescence microscopy, and the number of apoptotic and necrotic cells were determined by counting 100 cells in each of five different, randomly selected fields.

SOD and Catalase Activity Assays.
After a 24-h incubation in the presence of various MPG concentrations, 107 cells were washed once, resuspended in chilled 10 mM phosphate buffer (pH 7.0) containing 0.15 M NaCl, and sonicated for 30 s on ice. Aliquots were used for measuring enzyme activities. SOD activity was measured using the cytochrome c reduction assay as described by McCord and Fridovich (12) . Catalase activity was evaluated according to Bergmeyer (13) , using a freshly prepared stock solution of hydrogen peroxide. The protein content of crude extracts was measured using the method described by Lowry et al. (14)

SOD Activity Gels.
Aliquots of the cell lysates of 3 µl or less containing 0.1 unit of total SOD activity were loaded on agarose gels (Universal Gel/8; Helena Laboratories, Beaumont, TX) and electrophoresed in 20 mM Tris-glycine buffer (pH 8.2) at 200 mA for 15 min. The gel was stained for SOD activity with nitroblue tetrazolium-riboflavin-EDTA and then developed under fluorescent light as described by McCord (15) .

SSCP.
Genomic DNA was extracted from Jurkat cells by phenol/chloroform and ethanol precipitation. SSCP analysis was performed on genomic DNA samples as described in the FMC BioProducts (Rockland, ME) protocol by using primers for a portion of exon 3 of the sod2 gene and the Mutation Detection Enhanced gel system. The primer sequences were: WV5 5' (5'CAGTGGTTGAAAAAGTAGGAG3') and WV31 3' (5'TTAGGGCTGAGGTTTGTCCA3'). This amplification yielded a 148-bp PCR product.

RT-PCR and Sequencing of Jurkat sod2 cDNA.
Total RNA was purified from cell extracts using the total RNA purification system (Promega, Madison, WI). Samples of total RNA were reverse transcribed and amplified by PCR using the SF3 5' (5'-CCCCTGCAGATGTTGAGCCGGGCAGTGTGCGGCACCAGC-3', and the SF4 3' (5'-CCCTCTAGATTACTTTTTGCAAGCCATGTATCTTTCAGT-3') primers with the Access RT-PCR system (Promega) as described by the manufacturer. The PCR products were purified and cloned into the TA cloning kit from Invitrogen Life Technologies (Carlsbad, CA). Colonies were screened by PCR, followed by restriction analysis with HaeII and MboII. Clones with inserts of the right size, orientation, and restriction sites were sequenced with Ampli Taq DNA polymerase FS with the dRhodamine terminator cycle sequencing-ready reaction kit at the DNA sequencing and analysis core facility of the University of Colorado Cancer Center. Results were analyzed with PCGENE software.

Statistical Analyses.
Statistical significance was determined by one-way ANOVA using the Neuman-Keuls test by StatMost software for PC.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Jurkat cells were grown in the presence of several different reducing agents such as MPG, NAC, and GSH with the intent of modifying the oxidative state the cells. The effects of MPG on growth are shown in Fig. 1aCitation . After 24 h, low MPG concentrations ranging from 0.03 mM to 1.0 mM inhibited proliferation. Higher MPG concentrations of 3.0 mM and 10.0 mM, however, produced no inhibitory effects. We also quantified the percentage of apoptotic and necrotic cells under each condition, as well as cell viability (Fig. 1b)Citation . Surprisingly, we found that only the intermediate concentration of MPG (0.1 mM) induced the highest percentages of apoptosis (40%). In cultures incubated with 0.3 mM and 1.0 mM MPG, the cells died mainly by necrosis. Cell viability assessed by trypan blue exclusion was minimal at concentrations between 0.1 and 1.0 mM, essentially mirroring the necrosis. The highest concentrations of 3.0 mM and 10.0 mM MPG produced no observable adverse effects; by all criteria, these cells resembled control cells (Fig. 1b)Citation . Thus, the growth rate of Jurkat cells is affected by increasing concentrations of MPG in a complex and multiphasic manner.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Effects of three thiol reagents on growth, viability, apoptosis and necrosis of Jurkat cells. Cells (7.5 x 104) in RPMI medium with 10% FBS were placed into 24-well plates to a final volume of 1 ml/well. Wells contained the indicated concentrations of thiol reagents. The cultures were incubated at 37°C under 5% CO2 and 100% humidity. The cell numbers (bars) were determined by direct counting in a hemocytometer. Viability (triangles) was assessed by trypan blue exclusion. Apoptosis (circles) and necrosis (squares) were determined by fluorescent microscopy after staining with acridine orange-ethidium bromide as described in "Materials and Methods." Each measurement represents an n of 4 ± SE; asterisks or filled symbols, measurements that differ significantly by ANOVA analysis from control values (P < 0.05). a and b, the effects of various concentrations of MPG after 24 h of incubation; c and d, the effects of NAC; e and f, the effects of GSH.

 
NAC and GSH, used at the same concentrations as MPG, produced effects similar to those seen with MPG. Fig. 1cCitation shows the proliferation of Jurkat cells incubated with increasing concentrations of NAC. Cells incubated with 0.03 mM NAC showed no effects, but concentrations ranging from 0.1 mM to 10 mM inhibited the proliferation at 24 h. Cells incubated with concentrations from 0.3 mM to 3 mM of NAC showed the highest percentages of apoptosis (Fig. 1d)Citation . The percentage of necrotic cells was high only in the cells incubated with 1.0 mM NAC, again reflected as low viability assessed by trypan blue exclusion.

When GSH concentration was very low (0.03 mM or 0.1 mM) or very high (3.0 mM or 10.0 mM), there were no differences in growth compared with control (Fig. 1e)Citation . Cells incubated with intermediate concentrations of 0.3 mM and 1.0 mM, however, showed diminished viability and growth. The percentage of apoptotic cells was highest at a GSH concentration of 1.0 mM (Fig. 1f)Citation . The percentage of necrosis was highest in cells incubated with 0.3 mM and 1.0 mM GSH, correlating inversely with the percentage of viable cells (Fig. 1f)Citation .

We then evaluated the effects of MPG on the specific activity of SOD, in intact cells and in cell-free extracts. Fig. 2aCitation shows that SOD specific activity decreased about 75% compared with control, as MPG in the culture medium was increased to 0.1, 1, and 3 mM. Also, extracts from control cultures grown in the absence of MPG were treated in vitro with various concentrations of MPG. A dose-dependent loss of SOD2 activity was observed (Fig. 2b)Citation .



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Effect of MPG on the specific activity of SOD in the Jurkat T-cell line. Cells (107) from cultures grown for 24 h with different MPG concentrations were washed once and resuspended in chilled 10 mM phosphate buffer (pH 7.0) with 0.15 M NaCl. These cell suspensions were used to obtain crude extracts by sonication (30 s) on ice. a, aliquots were assayed for SOD activity using the cytochrome c reduction inhibition assay. Protein content was assayed as described in "Materials and Methods." Each point, the mean ± SE from triplicate assays. *, values that are significantly different from control at P < 0.001. b, extracts from control cells (no MPG) were incubated for 30 min with the indicated concentrations of MPG at 37°C. Equal amounts of protein as judged by the Lowry assay were loaded in each well of a thin-film agarose gel and electrophoresed in 20 mM Tris-glycine buffer (pH 8.2) at 200 mA for 15 min. The gel was stained for activity with nitroblue tetrazolium-riboflavin-EDTA and then was developed under fluorescent light.

 
These SOD specific activity assays measured the sum of the two intracellular forms of SOD, the cytosolic SOD1, and the mitochondrial SOD2. Therefore, we determined the relative contributions of SOD1 and SOD2 by native agarose gel electrophoresis and an activity stain. Fig. 3aCitation shows that the major band of SOD1 is not different from the control (HPBLs), although an additional weaker, faster moving band was visible in the Jurkat extract. The SOD2 of Jurkat cells, however, differs from that of normal lymphocytes quantitatively as well as qualitatively. The SOD2 activity is lower in Jurkat cells, as described previously for transformed and cancerous cells. In addition, the electrophoretic mobility is slightly faster than the SOD2 of normal HPBLs, suggesting the possibility of a mutated or differently processed SOD2 in Jurkat cells.



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Differences in SOD2 between HPBL and Jurkat. a, electropherogram of SOD activity from cell crude extracts of HPBL and Jurkat T-cells. Extracts were obtained by sonication. The total SOD activity was measured as described in "Materials and Methods." Samples of each extract containing 0.1 units of total SOD activity were loaded on agarose gels and run electrophoretically as described in Fig. 2bCitation . b, SSCP pattern from exon 3 of genomic HPBL (wild-type) and Jurkat DNA samples. Total DNA was extracted by phenol/chloroform and ethanol precipitation. SSCP analysis was performed as described in "Materials and Methods."

 
To pursue the possibility of a mutation in the Jurkat sod2 gene, we performed SSCP of exon 3 (in which the previously identified point mutation I58T is localized) to assess the possibility of a similar mutation in the Jurkat sod2 gene. We found an anomalous SSCP pattern in this region compared with the wild type (Fig. 3b)Citation , strongly suggesting a mutation in the gene.

The Jurkat sod2 cDNA was cloned and sequenced. Five of six independent clones (designated Jurkat Allele 1, Fig. 4Citation ) contained the C1183T substitution (which encodes the A-9V variant) in exon 2, previously reported by Heckl (16) . These five clones contained wild-type sequence in the entire region coding the mature SOD2. In one of six independent clones, however, we found a cDNA sequence presumably reflecting the other Jurkat allele (designated Jurkat Allele 2, Fig. 4Citation ). This sequence was wild type at the C1183 locus, but contained a new point mutation, C5782T, in exon 3, that will produce a L60F mutation in the enzyme. Thus, Jurkat T lymphocytes appear to be heterozygous in the sod2 gene at two loci: the previously described -9 locus and at a previously undescribed locus, 60.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. cDNA sequence from wild-type HPBL and both alleles of the Jurkat T-cell line sod2 gene. Total RNA from Jurkat cells was purified, reverse transcribed, amplified, and sequenced as described in "Materials and Methods." The numbering of loci refers to GenBank accession no. S77127. The base substitution on allele 1 at position 1183 causes the A-9V mutation; the substitution on allele 2 at 5782 causes the L60F mutation. The sequence difference between the two alleles at position 5782 is clearly evident in the sequencer output.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
When the SODs were first discovered, it was assumed that their roles were primarily to protect and defend against a cytotoxic metabolite. More recently, however, it has become apparent that the radical serves rather subtle metabolic regulatory roles, even in perfectly healthy cells. Superoxide has been proposed as a possible second messenger in the transduction of metabolic signals (17) . Low concentrations of superoxide regulate the proliferation of resting human lymphocytes (1) probably because of the activation of proteins related to growth control, such as kinases and some transcription factors (AP-1, NF-{kappa}ß, c-jun, c-fos; Refs. 18 , 19 ). Some of these proteins have been shown to be redox controlled, and their modification by oxidants may activate the cells to proliferate. However, the original premise holds true as well; high concentrations of superoxide can cause cell death (1) by inducing lipid peroxidation, protein inactivation, and DNA damage at the molecular level, as well as by inducing the phenomena of apoptosis and necrosis.

Jurkat T-cells proliferate in culture without activation, a characteristic common among immortalized cells. The effects of several thiol-reducing agents on growth and proliferation were evaluated, with results that appear to be complex, multiphasic, and paradoxical. The growth of Jurkat cells progressively slows as thiol concentrations increase toward 1 mM (Figs. 1, a, c, and e)Citation but is dramatically restored to normal at 3 mM or higher. Fig. 1bCitation sheds more light on what is happening in the growth-inhibitory range of thiol concentrations by revealing that the cells are dying almost entirely by apoptosis at 0.1 mM MPG, but that the mode of death shifts to predominantly necrosis at 1 mM MPG. This progressive behavior of "proliferation to apoptosis to necrosis" is reminiscent of how primary human peripheral lymphocytes behave in the face of increasing rates of superoxide production (1) . The apparent paradox is that our previous study observed this progressive behavior as cells were exposed to increasing oxidative stress brought about by the redox-cycling agent paraquat, whereas the present study sees the same behavior as cells are exposed to increasing concentrations of a reducing agent, MPG.

We begin to understand the paradox with the data seen in Fig. 2aCitation . Very low concentrations of MPG in the growth medium markedly decrease the SOD activity in Jurkat cells, and similar concentrations inhibit the enzyme in cell-free extracts (Fig. 2b)Citation . This inhibition of SOD2 by thiols was unexpected because Matsuda et al. (20) have reported that the activity of wild-type SOD2 is unaffected by thiols. We have found, however, that a mutant form of the enzyme, I58T, is quite sensitive to inhibition by thiol reagents (21) , probably through the formation of mixed disulfides. This mutant form of SOD2 has been characterized by Borgstahl et al. (22) and found to exist largely as a dimeric structure rather than the normal tetramer. In the dimer, each subunit exposes cysteine-140, a residue normally buried in the tetrameric structure. Thus, we wondered whether Jurkat cells may contain the I58T mutant form of SOD2 (or a similar mutation), which might explain the abnormal sensitivity to thiol reagents. If this were true, low concentrations of thiols could paradoxically create a condition of oxidative stress by virtue of SOD2 inhibition, resulting in increased numbers of apoptotic and necrotic cells. At high concentrations of the thiol reagents (3–10 mM), the antioxidant protection provided by the thiols might make up for the loss of SOD2 activity or, at the very least, drive the protein mixed-disulfides back to their reduced states to reactivate the SOD2, decreasing oxidative stress and allowing restoration of normal growth. The formation of protein-mixed-disulfides (or S-thiolation) under conditions of mild to moderate oxidative stress is well documented, and a number of metabolic enzymes are known to be inactivated by such modification (23) . If a mutant SOD2 were susceptible to inactivation by S-thiolation, the resulting elevation in oxidative stress would only serve to promote additional S-thiolation reactions, leading to a possible vicious cycle within the cell.

An examination of the electrophoretic behavior of Jurkat SOD2 (Fig. 3a)Citation was consistent with our hypothesis that the SOD2 might be a mutant form. The electrophoretic pattern differed from that seen in normal HPBLs, both quantitatively and qualitatively. There was less SOD2 activity, and its mobility was clearly faster than that of the wild type. This difference in mobility could reflect a coding mutation, or it could be evidence of S-thiolation of the enzyme, or both. Confirmation of a mutation was provided by SSCP analysis (Fig. 3b)Citation . The pattern presented by an amplicon containing exon 3 (where the I58T mutant is located) is clearly different from wild type. The pattern is consistent with a heterozygous genotype because the wild-type pattern is present, together with a similar but faster moving pattern, presumably contributed by the mutant allele.

Cloning and sequencing of the Jurkat sod2 cDNA (Fig. 4)Citation clearly revealed that the cells are indeed heterozygous. One allele contained the common alanine-to-valine mutation at residue -9 (in the leader sequence) in exon 2, but was wild type in exon 3. The other allele was wild type at -9, but contained a new mutation, leucine-to-phenylalanine, at position 60 in exon 3. This L60F mutation is only two residues downstream from the I58T mutation previously studied by Borgstahl et al. (22) The location of the I58T mutation is in a two-helix bundle that extends finger-like from each subunit (Ref. 24 ; the protein data bank coordinates were visualized with the software Rasmol). The monomer-monomer interface of human SOD2 is typical of globular protein subunit interactions, involving a substantial area of contact. The dimer-dimer interface, however, is quite atypical, involving a small area of contact between two pairs of these finger-like two helix bundles. These areas of contact involve only about eight residues contributed by each subunit. The eight contact residues include both the isoleucine residue at position 58 and the leucine residue at position 60. Thus, it seems highly likely that the L60F mutation that we report here from Jurkat cells will be functionally similar to the previously studied, tetramer-destabilizing I58T mutation, (22) , which renders the enzyme thermally unstable and vulnerable to inactivation by S-thiolation reactions (21) .

The finding of a destabilizing SOD2 mutation in a leukemia-derived cell line may not be coincidental. Nearly all cancerous tissues, including leukemia lymphocytes (4) , have decreased SOD2 (and increased oxidative stress) leading some to regard sod2 as a tumor suppressor gene (25) . Exposure of mitotically competent cells such as fibroblasts (26) or lymphocytes (1) to increased production of superoxide induces the cells to proliferate. Thus, a nearly universal feature of malignantly transformed cells may be either an increase in production of superoxide or a decrease in endogenous SOD levels (27) , with the latter seemingly more common. The decrease in SOD activity could occur via misregulation of the gene (resulting, e.g., from mutations in the promoter region of the gene) or via coding mutations such as L60F that may result in a thermally unstable enzyme or in an enzyme that is susceptible to inhibition by the formation of mixed-disulfides involving sensitive thiol groups exposed by the weakened tetrameric interface. It is interesting to note that SOD1 of chickens and of humans exists as S-thiolated derivatives, reflecting mixed disulfides with GSH (28) . It is also noteworthy that the bizarre behavior toward thiol reagents that we describe here for Jurkat cells is not unique, but has been reported by Morse et al. (9) for CEM cells, another human leukemia-derived cell line. Thiols represent an important class of antioxidants that contribute to cellular homeostasis in many ways. We report here an unusual mutation that renders SOD2, a vital antioxidant enzyme, sensitive to inactivation by these normally protective compounds.


    ACKNOWLEDGMENTS
 
We thank Drs. Sonia Flores, Carl White, and Bifeng Gao for their technical assistance and helpful discussions.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by a grant from the Gustavus and Louise Pfeiffer Foundation, and the Centro de Investigaciones Biologicas del Noroeste, La Paz, BCS, Mexico. Back

2 To whom requests for reprints should be addressed, at The University of Colorado Health Sciences Center, Box C-321, 4200 East Ninth Avenue, Denver, CO 80262. Phone: (303) 315-6257; E-mail: joe.mccord{at}uchsc.edu Back

3 The abbreviations used are: SOD, superoxide dismutase; MPG, N-2-mercaptopropionyl glycine; GSH, glutathione; NAC, N-acetylcysteine; SSCP, single-stranded conformational polymorphism; HPBL, human peripheral blood lymphocyte; FBS, fetal bovine serum. Back

Received 5/30/02. Accepted 10/30/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Seve M., Favier A., Osman M., Hernandez D., Vaitaitis G., Flores N. C., McCord J. M., Flores S. C. The human immunodeficiency virus-1 Tat protein increases cell proliferation, alters sensitivity to zinc chelator-induced apoptosis, and changes Sp1 DNA binding in HeLa cells. Arch. Biochem. Biophys., 361: 165-172, 1999.[Medline]
  2. Oberley L. W., Oberley T. D. Free radicals, cancer, and aging J. E. Johnson, Jr. R. Walford D. Harman J. Miquel eds. . Free Radicals, Aging, and Degenerative Diseases, 325-371, Alan R. Liss New York 1986.
  3. Sun Y. Free radicals, antioxidant enzymes, and carcinogenesis. Free Radical Biol. Med., 8: 583-599, 1990.[Medline]
  4. Yoshimitsu K., Kobayashi Y., Usui T. Superoxide dismutase activity in leukemic blasts of children with acute leukemia. Acta Paediatr. Scand., 73: 92-96, 1984.[Medline]
  5. Senturker S., Karahalil B., Inal M., Yilmaz H., Muslumanoglu H., Gedikoglu G., Dizdaroglu M. Oxidative DNA base damage and antioxidant enzyme levels in childhood acute lymphoblastic leukemia. FEBS Lett., 416: 286-290, 1997.[Medline]
  6. Gaudette M., Hirano M., Siddique T. Current status of SOD1 mutations in familial amyotrophic lateral sclerosis. Amyotroph. Lateral. Scler. Other Motor Neuron Disord., 1: 83-89, 2000.[Medline]
  7. Yamada H., Yamada Y., Adachi T., Goto H., Ogasawara N., Futenma A., Kitano M., Hirano K., Kato K. Molecular analysis of extracellular-superoxide dismutase gene associated with high level in serum. Jpn. J. Hum. Genet., 40: 177-184, 1995.[Medline]
  8. Sandstrom P. A., Mannie M. D., Buttke T. M. Inhibition of activation-induced death in t cell hybridomas by thiol antioxidants—oxidative stress as a mediator of apoptosis. J. Leukoc. Biol., 55: 221-226, 1994.[Abstract]
  9. Morse N. R., Tebbey P. W., Sandstrom P. A., Buttke T. M. Induction of apoptosis in lymphoid cells by thiol-mediated oxidative stress. Protoplasma, 184: 181-187, 1995.
  10. Waud W. R., Brady F. O., Wiley R. D., Rajagopalan K. V. A new purification procedure for bovine milk xanthine oxidase: effect of proteolysis on the subunit structure. Arch. Biochem. Biophys., 169: 695-701, 1975.[Medline]
  11. Duke R. C., Cohen J. J. Morphological and biochemical assays of apoptosis Coligan J. E. Kruisbeak A. M. Margulies D. H. Shevach E. M. Strober W. eds. . Current Protocols in Immunology, 3.17.1-3.17.16, John Wiley & Sons New York 1992.
  12. McCord J. M., Fridovich I. Superoxide dismutase: an enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem., 244: 6049-6055, 1969.[Abstract/Free Full Text]
  13. Bergmeyer H. U. Measurement of catalase activities. Biochem. Z., 327: 255-258, 1955.[Medline]
  14. Lowry O. H., Rosebrough N. J., Farr A. L., Randall R. J. Protein measurement with the folin phenol reagent. J. Biol. Chem., 193: 265-275, 1951.[Free Full Text]
  15. McCord J. M. Analysis of superoxide dismutase activity Maines M. D. eds. . Current Protocols in Toxicology, 7.3.1-7.3.9, John Wiley & Sons, Inc. New York 1999.
  16. Heckl K. Isolation of cDNAs encoding human manganese superoxide dismutase. Nucleic Acids Res., 16: 6224 1988.[Abstract/Free Full Text]
  17. Schreck R., Rieber P., Baeuerle P. A. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-{kappa}B transcription factor and HIV-1. EMBO J., 10: 2247-2258, 1991.[Medline]
  18. Meyer M., Schreck R., Baeuerle P. A. H2O2 and antioxidants have opposite effects on activation of NF-{kappa}b and AP-1 in intact cells—AP-1 as secondary antioxidant-responsive factor. EMBO J., 12: 2005-2015, 1993.[Medline]
  19. Kvanta A., Kontny E., Jondal M., Okret S., Fredholm B. B. Mitogen stimulation of T-cells increases c-Fos and c-Jun protein levels, AP-1 binding and AP-1 transcriptional activity. Cell Signal., 4: 275-286, 1992.[Medline]
  20. Matsuda Y., Higashiyama S., Kijima Y., Suzuki K., Kawano K., Akiyama M., Kawata S., Tarui S., Deutsch H. F., Taniguchi N. Human liver manganese superoxide dismutase—purification and crystallization, subunit association and sulfhydryl reactivity. Eur. J. Biochem., 194: 713-720, 1990.[Medline]
  21. Hernandez D., McCord J. M. Inactivation of a variant form of human recombinant Mn-superoxide dismutase by thiol reagents. FASEB J., 11: A1303 1997.
  22. Borgstahl G. E., Parge H. E., Hickey M. J., Johnson M. J., Boissinot M., Hallewell R. A., Lepock J. R., Cabelli D. E., Tainer J. A. Human mitochondrial manganese superoxide dismutase polymorphic variant Ile58Thr reduces activity by destabilizing the tetrameric interface. Biochemistry, 35: 4287-4297, 1996.[Medline]
  23. Eaton P., Byers H. L., Leeds N., Ward M. A., Shattock M. J. Detection, quantitation, purification, and identification of cardiac proteins S-thiolated during ischemia and reperfusion. J. Biol. Chem., 277: 9806-9811, 2002.[Abstract/Free Full Text]
  24. Borgstahl G. E., Parge H. E., Hickey M. J., Beyer W. F., Jr., Hallewell R. A., Tainer J. A. The structure of human mitochondrial manganese superoxide dismutase reveals a novel tetrameric interface of two 4-helix bundles. Cell, 71: 107-118, 1992.[Medline]
  25. Church S. L., Grant J. W., Ridnour L. A., Oberley L. W., Swanson P. E., Meltzer P. S., Trent J. M. Increased manganese superoxide dismutase expression suppresses the malignant phenotype of human melanoma cells. Proc. Natl. Acad. Sci. USA, 90: 3113-3117, 1993.[Abstract/Free Full Text]
  26. Murrell G. A. C., Francis M. J. O., Bromley L. Modulation of fibroblast proliferation by oxygen free radicals. Biochem. J., 265: 659-665, 1990.[Medline]
  27. McCord J. M. The evolution of free radicals and oxidative stress. Am. J. Med., 108: 652-659, 2000.[Medline]
  28. Schinina M. E., Carlini P., Polticelli F., Zappacosta F., Bossa F., Calabrese L. Amino acid sequence of chicken Cu, Zn-containing superoxide dismutase and identification of glutathionyl adducts at exposed cysteine residues. Eur. J. Biochem., 237: 433-439, 1996.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
B. Bogunovic, M. Stojakovic, L. Chen, and M. Maric
An Unexpected Functional Link between Lysosomal Thiol Reductase and Mitochondrial Manganese Superoxide Dismutase
J. Biol. Chem., April 4, 2008; 283(14): 8855 - 8862.
[Abstract] [Full Text] [PDF]


Home page
aacredbookHome page
L. W. Oberley
Therapeutic Manipulation of the Intracellular Redox State
Am. Assoc. Cancer Res. Educ. Book, April 1, 2006; 2006(1): 255 - 258.
[Full Text] [PDF]


Home page
Arch SurgHome page
B. Hermann, Y. Li, M. B. Ray, J. M. Wo, and R. C. G. Martin II
Association of Manganese Superoxide Dismutase Expression With Progression of Carcinogenesis in Barrett Esophagus
Arch Surg, December 1, 2005; 140(12): 1204 - 1209.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. L. T. Teoh, P. V. Turner, and D. H. Evans
Tumorigenic Poxviruses Up-Regulate Intracellular Superoxide To Inhibit Apoptosis and Promote Cell Proliferation
J. Virol., May 1, 2005; 79(9): 5799 - 5811.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
D. St. Clair
Manganese Superoxide Dismutase: Genetic Variation and Regulation
J. Nutr., November 1, 2004; 134(11): 3190S - 3191S.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hernandez-Saavedra, D.
Right arrow Articles by McCord, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hernandez-Saavedra, D.
Right arrow Articles by McCord, J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online