Cancer Research Annual Meeting 2010  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davila, E.
Right arrow Articles by Celis, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davila, E.
Right arrow Articles by Celis, E.
[Cancer Research 63, 3281-3288, June 15, 2003]
© 2003 American Association for Cancer Research


Immunology

Generation of Antitumor Immunity by Cytotoxic T Lymphocyte Epitope Peptide Vaccination, CpG-oligodeoxynucleotide Adjuvant, and CTLA-4 Blockade1

Eduardo Davila, Richard Kennedy and Esteban Celis2

Department of Immunology, Mayo Clinic and Mayo Graduate School, Rochester, Minnesota 55905


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although peptide immunization often leads to the induction of strong T-cell responses, it is seldom effective against established tumors. One possibility is that these T-cell responses are not strong enough or do not last sufficiently long to have an effect in tumor eradication. Here, we examined the role of synthetic oligodeoxynucleotide (ODN) adjuvants containing unmethylated cytosine-guanine motifs (CpG-ODN) and CTLA-4 blockade in enhancing the antitumor effectiveness of peptide vaccines intended to elicit CTL responses. The results show that combination immunotherapy consisting of vaccination with a synthetic peptide corresponding to an immunodominant CTL epitope derived from tyrosinase-related protein-2 administered with CpG-ODN adjuvant and followed by systemic injection of anti-CTLA-4 antibodies increased the survival of mice against the poorly immunogenic B16 melanoma. Interestingly, whereas this combination therapy was effective when administered to tumor-bearing mice (therapeutic protocol), it had no significant effect when applied in the prophylactic mode (i.e., before the tumor challenge). Moreover, the antitumor effect of the combination immunotherapy required the participation of CD4+ and CD8+ T lymphocytes and was accompanied by the induction of antitumor CD4+ T-cell responses. The overall results suggest that peptide vaccination of tumor-bearing mice, applied in combination with a strong adjuvant and CTLA-4 blockade, is capable of eliciting durable antitumor T cell responses that provide survival benefit. These findings bear clinical significance for the design of peptide-based therapeutic vaccines for human cancer patients.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Successful T-cell-based immunotherapy leading to increased survival of cancer patients is largely dependent upon the appropriate activation and persistence of antigen-specific antitumor T-cell responses. CD8+ CTLs constitute one of the most important arms of the immune system, exhibiting the capacity of recognizing and destroying cancerous cells. CTLs recognize antigen on tumor cells in the form of peptide fragments complexed with MHC class I molecules (1 , 2) . These T-cell peptide epitopes are derived from TAAs,3 which correspond to proteins that are synthesized and subsequently processed by tumor cells. With the continued identification of TAAs and their corresponding T-cell epitopes (3) , major interests have been kindled for the development of peptide-based vaccines intended to induce antitumor immunity. Indeed, the use of synthetic peptide-based vaccines for the induction of CTL responses with the goal of providing antitumor effects has been extensively researched (4) . However, in most instances, artificial tumor model systems have been used, which are based on peptide vaccines prepared from "surrogate TAAs" such as viral or foreign proteins selected for their high immunogenic nature. Although these tumor model systems have served as proofs of principle for understanding some of the mechanisms involved in the generation of in vivo CTL responses bearing "antitumor" effector function, the findings of these studies have not taken in consideration some of the complexities inherent to the use of natural TAAs as immunogens. Specifically, because most TAAs are also expressed to some extent on some normal tissues, the significant barrier posed by immune tolerance has not been fully addressed.

In addition to the above, other hurdles have hindered the development of synthetic peptide-based vaccines aimed at inducing CTL responses (5) . First, peptides on their own are seldom immunogenic and therefore must routinely be coadministered with immune adjuvants whose function is to provide the necessary alarm or danger signals to awaken the immune system (6 , 7) . Most disturbingly, in some cases, peptide vaccination, even in the presence of adjuvant, can lead to the elimination of the CTLs recognizing the specific peptide epitope, resulting in enhanced tumor growth (8 , 9) . Based on these observations, it has been assumed that to activate the naïve CTLs into effector killer cells, the peptide in the vaccine has to be presented by activated and licensed DCs (10, 11, 12) . On the other hand, presentation of peptide epitopes by nonprofessional APCs or unlicensed DCs may result in the induction of CTL anergy or even in their demise. To surmount these obstacles, some researchers have opted to use peptide-pulsed DCs as vaccines with the purpose of inducing antitumor CTL responses (13 , 14) . Although this approach can result in effective antitumor immunity both in animal models and in human clinical studies (13, 14, 15, 16) , the complex nature of this labor-intensive therapeutic approach curtails its widespread use in the general cancer patient population.

In previous studies, we observed that peptide or protein vaccination administered with immunostimulatory ODNs containing unmethylated cytosine-guanine (CpG) motifs as adjuvant significantly increased the number of antigen-specific CTLs resulting in antitumor immunity (17) . The adjuvanticity of CpG-ODN on CTL responses was ascribed to its capacity to stimulate and increase the numbers of activated DCs and to the antiapoptotic effects that this compound had on T lymphocytes, which allowed the expansion of antigen-stimulated cells by preventing activation-induced cell death (18 , 19) . However, in these studies, we used chicken Ova and its immunodominant CTL epitope (Ova257–264) as model TAA, and thus, these experiments did not realistically represent the scenario of a natural TAA that must follow the rules of T-cell tolerance. With the objective of extending our previous findings to a more physiological TAA, we have now selected the well-characterized melanoma-specific, H-2Kb-restricted CTL epitope derived from mouse TRP2 represented by peptide TRP2180–188 (20 , 21) . In addition, in the work described here, we included a CTLA-4 blockade regimen to prevent down-regulation of the CTL responses due to the cross-linking of CTLA-4 on T cells by its ligands, B7.1 and B7.2, which is known to provide negative signals to the T cells (22, 23, 24) . Our results show that TRP2180–188 peptide vaccination administered with CpG-ODN adjuvant and CTLA-4 blockade generated significant antigen-specific CD8+ CTL responses. Moreover, the vaccination protocol enhanced the overall survival against B16 melanoma when administered in the therapeutic mode but not with a prophylactic protocol. The antitumor effect of this peptide vaccine combination required the presence of CD4+ T cells, some of which responded to antigens expressed by the tumor cells. These findings indicate that peptide vaccines may be effective as therapies against established tumors if they are administered in combination with strong adjuvants and immunoregulatory strategies such as CTLA-4 blockade.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mice.
Female 6–8-week-old C57BL/6, CD4-/-, and CD8-/- mice were obtained from The Jackson Laboratory (Bar Harbor, ME) or Charles River Laboratories (Wilmington, MA). The Mayo Clinic’s Institutional Animal Care and Use Committee approved all experimental protocols described here.

Immunogens, Synthetic Peptides, ODNs, and Antibodies.
The TRP2180–188 CTL epitope (SVYDFFVWL) and the HTL pan DR epitope, known as PADRE (AKXVAAWTLKAAA where X = cyclohexylalanine; Ref. 25 ), were prepared by standard solid-phase methods using an Applied Biosystems synthesizer (Foster City, CA) and purified by high-performance liquid chromatography. The purity (95%) and identity of peptides were confirmed by high-performance liquid chromatography and mass spectrometry analysis. The previously described immunostimulatory synthetic ODN-1826 (17 , 18 , 26) , containing two CpG motifs (TCCATGACGTTCCTGACGTT), was used throughout this work. Synthetic ODNs were prepared with a nuclease-resistant phosphorothioate backbone by the Mayo Molecular Core Facility. Synthesized ODN-CpG was dried under vacuum, resuspended in RNase, DNase-free distilled H2O (pH 7.0), and stored at 4°C. Using a lymulus amoebocyte lysate, synthetic ODNs prepared in this manner were found to have less than 0.5 endotoxin unit/100 µg compound (the usual daily dose). The anti-CTLA-4 antibodies were generated from the UC10–4F10 hybridoma (27) and delivered i.p. after peptide immunization.

Cell Lines.
The B16 melanoma and the EL4 thymoma (both H-2b) were obtained from American Type Culture Collection (Manassas, VA). These cell lines were maintained in tissue culture in DMEM containing 10% fetal bovine serum, L-glutamine, and antibiotics. Cell lines used for these experiments were found to be free of Mycoplasma infection.

Immunizations and CpG-ODN Therapy.
All experiments were routinely performed in groups of 4–10 mice each. Mice received nine daily s.c. injections of 100 µg of CpG-ODN (referred to as 9XCpG-ODN therapy), at the nape of the neck. On day 5 (in the middle of 9XCpG-ODN therapy), the mice were vaccinated at a proximal site in the nape of the neck with 100 µg of TRP2180–188 peptide emulsified in IFA in a total volume of 100 µl. Where indicated, in some experiments the mice also received 140 µg of PADRE peptide mixed in the IFA emulsion to activate nonspecific T-helper responses. CTLA-4 blockade consisted of the i.p. injection of 100 µg of purified anti-CTLA-4 antibody on day 6 (1 day after the peptide administration), followed by two injections of 50 µg each of antibody applied on days 8 and 10. The peptide vaccine was administered either 7 days before tumor challenge (prophylactic protocol) or 7 days after the injection of the live tumor cells (therapeutic protocol). A schematic representation of the prophylactic immunization protocol is shown in Fig. 1ACitation .



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Prophylactic vaccination with TRP2180–188 peptide and CpG-ODN adjuvant does not protect against a subsequent tumor challenge. A, immunization schedule used for the prophylactic peptide vaccine. Four different groups of five mice each received various vaccination protocols ({circ}, {bullet}, {diamond}) or were left untreated ({square}) and challenged on day 12 with 4 x 104 live B16 melanoma cells as described in "Materials and Methods." B, survival of the mice from the different vaccination groups described in A was monitored and recorded on a daily basis. In this experiment, the TRP2180–188 peptide vaccine included the irrelevant HTL epitope, PADRE (140 µg/mouse), emulsified together in IFA.

 
Evaluation of Antitumor Effects in Vaccinated Mice.
The effect of peptide vaccination (with and without 9XCpG) on tumor growth and survival was evaluated in both prophylactic and therapeutic modes. For prophylaxis, the mice were immunized with TRP2180–188 peptide as described above, and 7 days later, they were challenged s.c. with 5 x 104 live B16 melanoma cells in the rear leg flank. For therapeutic evaluation, the mice received the TRP2180–188 peptide injection 7 days after the tumor challenge. Mice were observed daily or every other day, and when tumors became evident, their perpendicular diameters were measured using a set of calipers. Although some tumor-bearing mice died on their own, most animals were euthanized when tumors became ulcerated or surpassed 100 mm2 in size (as required by the Institutional Animal Care and Use Committee). Statistical analyses for evaluating the survival advantage of the vaccines were performed using log-rank tests.

CTL Assays.
LNs from immunized mice were removed 7 days after the peptide injection or otherwise as indicated, and single-cell suspensions were obtained by teasing the organs through a sterile nylon mesh. In most experiments, cells were pooled from each group of mice. LN cells (5 x 106) from immunized mice were maintained for 5 days in a humidified 7% CO2 incubator at 37°C in IMDM containing 10% fetal bovine serum (complete IMDM) and 25 IU interleukin 2/ml in 24-well flat-bottomed plates. The cytotoxic activity of the cells was determined by 4-h 51Cr release assays. Peptide-pulsed target cells were prepared by incubating EL4 cells with 10 µg/ml peptide in tissue culture for 12–16 h. B16 melanoma tumor cells were treated with 100 IU/ml recombinant mouse IFN-{gamma} for 18–24 h before the cytotoxicity assays to increase the expression of MHC class I and adhesion molecules. Approximately 3 x 106 target cells (EL4, peptide-EL4, or B16 cells) were labeled with 200 µCi of Na51Cr (Amersham Pharmacia Biotech, Piscataway, NJ) for 90 min at 37°C. Target cells were washed extensively and mixed with various numbers of effectors in 96-well round-bottomed plates. After a 4-h incubation period at 37°C, the radioactivity in the supernatants was determined using a TopCount scintillation counter (Packard Instruments, Meriden, CT), and the percentage of specific lysis was defined by the formula [(experimental 51Cr release - spontaneous 51Cr release)/(maximum 51Cr release - spontaneous 51Cr release)], where spontaneous release was the radioactivity of target cells released into the supernatant in the absence of effector cells (background), and maximum release was the radioactivity released by the targets incubated with 0.1% Triton X-100. All experimental determinations were performed in triplicate, and the averages and SD were consistently below 15% of the value of the mean.

Other Functional T-cell Assays.
The response of T cells to antigen stimulation was also evaluated by the production of lymphokines induced by antigen stimulation. Numbers of IFN-{gamma}-producing T lymphocytes were determined by flow cytometry using intracellular staining with fluoresceinated monoclonal antibodies specific for IFN-{gamma} (BD-PharMingen, San Diego, CA). For these experiments, 5 x 105 LN cells were cultured in 1 ml of complete IMDM for 5 days in the presence of 50 units of interleukin 2/ml. After this time, the cells were stimulated for 12 h with an equal number of EL4, peptide-pulsed EL4, or B16 cells (treated with 100 units of IFN-{gamma} 24 h before use). For some experiments (Fig. 8)Citation , the LN cells were stimulated with B16 melanoma cell lysates (3 freeze/thaw cycles), with the intention of stimulating the T cells via the cross-presentation of antigen by the APCs in the LN cell preparation. The stimulated LN cells were harvested and labeled for surface CD8 (or CD4) and intracellular IFN-{gamma} using FITC-labeled specific monoclonal antibodies (PharMingen) following the detailed instructions provided by the vendor. Cells were analyzed on a Becton Dickinson FACScan (San Jose, CA).



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Therapeutic and prophylactic/therapeutic TRP2180–188/9XCpG-ODN vaccination in tumor-bearing mice followed by CTLA-4 blockade generates melanoma-reactive CD4+ T-cell responses, which correlate with the persistence of antigen-specific CD8+ T cells. Groups of four mice were immunized with TRP2180–188/9XCpG-ODN and CTLA-4 blockade in the prophylactic mode (Phx, {circ}), therapeutic mode (Thx, {blacktriangleup}), or the prophylactic/therapeutic combination (Phx + Thx, {bullet}). As a negative control, one group of mice received the prophylactic protocol, but no TRP2180–188 peptide (Phx, {triangleup}). Seven days (for Thx and Phx + Thx) or 21 days (for Phx) after last peptide injection, cells from draining LNs were harvested and processed as described in "Materials and Methods" to determine antigen-specific CD4+ and CD8+ T-cell activity against TRP2180–188-pulsed EL4 cells and B16 melanoma cells. Antigen responses were determined via flow cytometry analysis for intracellular content of IFN-{gamma}. The total number of antigen-specific CD4+ and CD8+ T cells/draining LN was determined by multiplying the percentage of IFN-{gamma}+/CD4+ or IFN-{gamma}+/CD8+ cells by the total number of LN cells and subtracting this value from the number of CD4+ or CD8+ T cells responding nonspecifically to EL4 cells (without peptide). Horizontal lines represent the mean values for each group. The data were analyzed using Student’s t test, and significance is expressed by Ps observed between different groups.

 

    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Inefficacy of Peptide Vaccination for Protecting against a Melanoma Challenge.
The antitumor effect of peptide vaccination combined with CpG-ODN adjuvant and CTLA-4 blockade was first examined in the prophylactic setting (before tumor challenge). For these experiments, we selected the immunodominant H-2Kb-restricted TRP2180–188 CTL epitope, which was previously reported to confer resistance against B16 melanoma challenge in mice vaccinated with peptide-pulsed DCs but not in mice vaccinated with peptide emulsified in IFA (21) . Groups of five mice received one of various vaccination protocols shown in Fig. 1ACitation , and 7 days after peptide injection, the animals were challenged via s.c. route with 4 x 104 live B16 melanoma cells. The data presented in Fig. 1BCitation indicate that vaccination with CTL peptide TRP2180–188 together with the T-helper epitope PADRE, using 9XCpG-ODN adjuvant, even with the addition of CTLA-4 blockade, failed to provide a survival advantage against the subsequent tumor challenge. These results contrast with our previous observations in the Ova system, where peptide vaccination with 9XCpG-ODN adjuvant and without the need of CTLA-4 blockade protected the mice (80% survival) against a challenge with B16 cells expressing Ova (17) .

Induction of Antitumor CTL Responses by Peptide Vaccination Requires CpG-ODN Adjuvant.
The failure to protect mice against a B16 melanoma challenge using the above vaccination protocols could be explained if TRP2180–188-specific CTL responses were not generated by these vaccines. Thus, we assessed whether antigen-specific, tumor-reactive CTLs could be induced after a single immunization with the TRP2180–188 peptide/9XCpG-ODN vaccine. Significantly higher CTL responses to both peptide-pulsed EL4 and B16 melanoma were generated in the mice that received TRP2180–188 peptide in IFA and 9XCpG-ODN, as compared with those mice that were vaccinated with the peptide in IFA alone (Fig. 2)Citation . Furthermore, the addition of CTLA-4 blockade to the vaccination protocol slightly increased the magnitude of the response to the B16 melanoma target cells (Fig. 2Citation , right panel). These results demonstrate that CpG-ODN adjuvant was required for the induction of CTL responses against a peptide-based vaccine derived from a TAA, which is similar to what we reported in the Ova system (17) . Most important, these findings indicate that even though melanoma-reactive CTLs were generated with the TRP2180–188/9XCpG-ODN vaccine, these responses were not sufficiently robust to protect the mice against a tumor challenge.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. TRP2180–188 peptide vaccination with CpG-ODN adjuvant results in the generation of CTL responses. C57BL/6 mice (3 mice/group) were immunized s.c. with TRP2180–188 peptide emulsified in IFA administered in combination with 9XCpG adjuvant ({triangleup}), the same vaccine with CTLA-4 blockade ({circ}), or solely with TRP2180–188 peptide emulsified in IFA in the absence of CpG-ODN and anti-CTLA-4 ({square}). T-cell activity from the draining LNs was determined in a 4-h cytotoxicity assay against the following targets cells: EL4 (left panel); TRP2180–188 peptide-pulsed EL4 (middle panel); and B16 melanoma (right panel). All experimental determinations were performed in triplicate, and the averages and SD were consistently 15% of the mean.

 
Effects of Peptide Vaccination in Tumor-bearing Mice.
The TRP2180–188/9XCpG-ODN vaccine was also evaluated in the therapeutic mode (i.e., in tumor-bearing mice). The rationale for carrying out these experiments was the possibility that an initial CTL response in tumor-bearing animals could result in the generation of additional antitumor CTLs and even possibly helper T-cell activities against melanoma antigens via epitope spreading and the cross-presentation of antigens. Thus, we compared the antitumor effectiveness of TRP2180–188/9XCpG-ODN vaccination against B16 melanoma in the therapeutic and prophylactic settings. The results of this experiment indicated that the TRP2180–188/9XCpG-ODN vaccine combined with CTLA-4 blockade significantly increased the survival time (~50 days) of mice against B16 melanoma, but only when administered in the therapeutic mode (Fig. 3)Citation . In separate experiments, we established that all three components of the therapeutic vaccine (TRP2180–188 peptide, 9XCpG-ODN, and CTLA-4 blockade) were required to achieve the survival advantage and that the addition of PADRE HTL epitope did not increase the therapeutic benefit of the vaccine (data not shown). These results support our hypothesis that joint administration of a CTL peptide with CpG-ODN adjuvant and CTLA-4 blockade during the course of tumor progression results in enhanced antitumor activity.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Comparison of prophylactic and therapeutic peptide vaccination on overall survival to tumor challenge. Age-/sex-matched C57BL/6 mice (10 mice/group) were vaccinated withTRP2180–188 peptide/9XCpG-ODN with CTLA-4 blockade ({square}), TRP2180–188 peptide in IFA alone ({bullet}), or 9XCpG and CTLA-4 blockade but no peptide ({blacktriangleup}). Vaccination therapies were administered either before tumor challenge with 4 x 104 B16 cells (right panel) or after tumor challenge (left panel). Vaccines used in these experiments did not include the PADRE HTL epitope. The data were analyzed using log-rank tests to evaluate statistical significance.

 
Although the therapeutic vaccination increased the survival time against B16 melanoma, no complete tumor rejections were observed, and all animals ultimately succumbed to the disease. This could be due to: (a) the rapid growth of this tumor, which may not allow the sufficient time to generate an effective immune response; and/or (b) the induction of anergy or other immune escape/suppressor mechanisms by the tumor as it progresses in the host. These possibilities were examined by combining the prophylactic and therapeutic vaccination protocols, which would allow a more speedy generation of CTLs that supposedly would trigger the cascade of events leading to tumor rejection. The experiment presented in Fig. 4Citation demonstrates that, indeed, the majority (80%) of mice receiving two subsequent vaccination procedures (one prophylactic and the other therapeutic) survived the B16 melanoma challenge, whereas, as noted previously, the prophylactic vaccination alone had no effect, and the therapeutic vaccine extended survival but did not cure the mice. In subsequent experiments, we determined that all three components of the prophylactic/therapeutic combination vaccine (TRP2180–188 peptide, 9XCpG-ODN, and CTLA-4 blockade) were required during both immunizations to attain the antitumor effects (data not shown). The immunity provided by the combination prophylactic/therapeutic vaccine was long-lasting, as determined by the ability of 100% of the surviving mice from this experiment to reject a second tumor challenge (data not shown). These results indicate that the double immunization protocol may be more effective than the therapeutic vaccine because of the expedient generation of an immune response against the rapidly growing B16 melanoma. Moreover, the results also suggest that the inability of the therapeutic vaccine to eradicate disease is probably not solely due to an immune inhibitory activity of the tumor.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Enhancement of antitumor effect of TRP2180–188 peptide vaccination by prophylactic/therapeutic combination. Age-/sex-matched normal C57BL/6 mice were vaccinated in the prophylactic mode (left panel) with TRP2180–188 peptide/9XCpG-ODN and CTLA-4 blockade ({diamondsuit}), TRP2180–188 peptide in IFA alone ({circ}), or 9XCpG and CTLA-4 blockade, but no peptide ({blacktriangleup}). Additionally, one group of mice vaccinated with TRP2180–188 peptide/9XCpG-ODN with CTLA-4 blockade received a second complete regimen of vaccination after tumor challenge ({blacksquare}). As a control, one group of mice received a prophylactic/therapeutic vaccine combination of 9XCpG-ODN with CTLA-4 blockade without TRP2180–188 peptide ({triangleup}). For comparison, mice were vaccinated in the therapeutic mode (right panel) with TRP2180–188 peptide/9XCpG-ODN with CTLA-4 blockade ({diamondsuit}), TRP2180–188 peptide in IFA alone ({circ}), or 9XCpG and CTLA-4 blockade but no peptide ({blacktriangleup}). Vaccines used in these experiments did not include the PADRE HTL epitope. The data were analyzed using log-rank tests.

 
Effects of Peptide Vaccination in Tumor Growth Kinetics.
The antitumor activity of the TRP2180–188/9XCpG-ODN vaccine with CTLA-4 blockade therapy was also evaluated by the measurement of tumor sizes in the various groups of mice. The analysis of tumor growth kinetics (Fig. 5)Citation indicated that the tumors in mice receiving the complete therapeutic vaccination protocol (Fig. 5Citation , {blacktriangleup}) grew much slower than the tumors in mice that received the prophylactic vaccine (Fig. 5Citation , {square}) or those animals that were left untreated (Fig. 5Citation , {diamond}). Furthermore, the tumors also grew slowly in the small number of mice that developed tumors when receiving the combination of prophylactic/therapeutic vaccine (in this experiment, 3 of 10 mice developed tumors; Fig. 5Citation , {bullet}).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effects of TRP2180–188 peptide vaccination in tumor growth kinetics. C57BL/6 female mice were vaccinated with TRP2180–188 peptide/9XCpG-ODN with CTLA-4 blockade in the prophylactic mode ({square}), the therapeutic mode ({blacktriangleup}), or the prophylactic/therapeutic combination protocol ({bullet}). As controls, one group of mice was left untreated ({diamond}). Tumor sizes (in mm2) were scored by measuring perpendicular by longitudinal diameters and averaged for all tumor-bearing mice within each group. Numbers in parentheses represent the number of mice with tumor/total number of mice at the last day of scoring for each group before the mice had to be euthanized.

 
Requirement of CD4+ and CD8+ T Cells for Antitumor Immunity.
The roles of CD8+ CTLs and CD4+ T-helper lymphocytes in providing survival advantage of mice to B16 melanoma via the TRP2180–188/9XCpG-ODN vaccination with CTLA-4 blockade were examined. Various modes of vaccination were applied to wild-type C57BL6 mice and to CD8- and CD4-deficient (-/-) mice (both in the C57BL6 background), and their survival to a B16 melanoma challenge was evaluated. As shown in Fig. 6Citation , the survival advantage conferred by the therapeutic and the prophylactic/therapeutic vaccines was not evident in either CD4-/- or CD8-/- mice, indicating that both CD4+ and CD8+ T cells were required for the antitumor effects of the vaccine.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. An antitumor effect of peptide vaccination requires both CD4+ and CD8+ T lymphocytes. Normal wild-type (WT) BL/6, BL/6-CD8-/-, and BL/6-CD4-/- mice received TRP2180–188 peptide/9XCpG-ODN with CTLA-4 blockade in the prophylactic mode ({diamond}), therapeutic mode ({triangleup}), or the prophylactic/therapeutic combination protocol ({blacksquare}). As controls, one group of mice was left untreated ({circ}). Vaccines used in these experiments did not include the PADRE HTL epitope. The data were analyzed using log-rank tests between the control groups and the various treatment groups.

 
Although the requirement of the CD8+ CTLs was expected, the role of CD4+ T-helper lymphocytes in the effectiveness of the TRP2180–188/9XCpG-ODN vaccine is not so clear. In some cases, CD4+ T cells are required for the induction of CTLs, whereas in some circumstances, helper T cells can also play a critical role in the maintenance and longevity of the CTL responses. Thus, we evaluated whether CD4+ T cells were required for the induction of TRP2180–188-specific CTL responses to the 9XCpG vaccine. The results in Fig. 7Citation indicate that both C57BL6 and CD4-/- mice were capable of producing significant CD8+ T-cell responses to peptide-pulsed EL4 and B16 melanoma cells. Furthermore, the magnitude of the antigen-specific CD8+ T-cell responses induced by the peptide vaccine was not significantly different between the wild-type C57BL6 and the CD4-/- mice. These results suggest that in this model system of antitumor peptide vaccination, CD4+ T cells may be more important for maintenance of CTL responses than for their induction.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Induction of CD8+ T-cell responses by TRP2180–188/9XCpG-ODN vaccination is independent of CD4+ T cells. Wild-type (WT) or CD4-/- C57BL/6 mice were immunized with TRP2180–188 peptide/9XCpG-ODN with CTLA-4 blockade or left untreated. Seven days after peptide injection, cells from draining LNs were harvested and processed as described in "Materials and Methods" to determine antigen-specific CD8+ T-cell activity against TRP2180–188 peptide-pulsed EL4 cells and B16 melanoma cells. Antigen responses were determined via flow cytometric analysis for intracellular production of IFN-{gamma}. The total number of antigen-specific CD8+ T cells/draining LN was determined by multiplying the percentage of IFN-{gamma}+/CD8+ cells by the total number of LN cells and subtracting this value from the number of CD8 T cells responding nonspecifically to EL4 cells (without peptide). Horizontal lines represent the mean values for each group. The data were analyzed using Student’s t test, and significance is expressed by Ps observed between different groups.

 
The results presented thus far indicate that the therapeutic and the prophylactic/therapeutic vaccines are more effective than the administration of prophylactic vaccine alone because they are capable of inducing an antitumor CD4+ T-cell response, which could be critical for the persistence of the CTL responses. The results shown in Fig. 8Citation , where antigen-specific CD8+ and CD4+ T-cell responses were measured in vaccinated tumor-bearing mice, agree with this assessment. First, mice that received the therapeutic or the prophylactic/therapeutic vaccine displayed significant CD4+ responses to B16 melanoma antigens as compared with untreated or prophylactic-vaccinated mice. Second, CD8+ T-cell responses were also significantly higher in the same groups of mice exhibiting melanoma-reactive CD4+ T-cell responses. Third, and most important, no significant CD8+ T-cell responses to either peptide TRP2180–188 or B16 melanoma were evident in the prophylactic-vaccinated tumor-bearing mice. Because 9XCpG-ODN induces marked lymphoadenopathy, especially in the draining LNs (19) , we proceeded to reanalyze the data from the experiment presented in Fig. 8Citation to evaluate the actual frequency of effector T cells (antigen-reactive lymphokine secreting CD4+ or CD8+ T lymphocytes) in the LNs of the vaccinated mice. The results presented Fig. 9Citation indicate that approximately 20–30% of all CD8+ T cells in the LNs from tumor-bearing mice receiving the prophylactic/therapeutic or therapeutic vaccines were capable of recognizing TRP2180–188-pulsed EL4 cells. In addition, significant CD4+ T-cell responses to B16mel were also observed in the LNs of these mice. On the other hand, much lower numbers of CD8+ and CD4+ antigen-reactive effector cells were observed in mice receiving the prophylactic or mock-prophylactic vaccines. The overall results demonstrate that prophylactic vaccination was efficient at inducing CD8+ T-cell responses in tumor-free animals (Figs. 2Citation and 7)Citation but that these responses may have been down-regulated in the tumor-bearing mice, possibly due to the absence of CD4+ tumor-reactive T cells, which are only induced by the therapeutic vaccination.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. Frequency of antigen-reactive effector T lymphocytes in vaccinated tumor-bearing mice. The data from Fig. 8Citation were reanalyzed, and results are presented as the frequency (percentage) of effector CD8+ or CD4+ T cells (lymphokine-producing) corresponding to the total CD8+ or CD4+ LN cells, respectively. CD8/EL4p, CD8+ T cells tested with EL4 cells with TRP2180–188 peptide; CD8/EL4, CD8+ T cells tested with EL4 cells without peptide; CD8/B16m, CD8+ T cells tested with B16 melanoma cells; CD4/B16m, CD4+ T cells tested with B16 melanoma cells; CD4/EL4p, CD4+ T cells tested with B16 melanoma cells. Asterisks denote statistically significant differences (P < 0.05) in specific groups as compared with their corresponding controls: CD8/EL4p and CD8+/B16m versus CD8/EL4; and CD4/B16m versus CD4/EL4p.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The generation of antitumor CTL responses is an attractive approach for the treatment or prevention of cancer. Many types of T-cell-inducing vaccines ranging from gene-modified tumor cells to antigen-pulsed DCs have shown significant antitumor effects both in human and in mouse model systems (13, 14, 15, 16 , 28 , 29) . In addition, manipulation of the immune system via costimulation or CTLA-4 blockade can dramatically improve the effectiveness of some of these vaccines (22 , 23 , 30 , 31) . Recently, the identification of the TAA-derived CTL epitopes has opened the door to the development of highly defined vaccines in the form of in vivo-administered synthetic peptides that seek to elicit antitumor CTL responses. Although synthetic peptides are probably one of the simplest types of vaccines to prepare and characterize, these compounds are usually not very immunogenic unless they are administered in combination with strong adjuvants, which provide the appropriate danger/activation signals to the immune system. We reported previously (17) that vaccination of normal mice using the immunodominant and supposedly "strong" CTL epitope Ova257–264 (SIINFEKL) as a synthetic peptide formulated in an oil:water emulsion (IFA) failed to induce CTL responses unless the animals also received CpG-ODN as adjuvant. A possible explanation for these results is that our mouse colony is close to being germ-free, which would place the animal’s immune system in a low level of alert with insufficient activated APCs to stimulate CTL responses against an innocuous peptide. The potent adjuvanticity of CpG-ODN for CTL responses is derived from two of its biological properties. First, it is widely known that various forms of CpG-ODN, which mimic bacterial DNA, are able to stimulate and activate APCs such as DCs through their interaction with Toll-like receptor-9 (32, 33, 34, 35, 36, 37) . Second, as we have recently shown (19) , repeated administration of CpG-ODN results in the generation of strong antiapoptotic activity in both activated and naïve T cells via the enhanced expression of bcl-xL and c-FLIP, which would reduce the down-regulation of immune responses due to activation-induced cell death.

Our previous studies demonstrated that the CTL responses to the Ova257–264 peptide vaccine in the presence 9XCpG-ODN were sufficiently strong to protect mice against a subsequent challenge with an Ova-expressing B16 tumor and to extend the survival of tumor-bearing mice when administered in the therapeutic mode (17) . The purpose of the present studies was to extend these observations, which were done in the artificial Ova model system, to a peptide epitope representing a more realistic TAA, which would have to deal with issues such as immune tolerance and autoimmunity. In some respects, the results obtained with the TRP2180–188 CTL epitope were similar to those observed in the Ova system. First, peptide vaccination in IFA could only generate CTL responses if administered with CpG-ODN adjuvant (Fig. 2)Citation . Second, vaccination in the therapeutic mode extended survival by approximately 25–50 days (Figs. 3Citation , 4Citation , and 6)Citation . On the other hand, the main difference between the Ova and TRP2 systems is that prophylactic vaccination against tumor challenge was effective with the Ova vaccine but not with the TRP2 vaccination (Figs. 1Citation , 3Citation , and 4)Citation . Interestingly, when the prophylactic TRP2180–188 vaccination was followed by a second round of vaccine, administered after the tumor challenge (prophylactic/therapeutic protocol), the antitumor effectiveness of this procedure became comparable to that of the prophylactic Ova vaccine (~80% complete protection for both systems).

Notably, the two vaccination protocols that provided a survival advantage (the therapeutic vaccine and the prophylactic/therapeutic combination) resulted in the generation of CD4+ T-helper responses to B16 melanoma antigens (Fig. 8)Citation . In addition, both of these vaccination protocols failed to protect mice lacking CD4+ T cells (Fig. 6)Citation , indicating that this T-cell subset plays an important role in the antitumor effect of the peptide-based vaccine. Although CD4+ T cells were not required for the induction of the CTL responses to TRP2180–188 and B16 melanoma (Fig. 7)Citation , the helper T cells appeared to facilitate the persistence of high numbers of CTLs in tumor-bearing mice (Figs. 8Citation and 9)Citation . The overall results indicate that with peptide-based vaccines, the melanoma-reactive CD4+ T helper cells are extremely important during the effector phase of the immune response, possibly because they allow the CTLs to persist and expand at the tumor site. In agreement with this hypothesis, we have recently reported in an in vitro human melanoma system that activated CD4+ T lymphocytes were capable of providing direct costimulatory activity to a low number of tumor-reactive CTLs, enabling these cells to rapidly expand in the presence of large numbers of melanoma cells and ultimately eliminate all of the tumor cells from the cell cultures (38) . The costimulatory function of CD4+ T cells in this system required cell-to-cell contact with the CTLs and appeared to be mediated via CD27/CD70 and 4–1BB/4–1BBL interactions. It has also been described both in humans and in mice that adoptively transferred CD8+ CTLs are more likely to persist and remain functional when coadministered with antigen-specific CD4+ T cells (39 , 40) .

The mechanism by which the antimelanoma CD4+ T-cell responses were induced by the therapeutic and prophylactic/therapeutic vaccinations may be through the cross-presentation of melanoma-derived antigens. It is possible that through the cytolytic action of the TRP2180–188-specific CTLs, B16 melanoma antigens (or apoptotic tumor cells) are generated and subsequently captured by DCs, which become highly activated through the action of the CpG-ODN and then become highly effective in stimulating melanoma antigen-reactive CD4+ T-cell responses. The nature of the antigens recognized by the CD4+ melanoma-reactive T cells is unknown and presently being investigated.

The current findings hold significant implications for the design of peptide-based vaccination strategies for cancer in human patients. First, it is clear that peptide vaccination alone (in saline) or with simple adjuvants such as IFA will likely not provide a sufficiently strong CTL response to have a clinical benefit. Thus, stronger adjuvants such as CpG-ODN will be required to properly activate APCs and induce stronger T-cell responses. Second, the induction of tumor antigen-reactive CD4+ T-cell responses may be critical for the overall effectiveness of the antitumor CTLs. Although the CD4+ T-cell responses may be generated in some instances via the cross-presentation of antigens and epitope spreading after vaccination with a CTL peptide epitope (as shown here), it would probably be more effective to include T-helper peptide epitopes from TAAs in the vaccines themselves. The recent identification of several T-helper epitopes from various human TAAs should facilitate the implementation of this practice in future clinical studies (41, 42, 43, 44, 45, 46, 47, 48, 49) . Third and last, additional manipulation of the antitumor immune response may be required to prevent the down-modulation of T-cell responses so these can last sufficiently long to curb tumor progression. One of the most promising approaches to enhance immune responses by preventing negative signals to T lymphocytes is the use of CTLA-4 blockade, which, as shown here and in several other systems, enhances the effectiveness of antitumor vaccines. We hope that in the near future, clinical studies in human patients may be able to put into practice the current findings to demonstrate that peptide-based vaccines indeed constitute a simple, effective, and hopefully less hazardous approach than chemotherapy and radiation therapy for the treatment and prevention of cancer.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grants R01CA80782, R01CA82677, and P50CA91956. Back

2 To whom requests for reprints should be addressed, at Department of Immunology, GU421A, Mayo Clinic, Rochester MN 55905. Phone: (505) 284-0124; Fax: (505) 266-5255; E-mail: celis.esteban{at}mayo.edu Back

3 The abbreviations used are: TAA, tumor-associated antigen; HTL, helper T lymphocyte; DC, dendritic cell; APC, antigen-presenting cell; ODN, oligodeoxynucleotide; TRP2, tyrosinase-related protein 2; LN, lymph node; IFA, incomplete Freund’s adjuvant; IMDM, Iscove’s modified Dulbecco’s medium; Ova, ovalbumin. Back

Received 9/13/02. Accepted 4/ 9/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Zinkernagel R. M., Doherty P. C. MHC-restricted cytotoxic T cells: studies on the biological role of polymorphic major transplantation antigens determining T-cell restriction-specificity, function, and responsiveness. Adv. Immunol., 27: 51-177, 1979.[Medline]
  2. Germain R. N., Margulies D. H. The biochemistry and cell biology of antigen processing and presentation. Annu. Rev. Immunol., 11: 403-450, 1993.[Medline]
  3. Renkvist N., Castelli C., Robbins P. F., Parmiani G. A listing of human tumor antigens recognized by T cells. Cancer Immunol. Immunother., 50: 3-15, 2001.[Medline]
  4. Melief C. J., Offringa R., Toes R. E., Kast W. M. Peptide-based cancer vaccines. Curr. Opin. Immunol., 8: 651-657, 1996.[Medline]
  5. Buteau C., Markovic S. N., Celis E. Challenges in the development of effective peptide vaccines for cancer. Mayo Clin. Proc., 77: 339-349, 2002.[Abstract/Free Full Text]
  6. Janeway C. A., Jr., Medzhitov R. Innate immune recognition. Annu. Rev. Immunol., 20: 197-216, 2002.[Medline]
  7. Matzinger P. Tolerance, danger, and the extended family. Annu. Rev. Immunol., 12: 991-1045, 1994.[Medline]
  8. Toes R. E., Offringa R., Blom R. J., Melief C. J., Kast W. M. Peptide vaccination can lead to enhanced tumor growth through specific T-cell tolerance induction. Proc. Natl. Acad. Sci. USA, 93: 7855-7860, 1996.[Abstract/Free Full Text]
  9. Siegel C. T., Schreiber K., Meredith S. C., Beck-Engeser G. B., Lancki D. W., Lazarski C. A., Fu Y. X., Rowley D. A., Schreiber H. Enhanced growth of primary tumors in cancer-prone mice after immunization against the mutant region of an inherited oncoprotein. J. Exp. Med., 191: 1945-1956, 2000.[Abstract/Free Full Text]
  10. Schoenberger S. P., Jonges L. E., Mooijaart R. J., Hartgers F., Toes R. E., Kast W. M., Melief C. J., Offringa R. Efficient direct priming of tumor-specific cytotoxic T lymphocyte in vivo by an engineered APC. Cancer Res., 58: 3094-3100, 1998.[Abstract/Free Full Text]
  11. Ridge J. P., Di Rosa F., Matzinger P. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature (Lond.), 393: 474-478, 1998.[Medline]
  12. Bennett S. R., Carbone F. R., Karamalis F., Flavell R. A., Miller J. F., Heath W. R. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature (Lond.), 393: 478-480, 1998.[Medline]
  13. Porgador A., Gilboa E. Bone marrow-generated dendritic cells pulsed with a class I-restricted peptide are potent inducers of cytotoxic T lymphocytes. J. Exp. Med., 182: 255-260, 1995.[Abstract/Free Full Text]
  14. Mayordomo J. I., Zorina T., Storkus W. J., Celluzzi C., Falo L., Kast W. M., Ildstad S. T., DeLeo A. B., Lotze M. T. Bone marrow-derived dendritic cells pulsed with tumor peptides elicit protective and therapeutic anti-tumor immunity. Nat. Med., 1: 1297-1303, 1995.[Medline]
  15. Nestle F. O., Alijagic S., Gilliet M., Sun Y., Grabbe S., Dummer R., Burg G., Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med., 4: 328-332, 1998.[Medline]
  16. Banchereau J., Palucka A. K., Dhodapkar M., Burkeholder S., Taquet N., Rolland A., Taquet S., Coquery S., Wittkowski K. M., Bhardwaj N., Pineiro L., Steinman R., Fay J. Immune and clinical responses in patients with metastatic melanoma to CD34(+) progenitor-derived dendritic cell vaccine. Cancer Res., 61: 6451-6458, 2001.[Abstract/Free Full Text]
  17. Davila E., Celis E. Repeated administration of cytosine-phosphorothiolated guanine-containing oligonucleotides together with peptide/protein immunization results in enhanced CTL responses with anti-tumor activity. J. Immunol., 165: 539-547, 2000.[Abstract/Free Full Text]
  18. Grossmann M. E., Davila E., Celis E. Avoiding tolerance against prostatic antigens with subdominant peptide epitopes. J. Immunother., 24: 237-241, 2001.
  19. Davila E., Velez M. G., Heppelmann C. J., Celis E. Creating space: an antigen-independent, CpG-induced peripheral expansion of naive and memory T lymphocytes in a full T-cell compartment. Blood, 100: 2537-2545, 2002.[Abstract/Free Full Text]
  20. Bloom M. B., Perry-Lalley D., Robbins P. F., Li Y., El-Gamil M., Rosenberg S. A., Yang J. C. Identification of tyrosinase-related protein 2 as a tumor rejection antigen for the B16 melanoma. J. Exp. Med., 185: 453-459, 1997.[Abstract/Free Full Text]
  21. Schreurs M. W., Eggert A. A., de Boer A. J., Vissers J. L., van Hall T., Offringa R., Figdor C. G., Adema G. J. Dendritic cells break tolerance and induce protective immunity against a melanocyte differentiation antigen in an autologous melanoma model. Cancer Res., 60: 6995-7001, 2000.[Abstract/Free Full Text]
  22. Leach D. R., Krummel M. F., Allison J. P. Enhancement of antitumor immunity by CTLA-4 blockade. Science (Wash. DC), 271: 1734-1736, 1996.[Abstract]
  23. van Elsas A., Hurwitz A. A., Allison J. P. Combination immunotherapy of B16 melanoma using anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and granulocyte/macrophage colony-stimulating factor (GM-CSF)-producing vaccines induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune depigmentation. J. Exp. Med., 190: 355-366, 1999.[Abstract/Free Full Text]
  24. Egen J. G., Kuhns M. S., Allison J. P. CTLA-4: new insights into its biological function and use in tumor immunotherapy. Nat. Immunol., 3: 611-618, 2002.[Medline]
  25. Alexander J., Sidney J., Southwood S., Ruppert J., Oseroff C., Maewal A., Snoke K., Serra H. M., Kubo R. T., Sette A., et al Development of high potency universal DR-restricted helper epitopes by modification of high affinity DR-blocking peptides. Immunity, 1: 751-761, 1994.[Medline]
  26. Davis H. L., Weeratna R., Waldschmidt T. J., Tygrett L., Schorr J., Krieg A. M., Weeranta R. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J. Immunol., 160: 870-876, 1998.[Abstract/Free Full Text]
  27. Walunas T. L., Lenschow D. J., Bakker C. Y., Linsley P. S., Freeman G. J., Green J. M., Thompson C. B., Bluestone J. A. CTLA-4 can function as a negative regulator of T cell activation. Immunity, 1: 405-413, 1994.[Medline]
  28. Jaffee E. M., Hruban R. H., Biedrzycki B., Laheru D., Schepers K., Sauter P. R., Goemann M., Coleman J., Grochow L., Donehower R. C., Lillemoe K. D., O’Reilly S., Abrams R. A., Pardoll D. M., Cameron J. L., Yeo C. J. Novel allogeneic granulocyte-macrophage colony-stimulating factor-secreting tumor vaccine for pancreatic cancer: a Phase I trial of safety and immune activation. J. Clin. Oncol., 19: 145-156, 2001.[Abstract/Free Full Text]
  29. Dranoff G., Jaffee E., Lazenby A., Golumbek P., Levitsky H., Brose K., Jackson V., Hamada H., Pardoll D., Mulligan R. C. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. USA, 90: 3539-3543, 1993.[Abstract/Free Full Text]
  30. Kwon E. D., Hurwitz A. A., Foster B. A., Madias C., Feldhaus A. L., Greenberg N. M., Burg M. B., Allison J. P. Manipulation of T cell costimulatory and inhibitory signals for immunotherapy of prostate cancer. Proc. Natl. Acad. Sci. USA, 94: 8099-8103, 1997.[Abstract/Free Full Text]
  31. van Elsas A., Sutmuller R. P., Hurwitz A. A., Ziskin J., Villasenor J., Medema J. P., Overwijk W. W., Restifo N. P., Melief C. J., Offringa R., Allison J. P. Elucidating the autoimmune and antitumor effector mechanisms of a treatment based on cytotoxic T lymphocyte antigen-4 blockade in combination with a B16 melanoma vaccine: comparison of prophylaxis and therapy. J. Exp. Med., 194: 481-489, 2001.[Abstract/Free Full Text]
  32. Hartmann G., Weiner G. J., Krieg A. M. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA, 96: 9305-9310, 1999.[Abstract/Free Full Text]
  33. Weiner G. J., Liu H. M., Wooldridge J. E., Dahle C. E., Krieg A. M. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. USA, 94: 10833-10837, 1997.[Abstract/Free Full Text]
  34. Lipford G. B., Bauer M., Blank C., Reiter R., Wagner H., Heeg K. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur. J. Immunol., 27: 2340-2344, 1997.[Medline]
  35. Krieg A. M. CpG DNA: a novel immunomodulator. Trends Microbiol., 7: 64-65, 1999.[Medline]
  36. Hemmi H., Takeuchi O., Kawai T., Kaisho T., Sato S., Sanjo H., Matsumoto M., Hoshino K., Wagner H., Takeda K., Akira S. A Toll-like receptor recognizes bacterial DNA. Nature (Lond.), 408: 740-745, 2000.[Medline]
  37. Wagner H. Toll meets bacterial CpG-DNA. Immunity, 14: 499-502, 2001.[Medline]
  38. Giuntoli R. L., II, Lu J., Kobayashi H., Kennedy R., Celis E. Direct costimulation of tumor-reactive CTL by helper T cells potentiate their proliferation, survival, and effector function. Clin. Cancer Res., 8: 922-931, 2002.[Abstract/Free Full Text]
  39. Walter E. A., Greenberg P. D., Gilbert M. J., Finch R. J., Watanabe K. S., Thomas E. D., Riddell S. R. Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor N. Engl. J. Med., 333: 1038-1044, 1995.[Abstract/Free Full Text]
  40. Marzo A. L., Kinnear B. F., Lake R. A., Frelinger J. J., Collins E. J., Robinson B. W., Scott B. Tumor-specific CD4+ T cells have a major "post-licensing" role in CTL mediated anti-tumor immunity. J. Immunol., 165: 6047-6055, 2000.[Abstract/Free Full Text]
  41. Topalian S. L., Gonzales M. I., Parhurst M., Li Y. F., Southwood S., Sette A., Rosenberg S. A., Robbins P. F. Melanoma-specific CD4+ T cells recognize nonmutated HLA-DR-restricted tyrosinase epitopes. J. Exp. Med., 183: 1965-1971, 1996.[Abstract/Free Full Text]
  42. Zarour H. M., Storkus W. J., Brusic V., Williams E., Kirkwood J. M. NY-ESO-1 encodes DRB1*0401-restricted epitopes recognized by melanoma-reactive CD4+ T cells. Cancer Res., 60: 4946-4952, 2000.[Abstract/Free Full Text]
  43. Zarour H. M., Kirkwood J. M., Kierstead L. S., Herr W., Brusic V., Slingluff C. L., Jr., Sidney J., Sette A., Storkus W. J. Melan-A/MART-1(51-73) represents an immunogenic HLA-DR4-restricted epitope recognized by melanoma-reactive CD4(+) T cells. Proc. Natl. Acad. Sci. USA, 97: 400-405, 2000.[Abstract/Free Full Text]
  44. Jager E., Jager D., Karbach J., Chen Y. T., Ritter G., Nagata Y., Gnjatic S., Stockert E., Arand M., Old L. J., Knuth A. Identification of NY-ESO-1 epitopes presented by human histocompatibility antigen (HLA)-DRB4*0101–0103 and recognized by CD4(+) T lymphocytes of patients with NY-ESO-1-expressing melanoma. J. Exp. Med., 191: 625-630, 2000.[Abstract/Free Full Text]
  45. Manici S., Sturniolo T., Imro M. A., Hammer J., Sinigaglia F., Noppen C., Spagnoli G., Mazzi B., Bellone M., Dellabona P., Protti M. P. Melanoma cells present a MAGE-3 epitope to CD4(+) cytotoxic T cells in association with histocompatibility leukocyte antigen DR11. J. Exp. Med., 189: 871-876, 1999.[Abstract/Free Full Text]
  46. Chaux P., Vantomme V., Stroobant V., Thielemans K., Corthals J., Luiten R., Eggermont A. M., Boon T., van der Bruggen P. Identification of MAGE-3 epitopes presented by HLA-DR molecules to CD4(+) T lymphocytes. J. Exp. Med., 189: 767-778, 1999.[Abstract/Free Full Text]
  47. Kobayashi H., Lu J., Celis E. Identification of helper T-cell epitopes that encompass or lie proximal to cytotoxic T-cell epitopes in the gp100 melanoma tumor antigen. Cancer Res., 61: 7577-7584, 2001.[Abstract/Free Full Text]
  48. Kobayashi H., Song Y., Hoon D. S., Appella E., Celis E. Tumor-reactive T helper lymphocytes recognize a promiscuous MAGE-A3 epitope presented by various major histocompatibility complex class II alleles. Cancer Res., 61: 4773-4778, 2001.[Abstract/Free Full Text]
  49. Kobayashi H., Wood M., Song Y., Appella E., Celis E. Defining promiscuous MHC class II helper T-cell epitopes for the HER2/neu tumor antigen. Cancer Res., 60: 5228-5236, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
M. Kortylewski, M. Kujawski, A. Herrmann, C. Yang, L. Wang, Y. Liu, R. Salcedo, and H. Yu
Toll-like Receptor 9 Activation of Signal Transducer and Activator of Transcription 3 Constrains Its Agonist-Based Immunotherapy
Cancer Res., March 15, 2009; 69(6): 2497 - 2505.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
L. Fong and E. J. Small
Anti-Cytotoxic T-Lymphocyte Antigen-4 Antibody: The First in an Emerging Class of Immunomodulatory Antibodies for Cancer Treatment
J. Clin. Oncol., November 10, 2008; 26(32): 5275 - 5283.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
N. Asprodites, L. Zheng, D. Geng, C. Velasco-Gonzalez, L. Sanchez-Perez, and E. Davila
Engagement of Toll-like receptor-2 on cytotoxic T-lymphocytes occurs in vivo and augments antitumor activity
FASEB J, October 1, 2008; 22(10): 3628 - 3637.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. N. Haining, J. Davies, H. Kanzler, L. Drury, T. Brenn, J. Evans, J. Angelosanto, S. Rivoli, K. Russell, S. George, et al.
CpG Oligodeoxynucleotides Alter Lymphocyte and Dendritic Cell Trafficking in Humans
Clin. Cancer Res., September 1, 2008; 14(17): 5626 - 5634.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Zheng, N. Asprodites, A. H. Keene, P. Rodriguez, K. D. Brown, and E. Davila
TLR9 engagement on CD4 T lymphocytes represses {gamma}-radiation-induced apoptosis through activation of checkpoint kinase response elements
Blood, March 1, 2008; 111(5): 2704 - 2713.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. N. Kochenderfer and R. E. Gress
A Comparison and Critical Analysis of Preclinical Anticancer Vaccination Strategies
Experimental Biology and Medicine, October 1, 2007; 232(9): 1130 - 1141.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. N. Kochenderfer, J. L. Simpson, C. D. Chien, and R. E. Gress
Vaccination regimens incorporating CpG-containing oligodeoxynucleotides and IL-2 generate antigen-specific antitumor immunity from T-cell populations undergoing homeostatic peripheral expansion after BMT
Blood, July 1, 2007; 110(1): 450 - 460.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. N. Kochenderfer, C. D. Chien, J. L. Simpson, and R. E. Gress
Synergism between CpG-Containing Oligodeoxynucleotides and IL-2 Causes Dramatic Enhancement of Vaccine-Elicited CD8+ T Cell Responses
J. Immunol., December 15, 2006; 177(12): 8860 - 8873.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. M. Belyakov, D. Isakov, Q. Zhu, A. Dzutsev, D. Klinman, and J. A. Berzofsky
Enhancement of CD8+ T Cell Immunity in the Lung by CpG Oligodeoxynucleotides Increases Protective Efficacy of a Modified Vaccinia Ankara Vaccine against Lethal Poxvirus Infection Even in a CD4-Deficient Host
J. Immunol., November 1, 2006; 177(9): 6336 - 6343.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X.-F. Bai, J.-Q. Liu, P. S. Joshi, L. Wang, L. Yin, J. Labanowska, N. Heerema, P. Zheng, and Y. Liu
Different Lineages of P1A-Expressing Cancer Cells Use Divergent Modes of Immune Evasion for T-Cell Adoptive Therapy
Cancer Res., August 15, 2006; 66(16): 8241 - 8249.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
D. Wakita, K. Chamoto, Y. Zhang, Y. Narita, D. Noguchi, H. Ohnishi, T. Iguchi, T. Sakai, H. Ikeda, and T. Nishimura
An indispensable role of type-1 IFNs for inducing CTL-mediated complete eradication of established tumor tissue by CpG-liposome co-encapsulated with model tumor antigen
Int. Immunol., March 1, 2006; 18(3): 425 - 434.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. V. Maker, P. Attia, and S. A. Rosenberg
Analysis of the Cellular Mechanism of Antitumor Responses and Autoimmunity in Patients Treated with CTLA-4 Blockade
J. Immunol., December 1, 2005; 175(11): 7746 - 7754.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. R. Weihrauch, S. Ansen, E. Jurkiewicz, C. Geisen, Z. Xia, K. S. Anderson, E. Gracien, M. Schmidt, B. Wittig, V. Diehl, et al.
Phase I/II Combined Chemoimmunotherapy with Carcinoembryonic Antigen-Derived HLA-A2-Restricted CAP-1 Peptide and Irinotecan, 5-Fluorouracil, and Leucovorin in Patients with Primary Metastatic Colorectal Cancer
Clin. Cancer Res., August 15, 2005; 11(16): 5993 - 6001.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Paschen, M. Song, W. Osen, X. D. Nguyen, J. Mueller-Berghaus, D. Fink, N. Daniel, M. Donzeau, W. Nagel, H. Kropshofer, et al.
Detection of Spontaneous CD4+ T-Cell Responses in Melanoma Patients against a Tyrosinase-Related Protein-2-Derived Epitope Identified in HLA-DRB1*0301 Transgenic Mice
Clin. Cancer Res., July 15, 2005; 11(14): 5241 - 5247.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
K. Sanderson, R. Scotland, P. Lee, D. Liu, S. Groshen, J. Snively, S. Sian, G. Nichol, T. Davis, T. Keler, et al.
Autoimmunity in a Phase I Trial of a Fully Human Anti-Cytotoxic T-Lymphocyte Antigen-4 Monoclonal Antibody With Multiple Melanoma Peptides and Montanide ISA 51 for Patients With Resected Stages III and IV Melanoma
J. Clin. Oncol., February 1, 2005; 23(4): 741 - 750.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Demaria, N. Kawashima, A. M. Yang, M. L. Devitt, J. S. Babb, J. P. Allison, and S. C. Formenti
Immune-Mediated Inhibition of Metastases after Treatment with Local Radiation and CTLA-4 Blockade in a Mouse Model of Breast Cancer
Clin. Cancer Res., January 15, 2005; 11(2): 728 - 734.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Suzuki, D. Wakita, K. Chamoto, Y. Narita, T. Tsuji, T. Takeshima, H. Gyobu, Y. Kawarada, S. Kondo, S. Akira, et al.
Liposome-Encapsulated CpG Oligodeoxynucleotides as a Potent Adjuvant for Inducing Type 1 Innate Immunity
Cancer Res., December 1, 2004; 64(23): 8754 - 8760.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Daftarian, G.-Y. Song, S. Ali, M. Faynsod, J. Longmate, D. J. Diamond, and J. D. I. Ellenhorn
Two Distinct Pathways of Immuno-Modulation Improve Potency of p53 Immunization in Rejecting Established Tumors
Cancer Res., August 1, 2004; 64(15): 5407 - 5414.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Gregoire, C. Logre, P. Metharom, E. Loing, J. Chomilier, M. B. Rosset, P. Aucouturier, and C. Carnaud
Identification of two immunogenic domains of the prion protein--PrP--which activate class II-restricted T cells and elicit antibody responses against the native molecule
J. Leukoc. Biol., July 1, 2004; 76(1): 125 - 134.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Garbi, B. Arnold, S. Gordon, G. J. Hammerling, and R. Ganss
CpG Motifs as Proinflammatory Factors Render Autochthonous Tumors Permissive for Infiltration and Destruction
J. Immunol., May 15, 2004; 172(10): 5861 - 5869.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. B. Rosset, C. Ballerini, S. Gregoire, P. Metharom, C. Carnaud, and P. Aucouturier
Breaking Immune Tolerance to the Prion Protein Using Prion Protein Peptides Plus Oligodeoxynucleotide-CpG in Mice
J. Immunol., May 1, 2004; 172(9): 5168 - 5174.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Lu, Y. Higashimoto, E. Appella, and E. Celis
Multiepitope Trojan Antigen Peptide Vaccines for the Induction of Antitumor CTL and Th Immune Responses
J. Immunol., April 1, 2004; 172(7): 4575 - 4582.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davila, E.
Right arrow Articles by Celis, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davila, E.
Right arrow Articles by Celis, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online