Cancer Research Meeting Calendar  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakada, M.
Right arrow Articles by Sato, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakada, M.
Right arrow Articles by Sato, H.
[Cancer Research 63, 3364-3369, June 15, 2003]
© 2003 American Association for Cancer Research


Tumor Biology

Testican 2 Abrogates Inhibition of Membrane-type Matrix Metalloproteinases by Other Testican Family Proteins1

Mitsutoshi Nakada2, Hisashi Miyamori2, Junkoh Yamashita and Hiroshi Sato3

Department of Molecular Virology and Oncology [M. N., H. M., H. S.], Center for the Development of Molecular Target Drugs, Cancer Research Institute [H. S.], Department of Neurosurgery, Division of Neuroscience, Graduate School of Medical Science [M. N., J. Y.], Kanazawa University, Ishikawa 920-0934, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Testican family proteins are putative extracellular heparan/chondroitin sulfate proteoglycans of unknown function. We identified recently N-Tes, which is a product of testican 3 splicing variant gene, as an inhibitor of membrane-type matrix metalloproteinases (MT-MMPs). The inhibitory function is common among testican family members except for testican 2, which was shown to uniquely abolish inhibition of MT1-MMP- or MT3-MMP-mediated pro-MMP-2 activation by other testican family members. Testican 2 inactivates N-Tes by binding to the COOH-terminal extracellular calcium-binding domain of N-Tes through its NH2-terminal unique domain as demonstrated by coimmunoprecipitation analysis, and, thus, testican 2 was unable to inactivate a N-Tes deletion mutant lacking the extracellular calcium-binding domain (N-Tes-{Delta}122). Migration of U251 cells on collagen, which was dependent on MT1-MMP activity under serum-free condition, was inhibited by N-Tes or N-Tes-{Delta}122 deposited on collagen. Testican 2 was not incorporated into collagen by itself, and was deposited only in the presence of N-Tes, suggesting that testican 2 binds to N-Tes deposited on collagen. Binding of testican 2 to N-Tes deposited on collagen allowed migration of cells expressing MT1-MMP. Unlike wild-type N-Tes, N-Tes-{Delta}122 did not bind to testican 2, and, thus, expression of testican 2 did not recover cell migration blocked by N-Tes-{Delta}122. In situ hybridization showed that neurons are a major source of all of the testican family members in the normal brain. The quantitative reverse transcription-PCR analysis demonstrated that all of the testican family members are expressed prominently in normal brain, and their expression levels decrease as tumor grade increases. The expression level of testican 2 was the highest among testican family members regardless of histological grade of astrocytic tumors. These results suggest that abundant distribution of testican 2 may contribute to glioma invasion by inactivating other testican family members including N-Tes, which all inhibit MT-MMPs. We propose that N-Tes-{Delta}122, which is resistant to testican 2, may have therapeutic potential as a barrier against glioma invasion.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MMPs4 are a family of Zn2+-dependent enzymes that are essential for ECM turnover in normal and pathological conditions (1, 2, 3) . To date, 21 mammalian MMPs have been identified by cDNA cloning, and they can be subgrouped into 15 soluble-type and 6 MT-MMPs. MMPs are overexpressed in various human malignancies (2 , 3) . The first MT-MMP (MT1-MMP) was identified as an activator of pro-MMP-2, which functions on the cell surface (4) . Although the proteolytic activation of pro-MMP-2 is a common functional role proposed for all of the MT-MMPs (4, 5, 6, 7, 8) , expression of MT1-MMP most closely correlates with invasive phenotype of human tumors (9, 10, 11, 12, 13) .

Testican was first defined as an unnamed chondroitin/heparan sulfate proteoglycan in seminal plasma (14) . Corresponding cDNAs were isolated from human testis libraries, and the deduced protein was named testican (15) . To date 3 members of the testican family were identified by cDNA cloning, with deduced amino acid homologies of 42%, 51%, and 44% for testican 1/testican 2, testican 1/testican 3, and testican 2/testican 3, respectively (15, 16, 17) . Testican 1 and testican 2 are extracellular proteoglycans highly expressed in brain, and it was expected that testicans might contribute to the proteoglycan-rich ECM of the brain and associate with neurogenesis (17, 18, 19) . However, the biological function of testicans has not been extensively explored. We identified recently a splicing variant of the testican 3 gene by the expression cloning method, the product of which inhibits pro-MMP-2 processing mediated by MT-MMPs (20) . Furthermore, we revealed that all members of testican except testican 2 interfered with pro-MMP-2 activation mediated by MT1-MMP or MT3-MMP (20) . This suggests that testicans may regulate ECM degradation by interacting with MT-MMPs. However, its biological role in controlling ECM turnover has not been explored thus far. In addition, the expression level and tissue localization of testican mRNA in tumor tissues have not been studied.

In this study, we examined the interaction between testican 2 and other testican family proteins, and demonstrated that testican 2 abolishes inactivation of MT-MMPs by other testican family, and permits migration of glioma cells expressing MT1-MMP in the presence of other testican family proteins. Furthermore, we showed that testican 2 was expressed more highly than other testican family members both in normal and malignant astrocytic tissues. These results suggest that in contrast to other testican family members, only testican 2 contributes to malignant behavior of astrocytic tumors.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents.
DMEM was from Nissui Pharmaceutical Co., Ltd. (Tokyo, Japan). Primers were synthesized by Genset (Kyoto, Japan). Anti-FLAG M2 and anti-HA antibodies were purchased from Sigma and Santa Cruz Biotech (Santa Cruz, CA), respectively.

Cell Culture.
Human embryonic kidney 293T cells, and U251, U87, U373, and T98G glioma cells were obtained from Health Science Resources Bank (Osaka, Japan) and cultured in DMEM supplemented with 10% fetal bovine serum.

Expression Plasmids.
Expression plasmids for MT1-MMP, MT3-MMP, MMP-2, and TIMP-2 were as described previously (4 , 21) . Expression plasmids for testican 1, testican 2, testican 3, N-Tes, and N-Tes/testican-2 chimeric proteins tagged with FLAG or HA epitope at the COOH terminus were constructed as described previously (20 , 22) . Expression plasmids for N-Tes-{Delta}122, testican 2-{Delta}-133, and testican 2-{Delta}-89 tagged with FLAG or HA epitope were constructed by inserting cDNA fragment into respective plasmids. N-Tes-{Delta}122 cDNA fragment was PCR-amplified with pEAK8 5' primer and N-Tes reverse primer TCTAGATCCTGCTTCTTTCATCCTG that starts at nucleotide 473 (GenBank accession no. AB054866) with an extra Xba I site (italicized). The cDNA fragments encoding testican 2-{Delta}-133 and testican 2- {Delta}-89 were amplified with testican 2 forward primer GAATTCCAGACCACGATGGGCGC starting at nucleotide 278 (GenBank accession no. CAA04774) with an extra EcoRI site (italicized) and reverse primer TCTAGAGTCTTTGTTTCCATGGAG for testican 2- {Delta}-133 or TCTAGAGGGGTCCTTGGTGGTATC for testican 2- {Delta}-89 starting at nucleotide 684 or 553, respectively with an extra Xba I site (italicized).

Gelatin Zymography, Western Blotting, and Immunoprecipitation.
Gelatin zymography, Western blotting, and immunoprecipitation were performed as described previously (22 , 23) . Concentrations of N-Tes-FLAG and testican-2-FLAG in culture supernatants were estimated by Western blotting using partially purified proteins as standards.

Wound-induced Migration Assays.
293T cells transfected with expression plasmid for N-Tes-FLAG, N-Tes-{Delta}122-FLAG, and/or testican 2-HA were cultured on 12-well plates coated with collagen for 24 h. After removing cells by washing with 0.025% EDTA, U251 cells stably expressing MT1-MMP (2 x 105 cells/well) in DMEM containing 10% fetal bovine serum were plated. At 24 h after plating, subconfluent monolayers of the cells were scraped with a plastic tip and cultured additionally in serum-free DMEM. Migrating cells were photographed at 24 h after scraping.

Clinical Samples and Histology.
The classification of human brain tumors used in this study is based on the revised WHO criteria for tumors of the central nervous system (24) . Fifty-one astrocytic tumors consisted of 9 low-grade astrocytomas, 8 anaplastic astrocytomas, and 34 glioblastomas. All of the tumor tissues were obtained at primary resection, and none of the patients had been subjected to chemotherapy or radiation therapy before resection.

Real-Time Quantitative RT-PCR.
Real-time quantitative RT-PCR was performed as described previously with primers listed in Table 1Citation . The mRNA level of each testican gene was expressed as a molar ratio to GAPDH mRNA level.


View this table:
[in this window]
[in a new window]

 
Table 1 Nucleotide sequence of primers and probesa

 
ISH.
Specific antisense oligonucleotide DNA probes for ISH were designed complementary to the mRNA transcripts (Table 2)Citation . The specificity of each probe was confirmed as described previously (25) . All of the DNA probes were synthesized with six biotin molecules (hyper biotinylated) at the 3' end via direct coupling using standard phosphoramidite chemistry (Research Genetics, Huntsville, AL).


View this table:
[in this window]
[in a new window]

 
Table 2 Nucleotide sequences of oligo probes used for in situ hybridizationa

 
Statistics.
Statistical analyses were performed using the {chi}2 test and the two-tailed Mann-Whitney U test. Ps < 0.05 were considered significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Testican 2 Abolishes Inactivation of MT-MMPs by Other Testicans.
Testican family members, except for testican 2, inhibit pro-MMP-2 processing mediated by MT1-MMP or MT3-MMP by binding to them (20) . The effect of testican 2 expression on the inhibition of MT-MMPs by other testican family proteins was studied. Pro-MMP-2 was processed to an active form (Mr 62,000) through an intermediate form (Mr 64,000) by MT1-MMP, and mainly to an intermediate form by MT3-MMP (Fig. 1A)Citation . Pro-MMP-2 processing by both MT1-MMP and MT3-MMP were inhibited by testican 1, 3, and N-Tes as was observed with TIMP-2. Coexpression of testican 2 abolished the inhibition by testican 1, 3, and N-Tes, whereas inhibition by TIMP-2 was not affected. Pro-MMP-2 activation mediated by MT3-MMP was inhibited by N-Tes, which was abrogated by the expression of testican 2 dependent on the dose of testican 2 plasmid (Fig. 1B)Citation . The concentrations of N-Tes in culture supernatants ranged from 840 to 950 ng/ml, and the highest testican 2 concentration in the supernatants was ~920 ng/ml.



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Interaction between testican 2 and other testican family proteins. A, expression plasmids for MMP-2 (50 ng) and either MT1-MMP or MT3-MMP (100 ng) were cotransfected with plasmids for testican tagged with FLAG epitope or TIMP-2 (450 ng) as indicated. The culture supernatants were subjected to gelatin zymography (top panel). Cell lysates were analyzed by Western blotting with anti-FLAG antibody (bottom panel). B, expression plasmids for MMP-2 (50 ng), MT3-MMP (100 ng), and N-Tes-FLAG (450 ng) were cotransfected with testican 2-FLAG plasmid (450, 400, 350, 300, 250, 200, 150, 100, 50, or 0 ng, respectively), and the culture supernatants and cell lysates were analyzed as above.

 
Mapping of Domains for the Interaction between Testican 2 and N-Tes.
To identify the domain of N-Tes responsible for the interaction with testican 2, expression plasmids for N-Tes deletion mutants were constructed (Fig. 2, A and B)Citation . Testican 2-{Delta}89 and testican 2-{Delta}133 were both detected as two bands, one of which may represent monomer and the other dimmer form for each protein as estimated from molecular size. Expression of a deletion mutant of N-Tes, which consists of NH2-terminal 122-amino acid residues (N-Tes-{Delta}122), inhibited pro-MMP-2 processing mediated by MT1-MMP or MT3-MMP as was observed with N-Tes (Fig. 2CCitation , top panel). Expression of testican 2 abolished inhibition by N-Tes; however, inhibition by N-Tes-{Delta}122 was not affected by testican 2. A chimeric protein between N-Tes and testican 2, which consists of a signal peptide and the unique domain of N-Tes and other domains of testican 2 (N-Tes/Tes-2) inhibits MT-MMP-mediated pro-MMP-2 activation as shown with wild-type N-Tes. However, unlike wild-type N-Tes, inhibition by N-Tes/testican 2 chimera was not restored by testican 2 (Fig. 2CCitation , top panel). Deletion of COOH-terminal EC domain from N-Tes was enough to abrogate the susceptibility to testican 2 (data not shown), suggesting that testican 2 interacts with the COOH-terminal EC domain of N-Tes.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Direct interaction between testican 2 and N-Tes. A, schematic representation of N-Tes, testican 2, and their mutants. S (signal sequence), U (unique domain), FS (follistatin-like domain), EC (extracellular calcium-binding domain), TY (thyroglobulin-like domain), and two putative glycosaminoglycan attachment sites are indicated. aa, amino acids. B, expression of N-Tes or N-Tes-{Delta}122 tagged with HA epitope, and testican 2 or its mutant protein tagged with FLAG epitope was confirmed by Western blotting with anti-HA or anti-FLAG antibody. C, expression plasmids for N-Tes, testican 2, or their mutant proteins were cotransfected with MMP-2 plasmid and either MT1-MMP or MT3-MMP plasmid as described in legend for Fig. 1Citation . Culture supernatants were analyzed by gelatin zymography.

 
Next, to identify the domain of testican 2 responsible for the inactivation of N-Tes, testican 2 deletion mutants were constructed, which comprised the NH2-terminal 89- and 133-amino acid residues (testican 2-{Delta}89 and testican 2-{Delta}133), respectively (Fig. 2A)Citation . These deletion mutants still abrogated inhibition of MT-MMPs by N-Tes as wild-type testican 2 did (Fig. 2CCitation , bottom panel). These results suggest that the NH2-terminal unique domain of testican 2 interacts with the EC domain of N-Tes.

Testican 2 Forms a Complex with N-Tes.
To examine the interaction between N-Tes and testican 2, coimmunoprecipitation of these proteins was tested (Fig. 3)Citation . N-Tes-HA was detected in the precipitates from cells cotransfected with both N-Tes-HA and testican 2-FLAG plasmids, but not from cells transfected with either plasmid alone (Fig. 3ACitation , left panel). In the reciprocal experiment, testican 2 was coimmunoprecipitated with N-Tes (Fig. 3ACitation , right panel). N-Tes-HA was also coprecipitated with testican 2-FLAG deletion mutants (testican 2-{Delta}89-FLAG, testican 2-{Delta}133-FLAG; Fig. 3BCitation ); however, N-Tes-HA deletion mutant lacking EC domain ({Delta}122-HA) failed to be coprecipitated with testican-2-FLAG (Fig. 3C)Citation . These results indicate that testican 2 binds to the COOH-terminal EC domain of N-Tes through its NH2-terminal unique domain.



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Coprecipitation of testican 2 with N-Tes. A, expression plasmids for N-Tes-HA and testican 2-FLAG were transfected either alone or simultaneously. Immunoprecipitation was performed with anti-FLAG antibody (left), and the precipitates were analyzed by Western blotting with anti-HA antibody ({alpha}-HA). The blot was reprobed with anti-FLAG antibody ({alpha}-FLAG). Whole cell lysates were also immunoblotted with anti-HA antibody to confirm an equal expression of N-Tes-HA (WCL). Immunoprecipitates prepared as above using anti-HA antibody (right) were also analyzed by anti-FLAG ({alpha}-FLAG) or anti-HA antibody ({alpha}-HA). Whole cell lysates were immunoblotted to confirm an equal expression of testican 2-FLAG with anti-FLAG antibody (WCL). B, cells were transfected with expression plasmids for N-Tes-HA, testican 2-FLAG, and its deletion mutants ({Delta}89-FLAG and {Delta}133-FLAG) and analyzed as above. C, cells were transfected with expression plasmids for N-Tes-HA, N-Tes-{Delta}122-HA ({Delta}122-HA), and testican-2-FLAG, and analyzed as above.

 
Testican 2 Abrogates Reduction of MT1-MMP-mediated Cell Migration by N-Tes.
Stable transfection of MT1-MMP in U251 cells was confirmed by gelatin zymography, in which Mr 64,000 and 62,000 gelatinolytic bands, representing the intermediate and active form of MMP-2, respectively, were observed (Fig. 4A)Citation . Migration of parental U251 cells on collagen-coated dish in serum-free medium was minimal (Fig. 4B)Citation . Expression of MT1-MMP in U251 cells induced migration on collagen, and this was completely blocked by the addition of MMP inhibitor BB-94 to the culture medium. These results indicate that migration of U251 cells on collagen under serum-free condition is dependent on MT1-MMP activity. In the presence of 10% serum in the culture medium, U251 cells migrated actively on the collagen-coated dish regardless of MT1-MMP activity (data not shown).



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Effects of testican on cell migration. A, the culture medium from U251 cells mock-transfected (Mock) or transfected with MT1-MMP expression plasmid (MT1-MMP) were subjected to gelatin zymography. B, migration assay with mock-transfected (Mock) or MT1-MMP-transfected U251 cells (MT1-MMP) was performed in the presence (+BB94) or absence of 1 µM BB-94. Migrating cells were photographed under phase microscopy 24 h after scraping (x150). C, N-Tes-FLAG, testican 2-FLAG, or N-Tes-{Delta}122-HA deposited on collagen-coated plates and in cell lysates was analyzed by Western blotting with anti-FLAG or anti-HA antibody. D, migration assay with U251 glioma cells mock-transfected or stably transfected with the MT1-MMP cDNA was performed on collagen-coated plates pretreated as above.

 
To examine the effect of N-Tes, N-Tes-{Delta}122, and/or testican 2 on MT1-MMP-dependent cell migration, they were deposited on collagen by culturing 293T cells transfected with each gene on dishes coated with collagen. The amount of each protein deposited on collagen was analyzed by Western blotting (Fig. 4C)Citation . Both N-Tes and N-Tes-{Delta}122 were deposited effectively on collagen-coated on dishes. Testican 2 was deposited only at a trace level but at a moderate level when coexpressed with N-Tes. However, deposition of testican 2 was not stimulated by coexpression with N-Tes-{Delta}122.

The migration of U251 cells expressing MT1-MMP on N-Tes-coated collagen was quite low compared with migration on mock-coated collagen, and codeposition of testican 2 recovered the cell migration blocked by N-Tes. The migration of U251 cells expressing MT1-MMP was also inhibited by deposition of N-Tes-{Delta}122 on collagen. As described above, culturing of cells expressing both N-Tes-{Delta}122 and testican 2 deposited only N-Tes-{Delta}122 but not testican 2 on collagen, and thus migration of cells expressing MT1-MMP remained restricted.

The mRNA Expression Levels of Testican Family Genes.
To evaluate the expression levels of each testican family gene, quantitative RT-PCR for each testican mRNA was performed using GAPDH mRNA as an internal standard (Fig. 5)Citation . The mRNA levels of all of the testican family genes (testican mRNA:GAPDH mRNA molar ratios) were significantly lower in glioblastoma tissues (testican 1, 2, 3, and N-Tes, 0.093 ± 0.081, 0.107 ± 0.111, 0.007 ± 0.02, and 0.029 ± 0.041, respectively; n = 34) than those in normal brain tissues (0.251 ± 0.053, P < 0.01; 0.592 ± 0.224, P < 0.01; 0.182 ± 0.062, P < 0.01; and 0.359 ± 0.108, P < 0.01, respectively; n = 10), and their expression levels decrease significantly as tumor grade increases. The mean expression level of testican 2 was the highest among testican family regardless of histological grade of astrocytic tumors.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. The mRNA expression levels of testican family genes. The relative mRNA expression levels of testican family genes (testican mRNA:GAPDH mRNA molar ratios) in the normal brain (NB), low grade astrocytoma (LGA), anaplastic astrocytoma (AA), glioblastoma (GB), metastatic brain tumor (Meta), and glioma cell lines (GCL) were analyzed by the quantitative RT-PCR method. Each mRNA level was expressed as a proportion of the highest mRNA level of testican 2, which was given a value of 1. Bars indicate mean value. *, P < 0.05; **, P < 0.01.

 
ISH.
Cells expressing mRNA for testican family members in the normal brain and glioblastomas were identified by ISH (Fig. 6)Citation . The polyT probe gave a strong signal in all of the cells, but polyadenylic acid probe gave only a background signal in the normal brain and glioblastoma tissues. The signals for each testican mRNA were detected with antisense RNA probes mainly in the neurons, but also in some endothelial cells in normal brain (Fig. 6A)Citation . Only testican 1 and testican 2 mRNA was just detected in astrocytic tumor tissues, but testican 3 and N-Tes mRNA was at negligible level (Fig. 6B)Citation . These results are consistent with that of RT-PCR analysis.



View larger version (103K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. ISH for testican family mRNA. ISH was performed as described in "Materials and Methods." Note that strong signals for the mRNA of all testican family genes were detected in the neurons of normal brain, as indicated by arrows (A), and weak signals for testican 1 and testican 2 mRNAs but not for testican 3 and N-Tes in the neoplastic astrocytes as indicated by arrows (B). The poly(dT)20 probe gave a strong signal in all cells, and poly(dA)20 probe gave only a background signal in all tissue samples. Eosin counterstain. Tes-1, testican 1; Tes-2, testican 2; Tes-3, testican 3. Bar, 50 µm.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We identified previously N-Tes as an inhibitor of MT-MMPs, which is encoded by a spliced variant of testican 3 gene, and showed that testican 1 and testican 3 but not testican 2 also have an inhibitory function (20) . Testican 2 was identified through the screening of a human cDNA library using an expressed sequence tag related to BM-40/osteonectin/SPARC, and was shown to be expressed mainly in brain (17) . Our ISH study indicated that testican 2 was localized mainly to neurons and some endothelial cells in normal brain as reported previously (17 , 19) . Other testican family genes, including testican 3 and N-Tes, were also coexpressed predominantly in neurons. Because BM-40 is an ECM molecule well known as a modulator of cell adhesion and proliferation (17 , 26, 27, 28, 29) , testican 2 is also thought to function in tissue remodeling. Hartmann and Maurer (30) showed in vitro that testican 2 inhibits neurite outgrowth, suggesting that testican-2 may be involved in axonal pathfinding during the development of the nervous system. However, the precise function of testican 2 as a component of ECM still remained to be explored.

The present study demonstrated that testican 2 interacts with other testican family proteins and abolishes their inactivation of MT-MMPs. Testican 2 was shown to form a complex with N-Tes/testican 3 through the NH2-terminal unique domain of testican 2 and EC domain of N-Tes/testican 3. Thus, N-Tes-{Delta}122 lacking the EC domain did not interact with testican 2, but it did inhibit MT-MMPs. It was rather surprising to find that testican 2 abrogates inhibition of MT-MMP-mediated pro-MMP-2 activation by N-Tes by binding to its EC domain, because this is not involved in the inhibition of MT-MMPs. The precise mechanism of interaction between testican 2 and other testican family proteins is not clear thus far, but binding of testican 2 to the EC domain of N-Tes/testican 3 may cause conformational change, which may hamper access to MT-MMPs or may sterically hinder access to MT-MMPs.

Migration of U251 cells on dishes coated with collagen under serum-free condition was greatly enhanced by MT1-MMP activity. MT1-MMP-dependent cell migration on collagen was observed only under serum-free condition, and the cells migrated more aggressively in the presence of serum independent of MT1-MMP activity. Detachment of U251 cells from collagen would be the rate-limiting step under serum-free condition, and degradation of collagen by MT1-MMP may accelerate the migration. This would be supported by the fact that MT3-MMP, which does not degrade type I collagen, did not stimulate migration of U251 cells on collagen.5 Binding of testican 2 to N-Tes abrogated inhibition of MT1-MMP-dependent cell migration by N-Tes, as testican 2 abolished inhibition of MT1-MMP-mediated MMP-2 activation by N-Tes. N-Tes-{Delta}122, which is unable to form a complex with testican 2, does not induce deposition of testican 2 on collagen. Thus, testican 2 did not affect suppression of MT1-MMP-mediated MMP-2 activation or cell migration by N-Tes-{Delta}122.

The mRNA levels of all of the testican family members are lower in glioblastoma samples than those in normal brain tissues, and decrease significantly as tumor grade increases. The mRNA level of testican 2 is the highest among testican family members in normal and astrocytic tumor tissues. Furthermore, mRNAs of all of the testican family members are coexpressed mainly in neurons. Although the association of testican 2 with other ECM molecules remains to be examined, these results suggest that testican 2 could be deposited in ECM of brain in a complex form with other testican family proteins.

In conclusion, testican 2 may contribute to ECM remodeling by regulating function(s) of other testican family members, which possess MT-MMP inhibitory function. N-Tes-{Delta}122, which is incorporated into ECM and refractory to inactivation by testican 2, may have potential novel function as a barrier of glioma invasion.


    ACKNOWLEDGMENTS
 
We thank Erik Thompson for critical reading of the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants-in-aid for young scientists (B-14770707 to M. N.) and for scientific research (B2-13470290 to J. Y., and B2-14370053 and 11240203 to H. S., respectively) from the Ministry of Education, Science and Culture of Japan, and a grant from the Hokkoku Foundation for Cancer Research (to M. N.). Back

2 These authors have equally contributed to this work. Back

3 To whom requests for reprints should be addressed, at Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan. Phone: 81-76-265-2750; Fax: 81-76-234-4504; E-mail: vhsato{at}kenroku.kanazawa-u.ac.jp Back

4 The abbreviations used are: MMP, matrix metalloproteinase; ECM, extracellular matrix; TIMP, tissue inhibitor of metalloproteinase; MT, membrane type; HA, influenza virus hemagglutinin; EC, extracellular C2+-binding; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehydes-3-phosphate dehydrogenase; ISH, in situ hybridization; N-, NH2-. Back

5 Unpublished observations. Back

Received 9/ 5/02. Accepted 4/15/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Woessner J. F. J. Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J., 5: 2145-2154, 1991.[Abstract]
  2. Birkedal H. H., Moore W. G., Bodden M. K., Windsor L. J., Birkedal H. B., DeCarlo A., Engler J. A. Matrix metalloproteinases: a review. Crit. Rev. Oral Biol. Med., 4: 197-250, 1993.[Abstract/Free Full Text]
  3. Stetler-Stevenson W. G., Aznavoorian S., Liotta L. A. Tumor cell interactions with the extracellular matrix during invasion and metastasis. Annu. Rev. Cell Biol., 9: 541-573, 1993.[Medline]
  4. Sato H., Takino T., Okada Y., Cao J., Shinagawa A., Yamamoto E., Seiki M. A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature (Lond.), 370: 61-65, 1994.[Medline]
  5. Will H., Atkinson S. J., Butler G. S., Smith B., Murphy G. The soluble catalytic domain of membrane type 1 matrix metalloproteinase cleaves the propeptide of progelatinase A and initiates autoproteolytic activation. Regulation by TIMP-2 and TIMP-3. J. Biol. Chem., 271: 17119-17123, 1996.[Abstract/Free Full Text]
  6. Wang Y., Johnson A. R., Ye Q. Z., Dyer R. D. Catalytic activities and substrate specificity of the human membrane type 4 matrix metalloproteinase catalytic domain. J. Biol. Chem., 274: 33043-33049, 1999.[Abstract/Free Full Text]
  7. Lehti K., Valtanen H., Wickstrom S., Lohi J., Keski-Oja J. Regulation of membrane-type-1 matrix metalloproteinase activity by its cytoplasmic domain. J. Biol. Chem., 275: 15006-15013, 2000.[Abstract/Free Full Text]
  8. Velasco G., Cal S., Merlos-Suarez A., Ferrando A. A., Alvarez S., Nakano A., Arribas J., Lopez-Otin C. Human MT6-matrix metalloproteinase: identification, progelatinase A activation, and expression in brain tumors. Cancer Res., 60: 877-882, 2000.[Abstract/Free Full Text]
  9. Nomura H., Sato H., Seiki M., Mai M., Okada Y. Expression of membrane-type matrix metalloproteinase in human gastric carcinomas. Cancer Res., 55: 3263-3266, 1995.[Abstract/Free Full Text]
  10. Ueno H., Nakamura H., Inoue M., Imai K., Noguchi M., Sato H., Seiki M., Okada Y. Expression and tissue localization of membrane-type 1, 2, and 3 matrix metalloproteinases in human invasive breast carcinoma. Cancer Res., 57: 2055-2060, 1997.[Abstract/Free Full Text]
  11. Nakamura H., Ueno H., Yamashita K., Shimada T., Yamamoto E., Noguchi M., Fujimoto N., Sato H., Seiki M., Okada Y. Enhanced production and activation of progelatinase A mediated by membrane-type 1 matrix metalloproteinase in human papillary thyroid carcinomas. Cancer Res., 59: 467-473, 1999.[Abstract/Free Full Text]
  12. Nakada M., Nakamura H., Ikeda E., Fujimoto N., Yamashita J., Sato H., Seiki M., Okada Y. Expression and tissue localization of membrane-type 1, 2, and 3 matrix metalloproteinases in human astrocytic tumors. Am. J. Pathol., 154: 417-428, 1999.[Abstract/Free Full Text]
  13. Nakada M., Kita D., Futami K., Yamashita J., Fujimoto N., Sato H., Okada Y. Roles of membrane type 1 matrix metalloproteinase and tissue inhibitor of metalloproteinases 2 in invasion and dissemination of human malignant glioma. J. Neurosurg., 94: 464-473, 2001.[Medline]
  14. Bonnet F., Perin J. P., Maillet P., Jolles P., Alliel P. M. Characterization of a human seminal plasma glycosaminoglycan-bearing polypeptide. Biochem. J., 288: 565-569, 1992.
  15. Alliel P. M., Perin J. P., Jolles P., Bonnet F. J. Testican, a multidomain testicular proteoglycan resembling modulators of cell social behaviour. Eur. J. Biochem., 214: 347-350, 1993.[Medline]
  16. Charbonnier F., Perin J. P., Roussel G., Nussbaum J. L., Alliel P. M. Cloning of testican/SPOCK in man and mouse. Neuromuscular expression perspectives in pathology. C. R. Seances Soc. Biol. Fil., 191: 127-133, 1997.[Medline]
  17. Vannahme C., Schubel S., Herud M., Gosling S., Hulsmann H., Paulsson M., Hartmann U., Maurer P. Molecular cloning of testican 2: defining a novel calcium-binding proteoglycan family expressed in brain. J. Neurochem., 73: 12-20, 1999.[Medline]
  18. Bonnet F., Perin J. P., Charbonnier F., Camuzat A., Roussel G., Nussbaum J. L., Alliel P. M. Structure and cellular distribution of mouse brain testican. Association with the postsynaptic area of hippocampus pyramidal cells. J. Biol. Chem., 271: 4373-4380, 1996.[Abstract/Free Full Text]
  19. Marr H. S., Basalamah M. A., Bouldin T. W., Duncan A. W., Edgell C. J. Distribution of testican expression in human brain. Cell Tissue Res., 302: 139-144, 2000.[Medline]
  20. Nakada M., Yamada A., Takino T., Miyamori H., Takahashi T., Yamashita J., Sato H. Suppression of membrane-type 1 matrix metalloproteinase (MMP)-mediated MMP-2 activation and tumor invasion by testican 3 and its splicing variant gene product. N-Tes. Cancer Res., 61: 8896-8902, 2001.
  21. Takino T., Sato H., Shinagawa A., Seiki M. Identification of the second membrane-type matrix metalloproteinase (MT-MMP-2) gene from a human placenta cDNA library. MT-MMPs form a unique membrane-type subclass in the MMP family. J. Biol. Chem., 270: 23013-23020, 1995.[Abstract/Free Full Text]
  22. Miyamori H., Takino T., Kobayashi Y., Tokai H., Itoh Y., Seiki M., Sato H. Claudin promotes activation of pro-matrix metalloproteinase-2 mediated by membrane-type matrix metalloproteinases. J. Biol. Chem., 276: 28204-28211, 2001.[Abstract/Free Full Text]
  23. Nakada M., Yamashita J., Okada Y., Sato H. Ets-1 positively regulates expression of urokinase-type plasminogen activator (uPA) and invasiveness of astrocytic tumors. J. Neuropathol. Exp. Neurol., 58: 329-334, 1999.[Medline]
  24. Kleihues P., Burger P. C., Scheithauer B. W. Histological Typing of Tumours of the Central Nervous System11-20, Springer-Verlag Berlin 1993.
  25. Greene G. F., Kitadai Y., Pettaway C. A., von Eschenbach A. C., Bucana C. D., Fidler I. J. Correlation of metastasis-related gene expression with metastatic potential in human prostate carcinoma cells implanted in nude mice using an in situ messenger RNA hybridization technique. Am. J. Pathol., 150: 1571-1582, 1997.[Abstract]
  26. Bolander M. E., Young M. F., Fisher L. W., Yamada Y., Termine J. D. Osteonectin cDNA sequence reveals potential binding regions for calcium and hydroxyapatite and shows homologies with both a basement membrane protein (SPARC) and a serine proteinase inhibitor (ovomucoid). Proc. Natl. Acad. Sci. USA, 85: 2919-2923, 1988.[Abstract/Free Full Text]
  27. Mason I. J., Taylor A., Williams J. G., Sage H., Hogan B. L. Evidence from molecular cloning that SPARC, a major product of mouse embryo parietal endoderm, is related to an endothelial cell ‘culture shock’ glycoprotein of Mr 43,000. EMBO J., 5: 1465-1472, 1986.[Medline]
  28. Lane T. F., Sage E. H. Functional mapping of SPARC: peptides from two distinct Ca+(+)-binding sites modulate cell shape. J. Cell Biol., 111: 3065-3076, 1990.[Abstract/Free Full Text]
  29. Tremble P. M., Lane T. F., Sage E. H., Werb Z. SPARC, a secreted protein associated with morphogenesis and tissue remodeling, induces expression of metalloproteinases in fibroblasts through a novel extracellular matrix-dependent pathway. J. Cell Biol., 121: 1433-1444, 1993.[Abstract/Free Full Text]
  30. Hartmann U., Maurer P. Proteoglycans in the nervous system–the quest for functional roles in vivo.. Matrix Biol., 20: 23-35, 2001.[Medline]



This article has been cited by other articles:


Home page
Cereb CortexHome page
T. Takahata, Y. Komatsu, A. Watakabe, T. Hashikawa, S. Tochitani, and T. Yamamori
Differential Expression Patterns of occ1-Related Genes in Adult Monkey Visual Cortex
Cereb Cortex, August 1, 2009; 19(8): 1937 - 1951.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
H. Jarvelainen, A. Sainio, M. Koulu, T. N. Wight, and R. Penttinen
Extracellular Matrix Molecules: Potential Targets in Pharmacotherapy
Pharmacol. Rev., June 1, 2009; 61(2): 198 - 223.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Itoh, N. Ito, H. Nagase, and M. Seiki
The Second Dimer Interface of MT1-MMP, the Transmembrane Domain, Is Essential for ProMMP-2 Activation on the Cell Surface
J. Biol. Chem., May 9, 2008; 283(19): 13053 - 13062.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
O. J Sansom, F. C Mansergh, M. J Evans, J. A Wilkins, and A. R Clarke
Deficiency of SPARC suppresses intestinal tumorigenesis in APCMin/+ mice
Gut, October 1, 2007; 56(10): 1410 - 1414.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
M. Novinec, D. Kordis, V. Turk, and B. Lenarcic
Diversity and Evolution of the Thyroglobulin Type-1 Domain Superfamily
Mol. Biol. Evol., April 1, 2006; 23(4): 744 - 755.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Schnepp, P. K. Lindgren, H. Hulsmann, S. Kroger, M. Paulsson, and U. Hartmann
Mouse Testican-2: EXPRESSION, GLYCOSYLATION, AND EFFECTS ON NEURITE OUTGROWTH
J. Biol. Chem., March 25, 2005; 280(12): 11274 - 11280.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakada, M.
Right arrow Articles by Sato, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakada, M.
Right arrow Articles by Sato, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online