Cancer Research Cancer Epigenetics  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, P.
Right arrow Articles by Spindel, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, P.
Right arrow Articles by Spindel, E. R.
[Cancer Research 63, 214-221, January 2003]
© 2003 American Association for Cancer Research


Tumor Biology

Acetylcholine Is Synthesized by and Acts as an Autocrine Growth Factor for Small Cell Lung Carcinoma1

Pingfang Song, Harmanjatinder S. Sekhon, Yibing Jia, Jennifer A. Keller, Jan Krzysztof Blusztajn, Gregory P. Mark and Eliot R. Spindel2

Departments of Pathology [H. S. S.] and Behavioral Neuroscience [G. P. M.], Oregon Health and Science University, Portland, Oregon 97239; Department of Pathology and Laboratory Medicine, Boston University School of Medicine, Boston, Massachusetts 02118 [J. K. B.]; and Division of Neuroscience, Oregon National Primate Research Center, Beaverton, Oregon 97006 [H. S. S., P. S., Y. J., J. A. K., E. R. S.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It is well established that small cell lung carcinomas (SCLCs) express receptors for acetylcholine (ACh) and that stimulation of these receptors by nicotine or other cholinergic agonists stimulates cell growth via activation of nicotinic cholinergic receptors (nAChRs) and/or muscarinic cholinergic receptors (mAChRs). The aim of this study was to determine whether SCLC cells synthesize and secrete ACh and respond to endogenous ACh to create a functioning cholinergic autocrine loop. Reverse transcription-PCR was used to screen a panel of SCLC cell lines for components of cholinergic signaling. Choline acetyltransferase (ChAT) and the vesicular ACh transporter (VAChT), as well as {alpha}3, {alpha}5, {alpha}7, ß2, and ß4, nAChR subunits and M3 and M5 mAChRs, were found to be present in most of the SCLC cell lines tested. Real-time PCR showed that mRNA levels for ChAT, VAChT, and {alpha}7 and ß2 nAChR subunits varied significantly among different SCLC cell lines tested. The H82 cell line was found to express the highest levels of ChAT, and that cell line was chosen for additional studies of ACh release and cell proliferation. ACh was easily detectable in H82 cell culture media, and levels of ACh were increased by the acetylcholinesterase inhibitor neostigmine. Vesamicol, an inhibitor of VAChT, and hemicholinium-3, an inhibitor of choline transport, both reduced H82 cell ACh basal release in a dose-dependent manner. In parallel with the reductions of ACh release, vesamicol and hemicholinium-3 also decreased H82 cell proliferation. H82 cell proliferation was also inhibited by the muscarinic and nicotinic antagonists atropine and mecamylamine, respectively, in dose- and time-dependent manners. Finally, archival cases of SCLC were screened by immunohistochemistry for expression of ChAT. Thirteen of 26 tumors screened were positive for ChAT. These findings demonstrate that SCLC can synthesize, secrete, and degrade ACh and that released ACh stimulates SCLC cell growth. Identification of this new autocrine loop provides a potential new target for therapeutic intervention.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Global lung cancer deaths were over 1,000,000 for the year 2000 and are projected to increase to 2,000,000 per annum by 2020–2030 (1) . SCLC3 accounts for 20–25% of all new cases of primary lung cancer. In addition to morphological characteristics, SCLC is distinguished from non-SCLC by its rapid tumor doubling time, high growth fraction, and early development of widespread metastasis (2) . Overall, survival beyond 5 years occurs in only 3–8% of all patients with SCLC because relapse occurs within 2 years despite initial responses to chemotherapy and radiotherapy (3) . Thus, there is clear need for further understanding of the biology of SCLC and development of new therapeutic approaches for SCLC treatment.

The neuroendocrine nature of SCLC is well established, as is the concept of growth regulation of SCLC by autocrine growth factors such as gastrin-releasing peptide (4 , 5) . SCLC and some non-SCLCs secrete a variety of neuropeptides, and many of these act as growth factors (6 , 7) . The concept of autocrine growth factors has been extended to the secretion of ligands for tyrosine- and threonine-kinase-linked receptors such as basic fibroblast growth factor (bFGF, FGF-2; Refs. 8 ), epidermal growth factor (EGF; Ref. 9 ) and transforming growth factor ß-1 (10) . Therapeutic approaches derived from this have included monoclonal antibodies against the epidermal growth factor receptors (11) , broad spectrum neuropeptide antagonists (12) , and inhibitors of tyrosine kinases and phosphatases (13) . Thus, autocrine growth factors can regulate SCLC growth and are potential therapeutic targets.

Multiple reports have established that SCLC cells express nAChRs and mAChRs (14, 15, 16, 17) and that the activation of nAChR and/or mAChR with nicotine (18, 19, 20) , ACh (19) , and muscarine (19 , 20) stimulates the growth of SCLC cells. Recent reports that a variety of cell types in normal lung synthesize ACh (21, 22, 23) have led us to hypothesize that lung cancers, similarly, may make ACh and that, therefore, SCLC growth may be regulated by a cholinergic autocrine loop.

In cholinergic neurons, the neurotransmitter ACh is synthesized from choline and acetyl-CoA by ChAT (24) and is then translocated into synaptic vesicles by the VAChT (25) . In neurons, choline for synthesis of ACh is transported by a specific high-affinity choline transporter: CHT1 (26 , 27) . If SCLCs synthesize ACh, then ChAT must be present and the other components of neuronal cholinergic signaling may be present. If a cholinergic autocrine loop is present in SCLC, then interruption of ACh synthesis and signaling should modify growth of SCLC. In this article, we show that SCLC tumors and cell lines express ChAT and that SCLC cell lines synthesize VAChT, CHT1, nAChR, and mAChR and synthesize ACh and that interruption of cholinergic signaling affects cell growth.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and SCLC Tissue Samples.
SCLC cell lines NCI H69, H82, H209, H345, H378, H417, H510, H592 were generously provided by Phelps et al. and Carney et al. (28 , 29) . H82 cells were grown in RPMI 1640 (Invitrogen, Carlsbad, CA) supplemented with 5 µg/ml insulin, 5 µg/ml transferrin, 5 ng/ml sodium selenite, 100 units/ml penicillin, and 100 µg/ml streptomycin. These lines encompass both classic, neuroendocrine-differentiated SCLC cell lines (H69, H209, H345, H378, H510, H592) and variant SCLC cell lines that lack neuroendocrine differentiation (H82, H417; Ref. 29 ). In addition, these lines have previously been reported to express nicotinic and/or muscarinic receptors (17 , 18 , 30) . Paraffin-embedded bronchoscopic biopsies of SCLC were obtained from the Department of Pathology of the Oregon Health and Science University. Five-µm sections were cut, and 1 section was stained with H&E to confirm the diagnosis; then other sections were processed for immunohistochemistry as described below.

Immunohistochemistry and Immunocytochemistry.
Paraffin sections of SCLC were processed for immunohistochemistry as described previously (31) . Antibodies used were mouse anti-ChAT (mAB 305; Chemicon International, Inc.; 1:400), rabbit anti-VAChT (H-V005; Phoenix Pharmaceuticals), and rat anti-{alpha}7 nAChR (mAB 319; 1:250; Ref. 32 ). Immunohistochemistry for SCLC was performed using Vector ABC reagents and VIP as a chromogen (Vector Laboratories, Burlingame, CA) for ChAT and AEC for ChAT. VIP is a proprietary peroxidase substrate from Vector Laboratories that yields a purple color. Intensity of immunohistochemical staining was scored from 0 to 4+ by two independent readers (E.R.S. and H.S.S.) (where 0 = no staining; 1+ = focal weak staining; 2+ = focal strong staining or diffuse weak staining; 3+ = diffuse medium staining; and 4+ = diffuse strong staining). Fluorescent immunohistochemistry on H82 cells was performed using Texas-red conjugated second antibody.

RT-PCR.
RT-PCR and Southern hybridization were used to investigate the expression of nAChR, mAChR, ChAT, VAChT, and CHT1 genes in SCLC cell lines. For nAChR, {alpha}3, {alpha}5, {alpha}7, ß2, and ß4 subunits were examined. For mAChR, M3 and M5 subtypes were examined. RNA was isolated from SCLC cell lines with Tri Reagent (Molecular Research Center, Cincinnati, OH). RT-PCR, gel electrophoresis and hybridization were performed as described previously (31) . Primers for PCR and internal primers for probes that were used are shown in Table 1Citation .


View this table:
[in this window]
[in a new window]

 
Table 1 Primers used for RT-PCR

 
Real-Time PCR Analysis.
Real-time PCR was used to quantify ChAT, VAChT, and {alpha}7 and ß2 nAChR receptor subunit mRNA levels in SCLC cell lines H82, H69, H345, H378, H417, and H592. Procedures were as described previously (33) and primers for 18S RNA were used for standardization. The primers and TaqMan probes were designed using Primer Express software (Applied Biosystems, Foster City, CA). Primers used were as follows: ChAT, 5' primer, GGCTCAGAACAGCAGCATCA, 3' primer, TGAGACGGCGGAAATTAATGA, and TaqMan probe, CACGTCATCGTAGCCTGCTGCAATCA; VAChT: 5', CAGCGGCACGTCGTAGCT, 3', TTGCTTCCAAGGCTATCCT, and TaqMan probe, AGCGGGCCCTTCATCCGACCG; {alpha}7 nAChR: 5', CATGGCCTTCTCGGTCTTCA, 3', CACGGCCTCCACGAAGTT, and TaqMan probe: TCATCTGCACCATCGGCATCCTGA; ß2 nAChR: 5', GGTCCACGAACGGAACTTCA, 3', CTGCCGCCTGCCATCTAC, and TaqMan probe GCACTTCCCATTTGACCAGCAGAACTG. 18S RNA amplifications were conducted with the Pre-Developed TaqMan Assay Reagent (Applied Biosystems). All real-time PCR reactions were run in triplicate.

Sequence Analysis of ChAT.
Two µg of total RNA prepared from H82 cells was reverse transcribed as described above. Primers were used to amplify cDNAs spanning exons 5 to 11 and 11 to 18 to span the entire ChAT coding region (24) . Amplified cDNA bands were gel isolated and subcloned into pGEM-T (Promega Corp., Madison, WI) and sequenced. The 5' and 3' primers used to amplify from exon 5 to exon 11 of ChAT were TCCACACCTCTGCATCCCTG and GACTTGTCGTACCAGCGATT; the 5' and 3' primers used to amplify from exon 11 to exon 18 of ChAT were ACCGGGACTCGCTGGACATG and GGAGGTGAAACCTAGTGGCA.

ACh Assay.
For investigation of ACh release from H82 cells, 5 x 106 cells in 10 ml were plated in 60-cm2 culture dishes. After plating, the acetylcholinesterase inhibitor neostigmine was added at a concentration of 5 x 10-5 M (Sigma, St. Louis, MO) to inhibit ACh degradation. Drugs tested were the VAChT inhibitor (±)-vesamicol (Sigma), the choline transport inhibitor, hemicholinium-3 (ICN Biomedicals Inc., Aurora, OH) for 24 h. After incubation, cell suspensions were transferred to 15-ml centrifuge tubes and centrifuged at 1000 rpm for 2 min at 4°C. Supernatants were aliquoted, rapidly frozen on dry ice, and stored at -80°C. For ACh assay, supernatants were thawed, and 20 µl of supernatant were injected directly into the HPLC for enzyme-coupled electrochemical detection as described previously (34) . Each sample was assayed at least in duplicate. The detection limit, defined as the amount of ACh needed to achieve a 3:1 signal:noise ratio, was 30 fmol per 20-µl injection.

Cell Proliferation Assay.
H82 cells were used to evaluate the effects of endogenous ACh synthesis on cell proliferation because real-time PCR showed they had the highest levels of ChAT expression of the SCLC cell lines tested. Drugs tested were the nAChR antagonist mecamylamine at 10-7, 10-6, and 10-5 M; the mAChR antagonist atropine at 10-8, 10-7, and 10-6 M; nicotine at 10-8, 10-7, 10-6, and 10-5 M; carbachol, a stable ACh analogue, at 10-6 and 10-5 M; the VAChT inhibitor vesamicol at 10-7, 10-6, and 10-5 M; and the choline transport inhibitor hemicholinium-3 at 10-8, 10-7, 10-6, and 10-5 M. All of the experiments for each drug were performed at least twice with a minimum of 12 replicates per data point per experiment. All of the drugs were from Sigma. H82 cells were plated with an 8-channel pipette at 5000 cells/well in 96-well plates. Drugs were added immediately after cell plating. The final medium volume of each well was 200 µl. Every 3 days, one-half of the volume of the media and drugs were changed after centrifugation of the plates at 1000 rpm for 1 min. At 0, 6, 9, and 12 days of incubation, a MTS-based-assay was used to measure cell growth. Twenty µl of MTS reagent (cellTiter 96 AQueous; Promega Corporation, Madison, WI) were added per well, and absorbance at 490 nm was recorded 2 h later.

Statistical Analysis.
All of the data are presented as mean ± SE. Data of cell growth were analyzed by ANOVA followed by Neuman-Keuls multiple-comparison test using NCSS 2001 (Kaysville, UT) statistical software. Student’s t test was used for data analysis of ACh release.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of ChAT, VAChT, and ChT1 Gene Expression in SCLC Cell Lines.
If a cholinergic autocrine loop is functional in SCLC, then proteins to synthesize ACh must be present and cells must express receptors for ACh. To determine whether SCLC cell lines express the proteins needed to synthesize ACh, ChAT, VAChT, and CHT1 gene expression was examined by RT-PCR in SCLC cell lines H69, H82, H345, H378, H417, and H592. All of the tested SCLC cell lines expressed ChAT and VAChT although only H345 cells expressed CHT1 (Fig. 1A)Citation . In the brain, multiple forms of ChAT are expressed. As shown in Fig. 1BCitation , mRNA coding for three ChAT isoforms, N, R, and S, was expressed in all of the SCLC cell lines. ChAT isoform M was not expressed in any of the SCLC cell lines (data not shown).



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Expression of ChAT, VAChT, CHT1 mRNA in SCLC cell lines. RT-PCR and Southern hybridizations were performed on total RNA prepared from the indicated cell lines. Primers and probes are described in "Materials and Methods." A, ChAT, VAChT, and CHT1 expression in SCLC cell lines H69, H82, H345, H378, H417, and H592. Human basal forebrain RNA was used as a positive control (HBF343, HBF345). B, ChAT isoform gene expression. ChAT N, S, R isoform genes were expressed in all of the SCLC cell lines tested. ChAT M isoform was not expressed in any of the SCLC cell lines (data not shown).

 
Sequence Analysis of H82 Cell ChAT.
To determine whether the ChAT mRNA expressed in SCLC was similar to neuronal ChAT, cDNAs spanning the entire coding region of ChAT were amplified, subcloned, and sequenced from H82 mRNA. This was done in two overlapping amplifications spanning exons 5–11 and 11–18 (Fig. 2)Citation based on the genomic structure of ChAT as described by Ohno et al. (24) . As shown in Fig. 2ACitation , primers from exon 5–11 amplified 2 bands. The predominant band corresponded exactly to the size predicted from the sequence of neuronal ChAT. A second smaller band was also amplified. Sequence analysis of the amplified bands showed that the sequence of the larger band was identical to that of neuronal ChAT, whereas the smaller band corresponded to neuronal ChAT missing exon 10. As shown in Fig. 2BCitation , the primers from exon 11 to exon 18 amplified a single band that corresponded to the size predicted from neuronal ChAT. Sequence analysis of this band showed it to be identical to neuronal ChAT. Thus the ChAT protein expressed by H82 cells is identical in sequence to the ChAT expressed in neuronal tissue.



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. PCR amplification of ChAT from H82 RNA. Upper panel, strategy used to amplify the ChAT mRNA. The entire coding region was amplified in two overlapping segments, A and B: segment A, the amplification of exons 5–11; segment B, the amplification of exons 11–18. UT, untranslated. A, RT-PCR from exon 5 to exon 11. B, RT-PCR from exon 11 to 18. In A, the 987-bp band is exactly the predicted size based on neuronal ChAT. The 810-bp band corresponds to authentic ChAT missing exon 10. In B, the 1151-bp band is exactly the predicted size based on neuronal ChAT. The identity of the amplified bands was confirmed by subcloning and sequence analysis as described in "Materials and Methods."

 
Expression of mAChR and nAChR in SCLC Cell Lines.
All of the SCLC cell lines except H378 expressed the {alpha}7, {alpha}5, and ß2 nAChR subunit mRNAs (Fig. 3A)Citation . {alpha}3 nAChR was expressed in SCLC cell lines H69, H82, H345, H417, H592, was absent in H378, and was not tested in H209 and H510. ß4 nAChR was expressed in SCLC cell lines H69, H82, H209, and H345, but not in H378, H417, H510, and H592. The M3 mAChR and M5 mAChR were expressed in all of the SCLC cell lines tested (Fig. 3B)Citation .



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Expression of mAChR and nAChR mRNA in SCLC cell lines. RT-PCR and Southern hybridizations were performed on total RNA prepared from the indicated cell lines. Primers and probes are described in "Materials and Methods." A, nAChR expression. Expression of {alpha}3, {alpha}5, {alpha}7, ß2, and ß4 nAChR subunit mRNA as shown. B, mAChR expression. M3 mAChR and M5 mAChR were expressed in all of the SCLC cell lines tested. ND, not done.

 
Quantitative Analysis of ChAT, VAChT, {alpha}7, and ß2 nAChR Subunit mRNA.
To quantify levels of mRNA expression and to further confirm expression, real-time PCR was performed for selected cholinergic mRNAs. As shown in Table 2Citation , real-time PCR with different primer sets confirmed the expression observed by conventional RT-PCR. The quantitation achievable with real-time PCR also showed that there was significant variation in levels of ChAT, VAChT, {alpha}7 nAChR, and ß2 nAChR mRNA among the SCLC cell lines tested. Relative levels of ChAT mRNA in cell lines tested were as follows: H82>H69>H417>H345>H378>H592. ChAT mRNA was highest in H82 cells and more than 70 times greater than the lowest, H592, cells. Relative levels of VAChT were H417>H345>H82>H592>H69>H378. {alpha}7 nAChR subunit mRNA levels were H82>H345>H592>H417>H69>H378, and ß2 nAChR subunit mRNA levels were H592>H345>H82>H417>H69>H378.


View this table:
[in this window]
[in a new window]

 
Table 2 ChAT, VACHT, {alpha}7- and ß2-nAChR subunit mRNA levels in SCLC cell lines

RNAs levels in the cell lines shown were quantified by real-time PCR as described in "Materials and Methods." Levels were standardized to 18S RNA and are expressed as mean ± SE. Comparisons are valid within RNAs but not between RNAs.

 
ACh Secretion by H82 Cells.
Synthesis and secretion of ACh by H82 cells was confirmed by HPLC with enzymatically coupled electrochemical detection. As shown in Fig. 4, A and BCitation , ACh was easily detected in supernatants of H82 cell cultures. No ACh was detected in the media prior to cell culture. Addition of 5 x 10-5 M neostigmine significantly increased media ACh levels (P < 0.001). This confirms the synthesis of ACh by H82 cells and also suggests the presence of acetylcholinesterase activity in the H82-conditioned culture medium. ACh was also readily detectable in supernatants of H345 cell cultures, thus demonstrating that ACh is secreted by both classic and variant SCLC cell lines. Next, vesamicol, an inhibitor of VAChT, was used to determine the role of VAChT in ACh release from H82 cells. As shown in Fig. 2CCitation , vesamicol reduced H82 cell ACh basal release in a concentration-dependent manner. Vesamicol (10-6 and 10-5 M) significantly decreased H82 cell ACh release (P = 0.012 and P = 0.013, respectively). suggesting the presence of a vesamicol-sensitive VAChT activity in H82 cells. However, the ACh decrease caused by 10-5 M vesamicol was only 40%, suggesting that a vesamicol-independent pathway for H82 ACh release may also exist in SCLC cells. Next, the sensitivity of ACh secretion to hemicholinium-3 was determined. As shown in Fig. 4DCitation , hemicholinium-3 reduced H82 cell basal ACh release in a concentration-dependent manner. Concentrations of 10-7, 10-6, and 10-5 M hemicholinium-3 resulted in the significant decrease of H82-cell basal ACh release in the presence of 5 x 10-5 M neostigmine (P < 0.010, P < 0.047, and P < 0.037, respectively), suggesting the presence of a hemicholinium-3-sensitive, choline transporter in H82 cells.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. ACh release from H82 cells. H82 cells were plated as described in "Materials and Methods." Drugs were added immediately after plating and cells incubated for 24 h; then media were removed for HPLC assay of ACh. A, HPLC chromatogram from cells cultured in the absence of neostigmine. B, HPLC chromatogram from cells cultured in the presence of 5 x 10-5 M neostigmine. C, effect of vesamicol on ACh levels in medium from cultured H82 cells. Drugs were added immediately after plating at the concentration shown and media was removed for assay 24 h later. Neostigmine (Neo) concentration = 5 x 10-5 M. (n = 6). D, effect of hemicholinium-3 on ACh levels in medium from cultured H82 cells. Drugs were added immediately after plating at the concentration shown and medium was removed for assay 24 h later. Neostigmine (Neo) concentration = 5 x 10-5 M (n = 4). Data are represented as mean ± SE. , P < 0.05 for no neostigmine compared with 5 x 10-5 neostigmine. *, P < 0.05 compared with no vesamicol (Ves) or hemicholinium-3 (Hem-3) but with neostigmine.

 
Regulation of H82 Cell Growth.
The role of endogenously synthesized ACh in regulating H82 cell growth was determined with inhibitors of ACh synthesis and with cholinergic receptor antagonists. As shown in Fig. 5ACitation , the nAChR antagonist mecamylamine inhibited H82 cell growth in a concentration-dependent and time-dependent manner (P < 0.05). A concentration of 10-5 M mecamylamine significantly inhibited H82 cell growth at 6, 9, and 12 days (P < 0.05). A concentration of 10-6 M mecamylamine significantly inhibited H82 cell growth only at 6 days (P < 0.05). As shown in Fig. 5BCitation , the mAChR antagonist atropine also inhibited H82 cell growth in a concentration-dependent and time-dependent manner (P < 0.05). A concentration of 10-6 M atropine significantly inhibited H82 cell growth at 6, 9, and 12 days (P < 0.05). As shown in Fig. 5CCitation , the VAChT inhibitor vesamicol decreased H82 cell growth in a concentration-dependent and time-dependent manner (P < 0.05). Concentration of 10-7, 10-6, and 10-5 M vesamicol significantly inhibited H82 cell growth at 9 and 12 days (P < 0.05). Similarly, the choline transport inhibitor hemicholinium-3 inhibited cell proliferation in a time- and dose-dependent manner (Fig. 5D)Citation . Showing that these were not just nonspecific toxic effects, the nicotinic agonist nicotine and the muscarinic agonist carbachol significantly stimulated cell growth in time- and dose-dependent manners (Fig. 5, E and F)Citation .



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effect of modifying autocrine cholinergic signaling on H82 cell growth. H82 cells were plated in 96-well culture plates and cell proliferation measured after specified drug treatments. Cell numbers were measured at 0, 6, 9, and 12 days with using the MTS assay as described in "Materials and Methods." A, mecamylamine, a nicotinic antagonist; B, atropine, a muscarinic antagonist; C, vesamicol, a VAChT inhibitor; D, hemicholinium-3, a choline-uptake inhibitor; E, nicotine, a nicotinic agonist; F, carbachol, a muscarinic agonist. {square}, control; , 10-8 M; , 10-7 M; , 10-6 M; {blacksquare}, 10-5 M. *, P < 0.05 by Neuman-Keuls test after ANOVA. All of the data are expressed as the mean ± SE of 12 replicates.

 
ChAT Expression in SCLC Tumor Biopsies.
Immunohistochemistry was performed to determine whether immunoreactive ChAT could be detected in paraffin sections of SCLC biopsies. As shown in Fig. 6Citation , ChAT could be readily detected in SCLC. In 14 of 26 SCLC tumor biopsies tested, ChAT immunoreactivity was detected (Fig. 6, A–C)Citation with average immunostaining intensity of 2+. As a positive control, {alpha}7 nAChR was tested and found to be expressed in 24 of 26 SCLC tested with average immunostaining intensity of 2+. All of the tumors that expressed ChAT also expressed {alpha}7 nAChR, although there was no significant correlation between the intensity of ChAT immunostaining and {alpha}7 immunostaining. ChAT immunoreactivity was also detected in H82 cells (Fig. 6D)Citation . H82 cells and tumor samples also expressed VAChT immunoreactivity (data not shown). Thus, these data demonstrate that SCLC tumors as well as SCLC cell lines express ChAT.



View larger version (127K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Immunohistochemistry of ChAT and {alpha}7 nAChR expression in SCLC tumor and cell lines. A, ChAT immunostaining in bronchoscopic biopsy of SCLC (x100; chromogen = VIP). B, higher power view of A (x400). C, {alpha}7 nAChR immunostaining in bronchoscopic biopsy of SCLC (x400; chromogen = AEC). D, immunofluorescent staining of ChAT in H82 cells. ChAT immunostaining is red (Texas-red-labeled second antibody). Nuclei are counterstained with Blue 4',6-diamidine-2-phenylindole (DAPI). x630.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study presents data that SCLC express a cholinergic autocrine loop that can regulate cell growth. The data presented here demonstrate that: 1, genes for all components of an ACh autocrine loop including ChAT, VAChT, CHT1, nAChR and mAChR are expressed in SCLC cells; 2, ChAT immunostaining is present in biopsies of SCLC and in SCLC cell lines; 3, SCLC cells are able to synthesize, secrete, and degrade ACh; and 4, SCLC cell growth is modulated by endogenous ACh synthesis. To our knowledge, this is the first study to demonstrate that SCLC cells have a cholinergic phenotype and that ACh exerts as an autocrine growth factor in human lung tumors.

For SCLC to express a cholinergic autocrine loop, ACh must be synthesized and secreted. The enzyme ChAT is required for ACh synthesis and, therefore, the expression of ChAT in SCLC must be definitively demonstrated to prove the existence of the autocrine loop. Because of its importance, we have, therefore, demonstrated the expression of ChAT in SCLC by multiple techniques. The presence of ChAT mRNA has been demonstrated by both conventional and real-time PCR with multiple independent primer sets. SCLC ChAT has been amplified and sequenced to show that the mRNA is authentic ChAT. The presence of ChAT protein has been demonstrated by immunohistochemistry in both cell lines and tumors, and, finally, the activity of ChAT has been proven by measuring ACh secretion in the medium. To further confirm this novel finding, ACh was measured independently in both the Mark laboratory (Oregon Health and Science University, Portland, OR) and the Blusztajn laboratory (Boston University School of Medicine, Boston, MA). Thus, multiple assays confirm the synthesis of ACh by SCLC.

The ChAT gene includes 18 exons (24) , and the coding region of ChAT spans exons 5–18. PCR fragments spanning these exons were amplified from H82 RNA sequenced and found to be identical to neuronal ChAT; thus, SCLCs express the same ChAT protein as do neurons. In neural tissues, multiple isoforms of ChAT are expressed. These forms differ primarily in the 5'-untranslated region and express similar ChAT proteins. Using exon-specific probes, we found that all of the SCLC cell lines tested expressed ChAT isoforms N, R, and S. ChAT isoform M was not observed. Real-time PCR revealed that ChAT mRNA levels differed considerably among the SCLC cell lines investigated. ChAT mRNA levels in H82 cells were highest among the SCLC cell lines examined, nearly 70 times higher than in H592 cells. ChAT mRNA was detected in both variant (H82) and classic (H345) SCLC cell lines and, therefore, at first analysis, does not appear to correlate with neuroendocrine phenotype and expression of neuropeptides (29 , 35) . Consistent with this, ACh was measured in the medium of both classic and variant cell lines, although further analysis of additional cell lines is needed to determine whether the expression of the cholinergic autocrine loop is indeed independent of neuroendocrine differentiation. Interestingly, there was also evidence for an alternate ChAT transcript lacking exon 10 that would in all likelihood produce an inactive protein. This alternate form has also been previously observed in neural tissue (36) .

The concept of nonneuronal ACh synthesis is longstanding. One of the earliest descriptions of nonneuronal ACh synthesis was by Morris who in 1966 reported that ACh was synthesized in the placenta (37) . Subsequent to the report by Morris, there have been multiple reports of the expression of ACh, acetylcholinesterase, and cholinergic receptors in the placenta (reviewed in Ref. 38 by Sastry). The role of placental ACh remains unknown, however. ChAT has also been reported in glia (39) and in WBCs (40) . Reinheimer et al. (22) and Klapproth et al. (41) have described ACh synthesis by bronchial epithelial cells, describing the presence of ChAT and measuring ACh in bronchial epithelial cells. The exact function of nonneuronal endogenous ACh is unclear, although our data suggest a role in regulating growth. A key question is which elements of ACh synthesis in neurons are also used by cancers.

The initial step for ACh synthesis is transport of choline into the cell. In neurons, the high-affinity sodium-dependent choline transporter CHT1 is needed for ACh synthesis (26 , 27) . However, by RT-PCR, most SCLC cell lines including H82 cells lack CHT1; thus, CHT1 is clearly not required for ACh synthesis by SCLC. Friedrich et al. (42) have described a sodium-independent choline transporter that is expressed in endothelial cells and that is inhibited by hemicholinium-3 with a Ki of ~50 µM. The data presented in Fig. 4CCitation suggest that a choline transporter with a similar affinity for hemicholinium-3 might be responsible for providing the choline for ACh synthesis in SCLC. Such a sodium-independent choline transporter has also been described in pulmonary type II cells in which the transport of choline is also key for surfactant synthesis (43) . That H345 cells express CHT1 suggests that there will be diversity as to which choline transporter is expressed by SCLC.

In neurons, VAChT packages ACh into synaptic vesicles, a necessary step for action potential-regulated secretion (44) . In this study all of the SCLC cell lines examined expressed VAChT mRNA, although mRNA levels varied greatly between lines. The VAChT gene is located within the ChAT gene, and these two genes comprise the cholinergic gene locus (25) . This raises the possibility that cells that express ChAT may coexpress VAChT even if VAChT is not needed for ACh secretion. However, given that vesamicol, a specific inhibitor of VAChT (45) decreased H82 ACh release in a concentration-dependent manner, VAChT appears to be active in SCLC cells. This is further supported by the immunohistochemical detection of VAChT in SCLCs (not shown). On the other hand, in the H82 cells, 10-5 M vesamicol decreased ACh release by only 40% as opposed to the larger suppressions seen in the neuronal cells (44) . This suggests that SCLC cell lines may also use a second, vesamicol-insensitive, perhaps nonvesicular, mechanism for ACh secretion as has been reported for placenta (46) .

For a cholinergic autocrine loop to exist, SCLC must also express receptors for ACh. There are two classes of ACh receptors, nAChR and mAChR. mAChR are G protein-coupled receptors. nAChR belong to the family of ligand-gated ion channels. nAChR consists of five homologous or heterologous subunits. To date, cDNA sequences for 17 kinds of nAChR subunits have been determined (47) . These include {alpha}4–10, ß1–4, {gamma}, {delta}, and {epsilon} (47) . In the central nervous system, the most abundant heteromeric form is ({alpha}4)2(ß2)3, the most abundant homomeric form is ({alpha}7)5. Autonomic ganglia express a complex mixture of {alpha}3, {alpha}5, {alpha}6, ß2, and ß4 receptors. As shown in Fig. 3Citation , SCLCs express {alpha}3, {alpha}5, {alpha}7, ß2, and ß4 nAChR. This pattern is consistent with the expression of ({alpha}7)5 homomers and ganglionic heteromeric forms of nAChR in SCLCs. Also, as shown in Fig. 3Citation , all of the SCLC cell lines tested expressed the M3 and M5 mAChR.

Our identification of nAChR in SCLC cell lines and tumors is consistent with other reports of nAChR in SCLCs. The initial observation of the effects of nicotine on SCLCs dates to Lauweryns et al. (48) , who noted that nicotine caused degranulation of rabbit pulmonary neuroendocrine cells. Subsequently Cunningham et al. (16) showed the presence of both nicotinic and muscarinic receptors on SCLCs. Chini et al. (30) and Tarroni et al. (15) did the first detailed description of subtypes of nAChRs in SCLC and reported the presence of {alpha}3, {alpha}5, ß4, and {alpha}7 nicotinic subunits; and Quik et al. (18) , similarly, reported the presence of {alpha}7 nAChR in SCLC. Thus the nAChR subtypes that we have detected are consistent with previous reports. Similarly, our observation of M3 receptors in SCLC cell lines is also consistent with other reports (14 , 20 , 49) .

Although the components for a cholinergic autocrine loop are clearly present in SCLC, to prove an autocrine loop exists, modulation of growth must be demonstrated. To prove this, we have demonstrated autocrine stimulation at multiple levels in the cholinergic loop. The inhibition of choline transport with hemicholinium-3 decreased ACh synthesis and significantly decreased cell proliferation (Fig. 5)Citation . The inhibition of VAChT with vesamicol decreased ACh synthesis and significantly decreased cell proliferation. Blockade of the receptors for endogenously synthesized ACh with muscarinic and nicotinic antagonists, slowed cell growth and, conversely, muscarinic and nicotinic agonists stimulated cell growth. Given that muscarinic antagonists, such as atropine, show some antagonism of nicotinic receptors (50) , the development and use of broad spectrum anticholinergic agents could be particularly effective in slowing tumor growth.

Our identification of a cholinergic autocrine loop by SCLC now provides a framework and rationale for the many reports in the literature that nicotine and related compounds stimulate SCLC growth. Nylen et al. (51) and Schuller et al. (19) have demonstrated that nicotine stimulates growth of lung cancer cell lines as well as of cultured pulmonary neuroendocrine cells and that similar effects are obtained with ACh and muscarine. Maneckjee and Minna (17) showed that nicotine blocked opiate-induced inhibition of lung cancer cell line growth. Cattaneo et al. (52) suggested that the effect of nicotine was mediated by the release of serotonin. Alternately, Nylen et al. (53) and Novak et al. (54) have suggested that the effects of nicotine are mediated by the release of gastrin-releasing peptide from SCLC. Our results suggest that nicotine modulates the endogenous cholinergic autocrine loop, which may, in turn, be linked to other growth factor pathways.

The exact nAChR subtype mediating the effects of nicotine on SCLC growth remains unclear because the effects of nicotine on growth have been reported to be blocked both by {alpha}-bungarotoxin ({alpha}BGT; Refs. 18 , 55 ), a specific blocker of {alpha}7 nAChR, and by mecamylamine (52) , a relatively nonspecific nAChR antagonist that would block the effects of {alpha}7 homomeric nAChR as well as more complex heteromeric nAChRs containing {alpha}3, {alpha}5, ß2, and ß4 subunits. These results are consistent with the receptors that we have identified on SCLC and with our observation that mecamylamine inhibits H82 proliferation. Given the multiple subtypes of nAChR expressed by SCLC, it is likely that multiple nAChR subtypes can modulate growth. Characterization of which nAChRs are most important in the cholinergic autocrine loop will require additional studies. Indeed, given the variation in levels of nAChR subunit expression among the different SCLC cell lines, it is likely that different SCLC cell lines and tumors will have different pharmacological responses to nicotine because of differences in nAChR type as well as in density. The extent to which these variations in ChAT and cholinergic receptor expression is related to tumor growth, progression, or prognosis also requires additional studies. It is also clear that only a subset of SCLC will express this cholinergic autocrine loop and that some SCLC will not synthesize or respond to ACh and that some SCLC may only degrade ACh. Additional studies are required to determine how widespread the expression of the cholinergic autocrine loop by SCLC will be.

The expression of a cholinergic phenotype by SCLC may help explain the SCLC paraneoplastic syndrome, LEMS, which is characterized by antineuronal antibodies leading to myasthenia (56) . It is possible that the presentation of cholinergic antigens such as ChAT, VAChT, and CHT1 results in production of antibodies targeted against tumor cells that react with central and peripheral cholinergic nerves and lead to LEMS. The expression of splice variants of ChAT, as shown in Fig. 2Citation , may also promote autoantibody production. Given that antibodies against neuronal nAChR have been reported in SCLC patients with paraneoplastic neurological syndromes (57) , it is likely that antibodies to these other cholinergic factors can be produced. Interestingly, in a recent report, SCLC patients with LEMS had a significantly longer survival compared with SCLC patients without LEMS (58) , which suggests that antibodies to cholinergic proteins may impair tumor growth.

In summary, our data demonstrate the expression of a cholinergic autocrine loop in SCLC and provide a number of new targets for modifying tumor growth. These findings also provide a theoretical basis for understanding the basis by which nicotine and related compounds modulate lung cancer growth.


    ACKNOWLEDGMENTS
 
We thank Jon Lindstrom for supplying antibodies to the {alpha}7 nAChR, Kalama Taylor for technical assistance with cell culture, Greg Disson (Oregon National Primate Research Center, Beaverton, OR) for providing the control human brain RNA, and Christopher Corless (Oregon Health and Science University, Portland, OR) for providing the SCLC archival specimens.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grants RR00163, CA69533, HD/HL37131, AG09525, DA11203, and NS42793. Back

2 To whom requests for reprints should be addressed, at Division of Neuroscience, Oregon National Primate Research Center, Beaverton, OR 97006. Phone: (503) 690-5512; Fax: (503) 690-5384; E-mail: spindele{at}ohsu.edu Back

3 The abbreviations used are: SCLC, small cell lung carcinoma; ACh, acetylcholine; ChAT, choline acetyltransferase; VAChT, vesicular ACh transporter; nAChR, nicotinic ACh receptor; mAChR, muscarinic ACh receptor; RT, reverse transcription; HPLC, high-performance liquid chromatography; LEMS, Lambert-Eaton myasthenic syndrome; AEC, 3-amino-9-ethylcarbazole; MTS, methyltetrazolium. Back

Received 6/27/02. Accepted 10/31/02.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Proctor R. N. Tobacco and the global lung cancer epidemic. Nat. Rev. Cancer, 1: 82-86, 2002.
  2. Cotran R. S., Kumar V., Collins T. . Robins Patholologic Basis of Disease, Ed. 6 697-755, W. B. Saunders Company Philadelphia, PA 1999.
  3. Simon G., Ginsberg R. J., Ruckdeschel J. C. Small-cell lung cancer. Chest Surg. Clin. North Am., 11: 165-188, 2001.[Medline]
  4. Cuttitta F., Carney D. N., Mulshine J., Moody T. W., Fedorko J., Fischler A., Minna J. D. Bombesin-like peptides can function as autocrine growth factors in human small cell lung cancer. Nature, 316: 823-826, 1985.[Medline]
  5. Cuttitta F., Carney D. N., Mulshine J., Moody T. W., Fedorko J., Fischler A., Minna J. D. Autocrine growth factors in human small cell lung cancer. Cancer Surv., 4: 707-727, 1985.[Medline]
  6. Staley J., Fiskum G., Davis T. P., Moody T. W. Neurotensin elevates cytosolic calcium in small cell lung cancer cells. Peptides, 10: 1217-1221, 1989.[Medline]
  7. Giaccone G., Battey J., Gazdar A. F., Oie H., Draoui M., Moody T. W. Neuromedin B is present in lung cancer cell lines. Cancer Res., 52 (Suppl.): 2732s-2736s, 1992.[Abstract/Free Full Text]
  8. Berger W., Setinek U., Mohr T., Kindas-Mugge I., Vetterlein M., Dekan G., Eckersberger F., Caldas C., Micksche M. Evidence for a role of FGF-2 and FGF receptors in the proliferation of non-small cell lung cancer cells. Int. J. Cancer, 83: 415-423, 1999.[Medline]
  9. Masui H., Kawamoto T., Sato J. D., Wolf B., Sato G., Mendelsohn J. Growth inhibition of human tumor cells in athymic mice by anti-epidermal growth factor receptor monoclonal antibodies. Cancer Res., 44: 1002-1007, 1984.[Abstract/Free Full Text]
  10. Kang Y., Prentice M. A., Mariano J. M., Davarya S., Linnoila R. I., Moody T. W., Wakefield L. M., Jakowlew S. B. Transforming growth factor-ß1 and its receptors in human lung cancer and mouse lung carcinogenesis. Exp. Lung Res., 26: 685-707, 2000.[Medline]
  11. Bunn P. A., Jr., Soriano A., Johnson G., Heasley L. New therapeutic strategies for lung cancer: biology and molecular biology come of age. Chest, 117: 163S-168S, 2000.[Abstract/Free Full Text]
  12. Woll P. J., Rozengurt E. [D-Arg1,D-Phe5,D-Trp7,9,Leu11]substance P, a potent bombesin antagonist in murine Swiss 3T3 cells, inhibits the growth of human small cell lung cancer cells in vitro. Proc. Natl. Acad. Sci. USA, 85: 1859-1863, 1988.[Abstract/Free Full Text]
  13. Rozengurt E. Autocrine loops, signal transduction, and cell cycle abnormalities in the molecular biology of lung cancer. Curr. Opin. Oncol., 11: 116-122, 1999.[Medline]
  14. Williams C. L., Lennon V. A. Activation of M3 muscarinic acetylcholine receptors inhibits voltage-dependent calcium influx in small cell lung carcinoma. J. Biol. Chem., 265: 1443-1447, 1990.[Abstract/Free Full Text]
  15. Tarroni P., Rubboli F., Chini B., Zwart R., Oortgiesen M., Sher E., Clementi F. Neuronal-type nicotinic receptors in human neuroblastoma and small-cell lung carcinoma cell lines. FEBS Lett., 312: 66-70, 1992.[Medline]
  16. Cunningham J. M., Lennon V. A., Lambert E. H., Scheithauer B. Acetylcholine receptors in small cell carcinomas. J. Neurochem., 45: 159-167, 1985.[Medline]
  17. Maneckjee R., Minna J. D. Opioid and nicotine receptors affect growth regulation of human lung cancer cell lines. Proc. Natl. Acad. Sci. USA, 87: 3294-3298, 1990.[Abstract/Free Full Text]
  18. Quik M., Chan J., Patrick J. {alpha}-Bungarotoxin blocks the nicotinic receptor mediated increase in cell number in a neuroendocrine cell line. Brain Res., 655: 161-167, 1994.[Medline]
  19. Schuller H. M., Nylen E. S., Park P., Becker K. L. Nicotine, acetylcholine and bombesin are trophic growth factors in neuroendocrine cell lines derived from experimental hamster lung tumors. Life Sci., 47: 571-578, 1990.[Medline]
  20. Fucile S., Napolitano M., Mattei E. Cholinergic stimulation of human microcytoma cell line H69. Biochem. Biophys. Res. Commun., 230: 501-504, 1997.[Medline]
  21. Wessler I. K., Kirkpatrick C. J. The Non-neuronal cholinergic system: an emerging drug target in the airways. Pulm. Pharmacol. Ther., 14: 423-434, 2001.[Medline]
  22. Reinheimer T., Bernedo P., Klapproth H., Oelert H., Zeiske B., Racke K., Wessler I. Acetylcholine in isolated airways of rat, guinea pig, and human: species differences in role of airway mucosa. Am. J. Physiol., 270: L722-L728, 1996.[Abstract/Free Full Text]
  23. Conti-Fine B. M., Navaneetham D., Lei S., Maus A. D. Neuronal nicotinic receptors in non-neuronal cells: new mediators of tobacco toxicity?. Eur. J Pharmacol., 393: 279-294, 2000.[Medline]
  24. Ohno K., Tsujino A., Brengman J. M., Harper C. M., Bajzer Z., Udd B., Beyring R., Robb S., Kirkham F. J., Engel A. G. Choline acetyltransferase mutations cause myasthenic syndrome associated with episodic apnea in humans. Proc. Natl. Acad. Sci. USA, 98: 2017-2022, 2001.[Abstract/Free Full Text]
  25. Eiden L. E. The cholinergic gene locus. J. Neurochem., 70: 2227-2240, 1998.[Medline]
  26. Okuda T., Haga T. Functional characterization of the human high-affinity choline transporter. FEBS Lett., 484: 92-97, 2000.[Medline]
  27. Apparsundaram S., Ferguson S. M., George A. L., Jr., Blakely R. D. Molecular cloning of a human, hemicholinium-3-sensitive choline transporter. Biochem. Biophys. Res. Commun., 276: 862-867, 2000.[Medline]
  28. Phelps R. M., Johnson B. E., Ihde D. C., Gazdar A. F., Carbone D. P., McClintock P. R., Linnoila R. I., Matthews M. J., Bunn P. A., Jr., Carney D., Minna J. D., Mulshine J. L. NCI-Navy Medical Oncology Branch cell line data base. J. Cell Biochem. Suppl., 24: 32-91, 1996.[Medline]
  29. Carney D. N., Gazdar A. F., Bepler G., Guccion J. G., Marangos P. J., Moody T. W., Zweig M. H., Minna J. D. Establishment and identification of small cell lung cancer cell lines having classic and variant features. Cancer Res., 45: 2913-2923, 1985.[Abstract/Free Full Text]
  30. Chini B., Clementi F., Hukovic N., Sher E. Neuronal-type {alpha}-bungarotoxin receptors and the {alpha}5-nicotinic receptor subunit gene are expressed in neuronal and nonneuronal human cell lines. Proc. Natl. Acad. Sci. USA, 89: 1572-1576, 1992.[Abstract/Free Full Text]
  31. Sekhon H. S., Jia Y., Raab R., Kuryatov A., Pankow J. F., Whitsett J. A., Lindstrom J., Spindel E. R. Prenatal nicotine increases pulmonary {alpha}7 nicotinic receptor expression and alters fetal lung development in monkeys. J. Clin. Investig., 103: 637-647, 1999.[Medline]
  32. Schoepfer R., Conroy W. G., Whiting P., Gore M., Lindstrom J. Brain {alpha}-bungarotoxin binding protein cDNAs and MAbs reveal subtypes of this branch of the ligand-gated ion channel gene superfamily. Neuron, 5: 35-48, 1990.[Medline]
  33. Sekhon H. S., Keller J. A., Proskocil B. J., Martin E. L., Spindel E. R. Maternal nicotine exposure upregulates collagen gene expression in fetal monkey lung. Association with {alpha}7 nicotinic acetylcholine receptors. Am. J. Respir. Cell. Mol. Biol., 26: 31-41, 2002.[Abstract/Free Full Text]
  34. Pedersen W. A., Berse B., Schuler U., Wainer B. H., Blusztajn J. K. All-trans- and 9-cis-retinoic acid enhance the cholinergic properties of a murine septal cell line: evidence that the effects are mediated by activation of retinoic acid receptor-{alpha}. J. Neurochem., 65: 50-58, 1995.[Medline]
  35. Gazdar A. F., Carney D. N., Nau M. N., Minna J. D. Characterization of variant subclasses of cell lines derived from small cell lung cancer having distinctive biochemical, morphological, and growth properties. Cancer Res., 45: 2924-2930, 1985.[Abstract/Free Full Text]
  36. Tooyama I., Kimura H. A protein encoded by an alternative splice variant of choline acetyltransferase mRNA is localized preferentially in peripheral nerve cells and fibers. J. Chem. Neuroanat., 17: 217-226, 2000.[Medline]
  37. Morris D. The choline acetyltransferase of human placenta. Biochem. J., 98: 754-762, 1966.[Medline]
  38. Sastry B. V. Human placental cholinergic system. Biochem. Pharmacol., 53: 1577-1586, 1997.[Medline]
  39. Lan C. T., Shieh J. Y., Wen C. Y., Tan C. K., Ling E. A. Ultrastructural localization of acetylcholinesterase and choline acetyltransferase in oligodendrocytes, glioblasts and vascular endothelial cells in the external cuneate nucleus of the gerbil. Anat. Embryol. (Berl.), 194: 177-185, 1996.[Medline]
  40. Fujii T., Tsuchiya T., Yamada S., Fujimoto K., Suzuki T., Kasahara T., Kawashima K. Localization and synthesis of acetylcholine in human leukemic T cell lines. J. Neurosci. Res., 44: 66-72, 1996.[Medline]
  41. Klapproth H., Reinheimer T., Metzen J., Munch M., Bittinger F., Kirkpatrick C. J., Hohle K. D., Schemann M., Racke K., Wessler I. Non-neuronal acetylcholine, a signalling molecule synthesized by surface cells of rat and man. Naunyn-Schmiedebergs Arch. Pharmakol., 355: 515-523, 1997.[Medline]
  42. Friedrich A., George R. L., Bridges C. C., Prasad P. D., Ganapathy V. Transport of choline and its relationship to the expression of the organic cation transporters in a rat brain microvessel endothelial cell line (RBE4). Biochim. Biophys. Acta, 1512: 299-307, 2001.[Medline]
  43. Kleinzeller A., Dodia C., Chander A., Fisher A. B. Na(+)-dependent and Na(+)-independent systems of choline transport by plasma membrane vesicles of A549 cell line. Am. J. Physiol, 267: C1279-C1287, 1994.[Abstract/Free Full Text]
  44. Auld D. S., Day J. C., Mennicken F., Quirion R. Pharmacological characterization of endogenous acetylcholine release from primary septal cultures. J. Pharmacol. Exp. Ther., 292: 692-697, 2000.[Abstract/Free Full Text]
  45. Varoqui H., Erickson J. D. Active transport of acetylcholine by the human vesicular acetylcholine transporter. J. Biol. Chem., 271: 27229-27232, 1996.[Abstract/Free Full Text]
  46. Wessler I., Roth E., Schwarze S., Weikel W., Bittinger F., Kirkpatrick C. J., Kilbinger H. Release of non-neuronal acetylcholine from the human placenta: difference to neuronal acetylcholine. Naunyn-Schmiedebergs Arch. Pharmakol., 364: 205-212, 2001.[Medline]
  47. Lindstrom J. Neuronal nicotinic acetylcholine receptors Narahashi T. eds. . Ion Channels, vol. IV: 377-450, Plenum New York 1996.
  48. Lauweryns J. M., Cokelaere M., Deleersynder M., Liebens M. Intrapulmonary neuroepithelial bodies in newborn rabbits. Influence of hypoxia, hyperoxia, hypercapnia, nicotine, reserpine, LDOPA and 5HTP. Cell Tissue Res., 182: 425-440, 1977.[Medline]
  49. Quigley R. L., Shafer S. H., Williams C. L. Regulation of integrin-mediated adhesion by muscarinic acetylcholine receptors and protein kinase C in small cell lung carcinoma. Chest, 114: 839-846, 1998.[Abstract/Free Full Text]
  50. Zwart R., Vijverberg H. P. Potentiation and inhibition of neuronal nicotinic receptors by atropine: competitive and noncompetitive effects. Mol. Pharmacol., 52: 886-895, 1997.[Abstract/Free Full Text]
  51. Nylen E. S., Becker K. L., Snider R. H., Tabassian A. R., Cassidy M. M., Linnoila R. I. Cholinergic-nicotinic control of growth and secretion of cultured pulmonary neuroendocrine cells. Anat. Rec., 236: 129-135, 1993.[Medline]
  52. Cattaneo M. G., Codignola A., Vicentini L. M., Clementi F., Sher E. Nicotine stimulates a serotonergic autocrine loop in human small cell lung carcinoma. Cancer Res., 53: 5566-5568, 1993.[Abstract/Free Full Text]
  53. Nylen E. S., Snider R. H., Moore C. F., Becker K. L. Modulation of pulmonary bombesin by nicotine and vagotomy. Life Sci., 47: 213-218, 1990.[Medline]
  54. Novak J., Escobedo-Morse A., Kelley K., Boose D., Kautzman-Eades D., Meyer M., Kane M. A. Nicotine effects on proliferation and the bombesin-like peptide autocrine system in human small cell lung carcinoma SHP77 cells in culture. Lung Cancer, 29: 1-10, 2000.
  55. Codignola A., Tarroni P., Cattaneo M. G., Vicentini L. M., Clementi F., Sher E. Serotonin release and cell proliferation are under the control of {alpha}-bungarotoxin-sensitive nicotinic receptors in small-cell lung carcinoma cell lines. FEBS Lett., 342: 286-290, 1994.[Medline]
  56. Carpentier A. F., Delattre J. Y. The Lambert-Eaton myasthenic syndrome. Clin. Rev. Allergy Immunol., 20: 155-158, 2001.[Medline]
  57. Benatar M., Blaes F., Johnston I., Wilson K., Vincent A., Beeson D., Lang B. Presynaptic neuronal antigens expressed by a small cell lung carcinoma cell line. J. Neuroimmunol., 113: 153-162, 2001.[Medline]
  58. Maddison P., Newsom-Davis J., Mills K. R., Souhami R. L. Favourable prognosis in Lambert-Eaton myasthenic syndrome and small-cell lung carcinoma. Lancet, 353: 117-118, 1999.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
O. E. Pardo, J. Latigo, R. E. Jeffery, E. Nye, R. Poulsom, B. Spencer-Dene, N. R. Lemoine, G. W. Stamp, E. O. Aboagye, and M. J. Seckl
The Fibroblast Growth Factor Receptor Inhibitor PD173074 Blocks Small Cell Lung Cancer Growth In vitro and In vivo
Cancer Res., November 15, 2009; 69(22): 8645 - 8651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
E. R. Spindel
Is Nicotine the Estrogen of Lung Cancer?
Am. J. Respir. Crit. Care Med., June 15, 2009; 179(12): 1081 - 1082.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
L. Paleari, E. Negri, A. Catassi, M. Cilli, D. Servent, R. D'Angelillo, A. Cesario, P. Russo, and M. Fini
Inhibition of Nonneuronal {alpha}7-Nicotinic Receptor for Lung Cancer Treatment
Am. J. Respir. Crit. Care Med., June 15, 2009; 179(12): 1141 - 1150.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Profita, A. Bonanno, L. Siena, A. Bruno, M. Ferraro, A. M. Montalbano, G. D. Albano, L. Riccobono, P. Casarosa, M. P. Pieper, et al.
Smoke, Choline Acetyltransferase, Muscarinic Receptors, and Fibroblast Proliferation in Chronic Obstructive Pulmonary Disease
J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 753 - 763.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
G. Xie, K. Cheng, J. Shant, and J.-P. Raufman
Acetylcholine-induced activation of M3 muscarinic receptors stimulates robust matrix metalloproteinase gene expression in human colon cancer cells
Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G755 - G763.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. Shah, S. Khurana, K. Cheng, and J.-P. Raufman
Muscarinic receptors and ligands in cancer
Am J Physiol Cell Physiol, February 1, 2009; 296(2): C221 - C232.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. Cheng, R. Samimi, G. Xie, J. Shant, C. Drachenberg, M. Wade, R. J. Davis, G. Nomikos, and J.-P. Raufman
Acetylcholine release by human colon cancer cells mediates autocrine stimulation of cell proliferation
Am J Physiol Gastrointest Liver Physiol, September 1, 2008; 295(3): G591 - G597.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Song, H. S. Sekhon, X. W. Fu, M. Maier, Y. Jia, J. Duan, B. J. Proskosil, C. Gravett, J. Lindstrom, G. P. Mark, et al.
Activated Cholinergic Signaling Provides a Target in Squamous Cell Lung Carcinoma
Cancer Res., June 15, 2008; 68(12): 4693 - 4700.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Zheng, J. D. Ritzenthaler, J. Roman, and S. Han
Nicotine Stimulates Human Lung Cancer Cell Growth by Inducing Fibronectin Expression
Am. J. Respir. Cell Mol. Biol., December 1, 2007; 37(6): 681 - 690.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. C.-l. Lam, L. Girard, R. Ramirez, W.-s. Chau, W.-s. Suen, S. Sheridan, V. P.C. Tin, L.-p. Chung, M. P. Wong, J. W. Shay, et al.
Expression of Nicotinic Acetylcholine Receptor Subunit Genes in Non-Small-Cell Lung Cancer Reveals Differences between Smokers and Nonsmokers
Cancer Res., May 15, 2007; 67(10): 4638 - 4647.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Song, H. S. Sekhon, A. Lu, J. Arredondo, D. Sauer, C. Gravett, G. P. Mark, S. A. Grando, and E. R. Spindel
M3 Muscarinic Receptor Antagonists Inhibit Small Cell Lung Carcinoma Growth and Mitogen-Activated Protein Kinase Phosphorylation Induced by Acetylcholine Secretion
Cancer Res., April 15, 2007; 67(8): 3936 - 3944.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Martinez-Moreno, S. Nieto-Ceron, J. Torres-Lanzas, F. Ruiz-Espejo, I. Tovar-Zapata, P. Martinez-Hernandez, J. N. Rodriguez-Lopez, C. J. Vidal, and J. Cabezas-Herrera
Cholinesterase activity of human lung tumours varies according to their histological classification
Carcinogenesis, March 1, 2006; 27(3): 429 - 436.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. S. Lips, C. Volk, B. M. Schmitt, U. Pfeil, P. Arndt, D. Miska, L. Ermert, W. Kummer, and H. Koepsell
Polyspecific Cation Transporters Mediate Luminal Release of Acetylcholine from Bronchial Epithelium
Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 79 - 88.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Tsurutani, S.S. Castillo, J. Brognard, C. A. Granville, C. Zhang, J. J. Gills, J. Sayyah, and P. A. Dennis
Tobacco components stimulate Akt-dependent proliferation and NF{kappa}B-dependent survival in lung cancer cells
Carcinogenesis, July 1, 2005; 26(7): 1182 - 1195.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
M. G. Pomper, E. Phillips, H. Fan, D. J. McCarthy, R. A. Keith, J. C. Gordon, U. Scheffel, R. F. Dannals, and J. L. Musachio
Synthesis and Biodistribution of Radiolabeled {alpha}7 Nicotinic Acetylcholine Receptor Ligands
J. Nucl. Med., February 1, 2005; 46(2): 326 - 334.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. N. Ye, E. S. L. Liu, V. Y. Shin, W. K. K. Wu, and C. H. Cho
The Modulating Role of Nuclear Factor-{kappa}B in the Action of {alpha}7-Nicotinic Acetylcholine Receptor and Cross-Talk between 5-Lipoxygenase and Cyclooxygenase-2 in Colon Cancer Growth Induced by 4-(N-Methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone
J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 123 - 130.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. J. Proskocil, H. S. Sekhon, Y. Jia, V. Savchenko, R. D. Blakely, J. Lindstrom, and E. R. Spindel
Acetylcholine Is an Autocrine or Paracrine Hormone Synthesized and Secreted by Airway Bronchial Epithelial Cells
Endocrinology, May 1, 2004; 145(5): 2498 - 2506.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
S. M. Ferguson and R. D. Blakely
The Choline Transporter Resurfaces: New Roles for Synaptic Vesicles?
Mol. Interv., February 1, 2004; 4(1): 22 - 37.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Trombino, A. Cesario, S. Margaritora, P. Granone, G. Motta, C. Falugi, and P. Russo
{alpha}7-Nicotinic Acetylcholine Receptors Affect Growth Regulation of Human Mesothelioma Cells: Role of Mitogen-Activated Protein Kinase Pathway
Cancer Res., January 1, 2004; 64(1): 135 - 145.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. R. Spindel
Neuronal nicotinic acetylcholine receptors: not just in brain
Am J Physiol Lung Cell Mol Physiol, December 1, 2003; 285(6): L1201 - L1202.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, P.
Right arrow Articles by Spindel, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, P.
Right arrow Articles by Spindel, E. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online