Cancer Research Annual Meeting 2010  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vijayachandra, K.
Right arrow Articles by Glick, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vijayachandra, K.
Right arrow Articles by Glick, A. B.
[Cancer Research 63, 3447-3452, July 1, 2003]
© 2003 American Association for Cancer Research


Advances in Brief

Smad3 Regulates Senescence and Malignant Conversion in a Mouse Multistage Skin Carcinogenesis Model

Kinnimulki Vijayachandra, Jessica Lee and Adam B. Glick1

Laboratory of Cellular Carcinogenesis and Tumor Promotion, National Cancer Institute, Bethesda, Maryland 20892


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Transforming growth factor ß (TGF-ß) is a growth-inhibitory cytokine for epithelial cells. In the mouse multistage skin carcinogenesis model, defects in TGF-ß1 signaling reduce senescence in vitro and accelerate malignant progression in vivo. However, the precise postreceptor signaling pathways and specific roles played by Smad proteins in this process have not been defined. Here we show that senescence of v-rasHa-transduced Smad3 null keratinocytes is delayed, whereas overexpression of Smad3, but not Smad2 or Smad4, induced senescence. The TGF-ß1 target genes c-myc and p15ink4b were deregulated in the absence of Smad3. When transplanted to a graft site on nude mice, the v-rasHa-transduced Smad3 null keratinocytes underwent rapid conversion from benign papilloma to malignant carcinoma, whereas wild-type keratinocytes predominantly formed papillomas. These results link Smad3-mediated regulation of growth control genes to senescence in vitro and tumor suppression in vivo.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
TGF-ß2 is a secreted autocrine or paracrine growth inhibitor for epithelial cells, causing a G1 cell cycle arrest in sensitive cells (1) . TGF-ß inhibits cell proliferation through induction of cyclin-dependent kinase inhibitors p15ink4b and p21cip1/waf1, and down-regulation of c-myc and cdc25A (2, 3, 4, 5) . TGF-ß activates a heterotetrameric surface receptor complex composed of serine/threonine kinases TßRI and TßRII. The intracellular mediators of TGF-ß1 signaling, Smad2 and Smad3, are phosphorylated by the activated type I receptor allowing complex formation with Smad4, nuclear translocation and transcriptional activation in conjunction with other transcription factors (6) . Smad3 and Smad4 can bind DNA directly, but Smad2 has no known DNA binding activity. The distinct phenotypes shown by Smad2, Smad3, and Smad4 null mice suggest that these three proteins have nonredundant functions in the TGF-ß signaling pathway (7, 8, 9, 10) . Alterations in TGF-ß expression, signaling, and response occur frequently in human cancers and experimental models of multistage carcinogenesis, and play a critical role in cancer development (11 , 12) . TGF-ß1 is a haploid insufficiency locus for tumorigenesis in mice (13) , and a polymorphic allele reduces the risk of breast cancer in women carriers (14) . Additionally in a number of human cancers the TGF-ß type II receptor, Smad4 and Smad2 are mutated, and function as classical tumor suppressors (15, 16, 17) . The role of Smad3 as a tumor suppressor has not been demonstrated conclusively, because Smad3 mutations are not frequent in human cancers (18) , and independent lines of Smad3 null mice exhibit discordant frequencies of spontaneous colon cancer (8, 9, 10) . However, Smad3 null mice are defective in mucosal immunity and show accelerated wound healing (10 , 19) .

We have used previously an in vitro model of multistage skin carcinogenesis to examine the tumor suppressor function of the TGF-ß signaling pathway. In this model primary mouse keratinocytes are infected with a v-rasHa retrovirus to generate an in vitro counterpart to the initiated preneoplastic cell produced after chemical carcinogen treatment of mouse back skin. v-rasHa-transduced keratinocytes initially hyperproliferate for 10–12 days, but then enter a G1 growth arrest and senesce or undergo transformation on prolonged culturing and give rise to calcium resistant foci. When grafted onto nude mice during proliferative phase, these cells form benign tumors or papillomas that mirror papillomas induced by two-stage chemical carcinogenesis protocols (20) . Senescence of v-rasHa keratinocytes is associated with elevated TGF-ß1 secretion and is suppressed by a TGF-ß1 null genotype, infection with a dominant-negative type II receptor adenovirus, or treatment with neutralizing TGF-ß1 antibodies (21) . Additionally, keratinocytes with defects in TGF-ß1 signaling exhibit genomic instability and enhanced transformation in vitro (22) , and form carcinomas when grafted onto nude mice (12) . Thus, in keratinocytes there is a link between the regulation by TGF-ß1 of senescence in vitro and malignant conversion in vivo. Using Smad3 null keratinocytes we now show that Smad3 but not Smad2 or Smad4 specifically mediates the TGF-ß1-induced senescence response in vitro and is important for suppression of malignant conversion in the mouse multistage skin carcinogenesis model.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Keratinocyte Preparation, Culture, and Nude Mouse Grafting.
Smad3 KO, HET, and WT newborn mice were obtained from crosses of Smad3 HET adults maintained in a C57Bl/SVJ background and were genotyped using PCR as described (10) . Primary mouse keratinocytes were isolated from newborn Smad3, FVB/N, and BALB/c following a standard protocol (23) . For grafting experiments keratinocytes were seeded at a density of 107/100-mm dish in Ca2+ and Mg2+-free minimal essential medium (Invitrogen), supplemented with 8% chelex-treated fetal bovine serum (Gemini Bioproducts) and 0.05 mM Ca2+. On day 3 in culture, primary keratinocytes were infected with the v-rasHa retrovirus, and trypsinized and used for grafting on day 8. Two million keratinocytes were mixed with 6 million mouse dermal fibroblasts (cultured for 1 week) and grafted onto the back of nude mice on a prepared skin graft site (23) . Experiments were terminated after 5 weeks, and formalin-fixed, H&E-stained sections of tumors were scored for benign or malignant histology.

Retroviral and Adenoviral Constructs.
The v-rasHa replication defective ecotropic retrovirus was prepared using {psi}2 producer cells (20) . Retrovirus titers were routinely 1 x 107 virus/ml. Keratinocytes were infected with v-rasHa retrovirus on day 3 at a MOI of 1 in medium containing 4 µg/ml Polybrene (Sigma). Adenoviral vectors encoding Smad2, Smad3, Smad4, Smad7, and Alk5 were gifts from Kohei Miyazono, Tokyo University (Tokyo, Japan; Ref. 24 ). Adenoviruses were amplified using QBI 293 cells. Virus was purified over two CsCl gradients and dialyzed against a buffer containing Tris-HCl (pH 7.5), 10% glycerol, and 1 mM MgCl2. Keratinocytes were infected with 20 MOI adenoviral vectors on day 3 after v-rasHa retroviral infection in medium containing 4 µg/ml Polybrene.

Protein Extraction, Western Blotting, and Antibodies.
Protein lysates were prepared in Tween 20 lysis buffer containing 50 mM HEPES (pH 7.0), 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.1% Tween 20, 10 µg/ml leupeptin and pepstatin, 0.2 units/ml aprotinin, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 2 mM sodium orthovanadate, and 1 mM sodium fluoride. Nuclear and cytoplasmic extracts were prepared using NE-PER nuclear and cytoplasmic extraction reagents (Pierce) according to manufacturer’s instructions. Ten µg protein samples were electrophoresed through 5–20% gradient SDS-polyacrylamide gels and transferred to nitrocellulose membrane. Membranes were stained with Ponceau S and probed with anti ß-actin antibody (Chemicon) to ensure even loading and transfer. Antibodies used were p15ink4b (Neomarkers; Ab-3), c-Myc (Santa Cruz; N-262), Smad3 (Zymed), and Lamin A/C (Santa Cruz; 346). To assay Smad3 binding to biotinylated SBE oligonucleotides, nuclear pellets were extracted with HKMG buffer [10 mM HEPES (pH 7.9), 100 mM KCl, 5 mM MgCl2, 10% glycerol, 1 mM DTT, and 0.5% NP40] and incubated with double-stranded oligonucleotides based on mouse p15ink4b promoter SBE AGCCTTGCATGACAGATGTTACCACTTTCAGA CAGCTTCAAGAAACTAACAAATTT and mutant SBE AGCCTTGCATGACAGATGTTACCACTTTCACTCAGCTTCAAGAAACTAACAAATTT. Precipitated proteins were analyzed for Smad3 by Western blot (25) .

Polyadenylated RNA Purification and Northern Analysis.
Polyadenylated RNA was prepared using oligodeoxythymidylic acid-cellulose following standard protocols. RNA was electrophoresed through a 1% agarose-formaldehyde gel and transferred to Nytran Supercharge (Schleicher and Schuell) according to standard methods. p15ink4b and c-myc probes were obtained from Dr. Bert Vogelstein (Johns Hopkins Cancer Center).

Senescence Assay and Cell Cycle Analysis.
To assay for SA ß-gal expression, keratinocytes were plated in 12-well tissue culture trays, and triplicate wells were fixed on day 3 after adenoviral infection in 0.5% glutaraldehyde. Fixed cells were stained for SA ß-galactosidase at pH 6.0 (26) and ß-galactosidase-positive cells were enumerated using a Nikon inverted microscope. For cell cycle analysis, keratinocytes were trypsinized on day 3 after Smad adenoviral infection, fixed in 70% ethanol, and stained with propidium iodide and analyzed by flow cytometry using a FACSCALIBUR (Becton-Dickinson) and the Modfit analysis program to quantitate the fraction of cells in S phase.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Loss of Smad3 Reduces Senescence Response.
We have shown previously that v-rasHa-transduced TGF-ß1 null keratinocytes have a reduced senescence response compared with TGF-ß1 WT keratinocytes (21) . In WT keratinocytes the onset of senescence occurs ~10 days after v-rasHa transduction and reaches a maximum by 18–20 days (21) . To test the role of Smad3 in senescence, nuclear extracts made from keratinocytes at different times after v-rasHa transduction were incubated with a biotinylated oligonucleotide containing the SBE from the p15ink4b promoter. Bound proteins were precipitated with streptavidin agarose, and Smad3 levels were determined by Western blot analysis (25) . Fig. 1ACitation shows that the level of endogenous Smad3 bound to p15ink4b SBE increases between 11 and 19 days after v-rasHa transduction, corresponding to an increase in total nuclear Smad3 (data not shown) and onset of senescence. As a control, nuclear extracts from keratinocytes infected with a Smad3 adenovirus were incubated with either WT or mutant SBE oligonucleotide. Smad3 did not bind to the mutant SBE oligonucleotide, showing specificity of the binding reaction.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Altered TGF-ß-mediated growth inhibition and senescence in Smad3 KO keratinocytes. A, nuclear Smad3 increases during senescence. Western blot analysis of nuclear Smad3 bound to biotinylated p15ink4b SBE oligonucleotide (25) . Nuclear extracts were prepared as indicated in "Materials and Methods," and 250 µg from each time point incubated with the biotinylated SBE oligonucleotide. Bound protein was precipitated with streptavidin-coupled agarose and analyzed after extensive washing of the pellet in HKMG buffer by SDS-PAGE and immunoblotting for Smad3. Top panel shows endogenous Smad3 bound to the oligonucleotide. As a control nuclear extracts from keratinocytes infected with flag-Smad3 adenovirus were incubated with p15inkb WT and mutant (MT) oligonucleotides. B, v-rasHa-transduced Smad3 KO keratinocytes have reduced sensitivity to TGF-ß1-induced growth inhibition. Smad3 WT, HET, and KO v-rasHa keratinocytes were infected with the v-rasHa retrovirus and treated with TGF-ß1 for 24 h. DNA synthesis was measured in duplicate wells using a [3H]thymidine incorporation assay, and the data were normalized to that of untreated cells. C, reduced senescence of v-rasHa-transduced Smad3 KO keratinocytes. Smad3 WT, HET, and KO keratinocytes were infected with v-rasHa retrovirus, and assayed for senescence after 11 days by staining for SA ß-galactosidase. The assay was done in duplicate with a total of 600-1000 cells counted from three different fields for each sample; bars, ±SD.

 
To address the functional significance of the increased nuclear Smad3, primary keratinocytes from Smad3 KO, WT, and HET newborn mice (10) were infected with the v-rasHa retrovirus, and assayed for TGF-ß responsiveness and senescence. Analysis of Smad2, Smad3, and Smad4 expression, as well as TGF-ß-induced phosphorylation of Smad2 in the different genotypes showed that only Smad3 levels were altered in the Smad3 KO keratinocytes (data not shown). Keratinocytes were treated with a serial dilution of TGF-ß1, and inhibition of DNA synthesis was measured using a [3H]thymidine incorporation assay. Fig. 1BCitation shows that the v-rasHa-transduced Smad3 KO keratinocytes had a 10-fold reduced response to TGF-ß1-mediated growth inhibition with a IC50 of 230 pg/ml for the KO compared with 23 pg/ml for the WT. The IC50 for the HET genotype was 90 pg/ml, intermediate between the other two genotypes. To quantitate senescence we used SA ß-gal, because we and others have shown a strong correlation of this biochemical marker with an irreversible G1 arrest in keratinocytes (21 , 26) . Fig. 1CCitation shows that 11 days after v-rasHa infection 38% of the Smad3, WT cells expressed SA ß-gal, whereas only 19% of the HET and 13% of the KO keratinocytes expressed this marker. There was no difference in the level of TGF-ß1 mRNA expression between the genotypes (data not shown) suggesting that the effects of Smad3 loss on senescence were direct rather than indirect through changes in TGF-ß1 levels. Thus, in the absence of Smad3 v-rasHa transduced keratinocytes exhibit both a reduced responsiveness to TGF-ß1-induced growth arrest and reduced senescence.

Overexpression of Smad3 Induces Growth Arrest and Senescence.
To additionally test the specificity of Smad3 in TGF-ß-mediated senescence, we used adenoviral vectors to overexpress Flag-tagged Smad proteins in v-rasHa keratinocytes. Adenoviral infection was done day 4 after v-rasHa transduction, and cells were assayed for senescence on day 7. Western blot analysis of cytoplasmic and nuclear extracts from Smad adenovirus-infected keratinocytes showed a similar level of expression and proper nuclear translocation of all of the adenovirally expressed Smads. In addition, all of the Smad adenoviruses were capable of stimulating TGF-ß-induced gene expression from the 3TP-lux reporter (data not shown). Overexpression of Smad3 in v-rasHa keratinocytes increased the percentage of senescent cells from 16% to 24% (Fig. 2A)Citation , but overexpression of Smad2 or Smad4 had little effect. There was also a similar Smad-specific effect on DNA synthesis. Analysis of cell cycle by flow cytometry showed that 7 days after v-rasHa transduction 31% of keratinocytes were in S phase. Overexpression of either Smad2 or Smad4 had slight effect on percentage of cells in S phase (28% and 26%, respectively), whereas overexpression of Smad3 decreased the percentage of cells in S phase to 12% (Fig. 2B)Citation . To test whether overexpression of Smad2 or Smad4 could compensate for the absence of Smad3 in Smad3 KO keratinocytes, v-rasHa-transduced Smad3 KO keratinocytes were infected with different Smad adenoviruses. Fig. 2CCitation shows that overexpression of Smad3 resulted in a 2.3-fold increase in SA ß-gal-positive cells in Smad3 KO keratinocytes, whereas overexpression of Smad2 or Smad4 in Smad3 KO keratinocytes had no effect. Thus, despite their ability to transactivate a TGF-ß-regulated reporter plasmid, neither Smad2 or Smad4 adenoviruses could rescue the reduced senescence response of Smad3 KO keratinocytes.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Overexpression of Smad3 but not Smad2 or Smad4 induces senescence and inhibits DNA synthesis. A, Smad3 increases the percentage of SA ß-gal-positive cells in v-rasHa-transduced FVB/N keratinocytes. v-rasHa-transduced keratinocytes were infected with adenoviruses (20 MOI) and stained for SA ß-gal after 3 days. Histograms represent average of duplicate samples with a total of 800-1200 cells counted from three different fields for each sample. B, Smad3 decreases the percentage of cells in S phase. v-rasHa FVB/N keratinocytes were infected with 20 MOI of Smad-adenovirus for 3 days, stained with propidium iodide, and analyzed for DNA content using flow cytometry. C, Smad3 induces senescence in Smad3 KO keratinocytes. v-rasHa-transduced Smad3 KO keratinocytes were infected with Smad-adenovirus (20 MOI) and stained for senescence after 3 days. Histograms represent average of duplicate samples and with at least 700 cells counted from three different fields for each sample; bars, ±SD.

 
Smad3 Regulates p15ink4b and c-myc Expression.
Two of the critical regulators of growth-inhibitory response to TGF-ß are p15ink4b and c-myc. These genes are linked in a regulatory circuit in which c-myc represses p15ink4b expression, and this is relieved by TGF-ß-mediated down-regulation of c-myc (25) . Fig. 3ACitation shows that the addition of TGF-ß1, overexpression of constitutively active type I receptor Alk5, or overexpression of Smad3, but not Smad2 or Smad4 alone or in combination, induced p15ink4b protein in v-rasHa keratinocytes. Overexpression of Smad7, an inhibitory Smad, decreased expression of p15ink4b protein suggesting that in keratinocytes basal levels of expression of this kinase inhibitor are dependent on autocrine TGF-ß signaling. p15ink4b mRNA was also induced by treatment with 1 ng/ml TGF-ß1 within 1 day, as well as by overexpression of Smad3 but not by Smad2 or Smad4 (Fig. 3B)Citation . In the Smad3 WT keratinocytes p15ink4b protein levels increased within 3–6 days after v-rasHa transduction (Fig. 3C)Citation , and there was a corresponding increase in p15ink4b mRNA (Fig. 3D)Citation . In contrast, induction of p15ink4b protein in the Smad3 KO keratinocytes was delayed until day 6 after v-rasHa transduction, although levels of p15ink4b were ultimately similar by day 12 in both genotypes (Fig. 3C)Citation . Similarly, p15ink4b mRNA expression was also reduced in Smad3 KO keratinocytes compared with the WT. These results clearly implicate Smad3 in regulation of p15ink4b expression during keratinocyte senescence but do not rule out the existence of Smad3-independent and/or TGF-ß-independent pathways for p15ink4b regulation.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Smad3 regulates p15ink4b and c-myc expression. A, Smad3 but not Smad2 or Smad4 induces p15ink4b protein expression. v-rasHa FVB/N keratinocytes were infected with adenovirus for 3 days (20 MOI or 10 + 10 MOI when used in combination) and protein lysates analyzed for p15ink4b expression by Western blot. B, TGF-ß and Smad3 induce p15ink4b mRNA. Northern blot analysis of p15ink4b expression in polyadenylated RNA isolated from v-rasHa FVB/N keratinocytes after infection with Smad adenovirus for 3 days or TGF-ß1 (1 ng/ml) treatment for indicated times. C, delayed induction of p15ink4b in Smad3 KO keratinocytes. Protein lysates from Smad3 WT and KO keratinocytes prepared on indicated days after v-rasHa transduction were analyzed for p15ink4b expression by Western blot. D, altered expression of p15ink4b and c-myc mRNA in Smad3 KO keratinocytes. Polyadenylated RNA from Smad3 WT and KO keratinocytes was prepared on 4 and 11 days after v-rasHa transduction, and Northern blots hybridized to p15ink4b and c-myc probes. Blots were reprobed with ribosomal protein L7 fragment as a loading control. E, TGF-ß down-regulation of c-Myc is reduced in Smad3 KO keratinocytes. Nuclear extracts from v-rasHa-transduced Smad3 WT, HET, and KO keratinocytes treated with or without TGF-ß1 (1 ng/ml) for 1 h were immunoblotted for c-Myc.

 
Corresponding with the reduced level of p15ink4b mRNA there was a higher level of c-myc mRNA in the Smad3 KO keratinocytes compared with the WT keratinocytes at both 4 and 11 days after v-rasHa transduction (Fig. 3D)Citation . In addition, c-Myc protein levels were 3-fold higher in nuclear extracts from Smad3 HET keratinocytes and 3.7-fold higher in Smad3 KO keratinocytes compared with Smad3 WT (Fig. 3E)Citation . As expected, a 1-h treatment with TGF-ß1 caused a 45% reduction of nuclear c-Myc protein in Smad3 WT, but there was only a 16% reduction of c-Myc levels in the Smad3 HET and KO keratinocytes.

Smad3 Null Keratinocytes Undergo High Frequency of Malignant Conversion.
We have shown previously that TGF-ß1 null primary keratinocytes transduced with v-rasHa retrovirus rapidly progress to squamous cell carcinoma when transplanted to a prepared graft site on a nude mouse, whereas WT keratinocytes form only benign papillomas (12) . To test the role of Smad3 in TGF-ß1-mediated suppression of malignant conversion, we grafted v-rasHa-transduced primary keratinocytes from Smad3 WT and KO mice onto nude mice. Grafts from both the genotypes formed papillomas within 2 weeks. There was no significant difference in growth rate of the tumors from the different genotypes (Fig. 4, A and B)Citation . However, 50% (6 of 12) of the Smad3 KO grafts underwent malignant conversion with histological evidence for stromal invasion, whereas 12 of 14 Smad3 WT grafts remained as benign papillomas with a well-differentiated hyperplastic epidermis and no evidence for stromal invasion (Fig. 4, C and D)Citation . Thus. in this model of multistage skin carcinogenesis, Smad3 suppresses malignant conversion of benign papillomas.



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Smad3 KO keratinocytes progress to carcinoma at high frequency. A, similar growth rate of grafted tumors. Tumor volumes of Smad3 WT and KO grafts were measured once per week. B, distinct tumor morphology between Smad3 WT and KO grafts. Smad3 WT and KO grafts were photographed at 5 weeks after grafting. C, increased frequency of carcinomas in v-rasHa-transduced Smad3 KO tumors. Papillomas and carcinomas isolated 5 weeks after grafting were scored on microscopic examination of H&E-stained sections. D, photomicrographs of H&E-stained sections from tumors isolated 5 weeks after grafting. Magnification x40; bars, ±SD.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Components of the TGF-ß1 signaling pathway function as tumor suppressors in human cancer development. This has been well characterized for the type II receptor, Smad4 and Smad2, where inactivating mutations in these genes are associated with human cancers (11 , 15, 16, 17) . Whereas Smad3 is an essential transducer of TGF-ß1 signaling, evidence that this gene can function as a tumor suppressor in vivo is not clear. Smad3 mutations have not been found in colon cancers (18) , where other mutations in TGF-ß1 pathway are frequent. Additionally, several independent lines of Smad3 KO mice have been developed, of which only one produced spontaneous colon cancers (8, 9, 10) , and in this case defective epithelial growth regulation, stromal epithelial interaction, or defective immunosurveillance could contribute, because all of these processes are regulated by TGF-ß. We have shown here in a mouse model of multistage epidermal carcinogenesis in which oncogenic ras is introduced into primary mouse keratinocytes that Smad3 acts to suppress premalignant progression from the benign papilloma to malignant squamous cell carcinoma. Whereas our studies have not examined spontaneous or chemical carcinogenesis in the intact Smad3 null epidermis, they circumvent problems associated with systemic Smad3 deletion such as growth retardation and wasting syndrome (10) . Thus, the results shown here provide strong support for a model in which Smad3 functions as a tumor suppressor in epithelial cells where oncogenic activation of ras has already occurred.

Our data show that in this model Smad3 functions as the intracellular mediator of TGF-ß signaling required for the senescence response of keratinocytes and suppression of malignant conversion of benign tumor cells. Thus, overexpression of Smad3, but not Smad2 or Smad4, induced senescence and growth arrest of v-rasHa keratinocytes, whereas Smad3 depletion reduced senescence in a gene dose-dependent manner. In addition, overexpression of Smad2 or Smad4 did not induce senescence in v-rasHa-transduced Smad3 KO keratinocytes, although both were capable of activating TGF-ß1-mediated gene expression from a reporter plasmid. Whereas specific Smad2 or Smad4 conditional KOs or dominant negatives will be necessary to rule out a role for these proteins in senescence of the keratinocytes, these results strongly point to Smad3 and Smad3-regulated genes as critical mediators of the senescence response.

The TGF-ß1-induced growth arrest in epithelial cells is in part mediated by a regulatory pathway that involves p15ink4b and c-myc (2 , 4) . c-Myc represses p15ink4b expression through interaction with Miz-1 (25) ; TGF-ß1 induces p15ink4b expression in part through down-regulation of c-myc (25) , and this is mediated through binding of Smad3 and Smad4 in a complex with E2F4/5 and p107 to an inhibitory site on the c-myc promoter (27) . Expression of c-myc is up-regulated in several cancers, but in most cases the mechanism of c-myc up-regulation is not known. Overexpression of c-myc in the mouse epidermis by itself produces a benign papilloma (28) . Our data provide the first evidence that regulation of these cell cycle genes is perturbed in Smad3 KO epithelial cells. In Smad3 KO keratinocytes the senescence-associated induction of p15ink4b protein and mRNA is delayed. Furthermore, in keratinocytes, p15ink4b protein and mRNA expression was induced by overexpression of Smad3 but not Smad2 or Smad4. These results in mouse primary keratinocytes differ from in the human immortal HaCaT cell line, where Smad2, Smad3, and Smad4 can induce expression from p15ink4b promoter-reporter construct (29) . Whereas this could be a difference between mouse and human p15ink4b promoters, it also suggests that TGF-ß regulation of p15ink4b expression in mouse epithelial cells is more stringent. Both c-myc mRNA and protein levels are higher in the Smad3 KO keratinocytes compared with Smad3 WT, and the TGF-ß1-induced down-regulation of c-myc is blocked in the Smad3 KO keratinocytes such that higher levels of c-Myc protein are maintained in the Smad3 KO cells even after TGF-ß1 treatment. The decrease in c-myc message between 4 and 11 days after v-rasHa transduction may be in part because of increased secretion of autocrine TGF-ß1. Thus, we propose a model for senescence of v-rasHa-transduced keratinocytes in which TGF-ß1 secretion causes increased nuclear accumulation of Smad3, and this activates p15ink4b through down-regulation of c-myc levels in conjunction with Smad3 binding to p15ink4b promoter. In the absence of Smad3, c-myc down-regulation is less, and p15ink4b induction is delayed. Because p15ink4b levels in the Smad3 KO keratinocytes ultimately increase to near WT levels, it is possible that effects of higher c-myc levels on positive growth regulatory genes also contribute to the altered senescence of Smad3 KO keratinocytes.

Numerous studies have shown that TGF-ß1 signaling can both suppress as well as enhance tumor progression. Here we have shown that endogenous Smad3 can suppress premalignant progression, but endogenous Smad2 cannot compensate for the loss of Smad3; Smad2 in contrast appears to function in concert with oncogenic ras to promote invasive growth and metastasis of mouse skin tumors (30) . Taken together these results suggest distinct targets and biological functions of these two Smads in squamous cancer development, and that the relative level or activity of each could determine how a neoplastic cell responds to TGF-ß1.


    ACKNOWLEDGMENTS
 
We thank Dr. Chuxia Deng, National Institutes of Diabetes, Digestive and Kidney Diseases and Dr. Anita Roberts, National Cancer Institute, NIH, for the Smad3 null mice; Drs. Kohei Miyazono and Makiko Fujii, University of Tokyo, Tokyo, Japan for the Smad adenoviral constructs; Dr. Joan Massague, Memorial Sloan-Kettering Cancer Center, New York, NY, for 3TP-lux plasmid; Dr. Bert Vogelstein, Johns Hopkins Cancer Center, Baltimore, MD for SBE-luc plasmid; and Dr. Stuart Yuspa, National Cancer Institute, NIH, Bethesda, MD for critical reading of the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Laboratory of Cellular Carcinogenesis and Tumor Promotion, National Cancer Institute, Bethesda, Maryland 20892. Phone: (301) 496-1902; Fax: (301) 496-8709; E-mail: glicka{at}dc37a.nci.nih.gov Back

2 The abbreviations used are: TGF-ß, transforming growth factor-ß; MOI, multiplicity of infection; SBE, Smad binding element; WT, wild-type; KO, knockout; HET, heterozygous; SA ß-gal, senescence-associated ß-galactosidase. Back

Received 4/10/03. Accepted 5/13/03.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Laiho M., DeCaprio J. A., Ludlow J. W., Livingston D. M., Massague J. Growth inhibition by TGF-ß linked to suppression of retinoblastoma protein phosphorylation. Cell, 62: 175-185, 1990.[Medline]
  2. Hannon G. J., Beach D. p15INK4B is a potential effector of TGF-ß-induced cell cycle arrest. Nature (Lond.), 371: 257-261, 1994.[Medline]
  3. Datto M. B., Li Y., Panus J. F., Howe D. J., Xiong Y., Wang X. F. Transforming growth factor ß induces the cyclin-dependent kinase inhibitor p21 through a p53-independent mechanism. Proc. Natl. Acad. Sci. USA, 92: 5545-5549, 1995.[Abstract/Free Full Text]
  4. Alexandrow M. G., Moses H. L. Transforming growth factor ß and cell cycle regulation. Cancer Res., 30: 1-2, 1995.
  5. Iavarone A., Massague J. Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-ß in cells lacking the CDK inhibitor p15. Nature (Lond.), 387: 417-422, 1997.[Medline]
  6. Zhang Y., Feng X., We R., Derynck R. Receptor-associated Mad homologues synergize as effectors of the TGF-ß response. Nature (Lond.), 383: 168-172, 1996.[Medline]
  7. Weinstein M., Yang X., Li C., Xu X., Gotay J., Deng C. X. Failure of egg cylinder elongation and mesoderm induction in mouse embryos lacking the tumor suppressor smad2. Proc. Natl. Acad. Sci. USA, 95: 9378-9383, 1998.[Abstract/Free Full Text]
  8. Zhu Y., Richardson J. A., Parada L. F., Graff J. M. Smad3 mutant mice develop metastatic colorectal cancer. Cell, 94: 703-714, 1998.[Medline]
  9. Datto M. B., Frederick J. P., Pan L., Borton A. J., Zhuang Y., Wang X. F. Targeted disruption of Smad3 reveals an essential role in transforming growth factor ß-mediated signal transduction. Mol. Cell Biol., 19: 2495-2504, 1999.[Abstract/Free Full Text]
  10. Yang X., Letterio J. J., Lechleider R. J., Chen L., Hayman R., Gu H., Roberts A. B., Deng C. Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-ß. EMBO J., 18: 1280-1291, 1999.[Medline]
  11. Riggins G. J., Kinzler K. W., Vogelstein B., Thiagalingam S. Frequency of Smad gene mutations in human cancers. Cancer Res., 57: 2578-2580, 1997.[Abstract/Free Full Text]
  12. Glick A. B., Lee M. M., Darwiche N., Kulkarni A. B., Karlsson S., Yuspa S. H. Targeted deletion of the TGF-ß1 gene causes rapid progression to squamous cell carcinoma. Genes Dev., 8: 2429-2440, 1994.[Abstract/Free Full Text]
  13. Tang B., Bottinger E. P., Jakowlew S. B., Bagnall K. M., Mariano J., Anver M. R., Letterio J. J., Wakefield L. M. Transforming growth factor-ß is a new form of tumor suppressor with true haploid insufficiency. Nat. Med., 4: 802-807, 1998.[Medline]
  14. Ziv E., Cauley J., Morin P. A., Saiz R., Browner W. S. Association between the T29-C polymorphism in the transforming growth factor ß1 gene and breast cancer among elderly white women: the study of osteoporotic fractures. JAMA, 285: 2859-2863, 2001.[Abstract/Free Full Text]
  15. Markowitz S., Wang J., Myeroff L., Parsons R., Sun L., Lutterbaugh J., Fan R. S., Zborowska E., Kinzler K. W., Vogelstein B., Brattain M., Willson J. K. V. Inactivation of the type II TGF-ß receptor in colon cancer cells with microsatellite instability. Science (Wash. DC), 268: 1336-1338, 1995.[Abstract/Free Full Text]
  16. Hahn S. A., Schutte M., Hoque A. T., Moskaluk C. A., da Costa L. T., Rozenblum E., Weinstein C. L., Fischer A., Yeo C. J., Hruban R. H., Kern S. E. DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1. Science (Wash. DC), 271: 350-353, 1996.[Abstract]
  17. Eppert K., Scherer S. W., Ozcelik H., Pirone R., Hoodless P., Kim H., Tsui L. C., Bapat B., Gallinger S., Andrulis I. L., Thomsen G. H., Wrana J. L., Attisano L. MADR2 maps to 18q21 and encodes a TGFß-regulated MAD-related protein that is functionally mutated in colorectal carcinoma. Cell, 86: 543-552, 1996.[Medline]
  18. Arai T., Akiyama Y., Okabe S., Ando M., Endo M., Yuasa Y. Genomic structure of the human Smad3 gene and its infrequent alterations in colorectal cancers. Cancer Lett., 122: 157-163, 1998.[Medline]
  19. Ashcroft G. S., Yang X., Glick A. B., Weinstein M., Letterio J. L., Mizel D. E., Anzano M., Greenwell-Wild T., Wahl S. M., Deng C., Roberts A. B. Mice lacking Smad3 show accelerated wound healing and an impaired local inflammatory response. Nat. Cell Biol., 1: 260-266, 1999.[Medline]
  20. Roop D. R., Lowy D. R., Tambourin P. E., Strickland J., Harper J. R., Balaschak M., Spangler E. F., Yuspa S. H. An activated Harvey ras oncogene produces benign tumours on mouse epidermal tissue. Nature (Lond.), 323: 822-824, 1986.[Medline]
  21. Tremain R., Marko M., Kinnimulki V., Ueno H., Bottinger E., Glick A. Defects in TGFß signaling overcome senescence of mouse keratinocytes expressing v-ras. Oncogene, 19: 1698-1709, 2000.[Medline]
  22. Glick A., Popescu N., Alexander V., Ueno H., Bottinger E., Yuspa S. H. Defects in transforming growth factor-ß signaling cooperate with a ras oncogene to cause rapid aneuploidy and malignant transformation of mouse keratinocytes. Proc. Natl. Acad. Sci. USA, 96: 14949-14954, 1999.[Abstract/Free Full Text]
  23. Dlugosz A. A., Glick A. B., Tennenbaum T., Weinberg W. C., Yuspa S. H. Isolation and utilization of epidermal keratinocytes for oncogene research Vogt P. K. Verma I. M. eds. . Methods in Enzymology, 254: 3-20, Academic Press New York 1995.[Medline]
  24. Fujii M., Takeda K., Imamura T., Aoki H., Sampath T. K., Enomoto S., Kawabata M., Kato M., Ichijo H., Miyazono K. Roles of bone morphogenetic protein type I receptors and Smad proteins in osteoblast and chondroblast differentiation. Mol. Biol. Cell, 10: 3801-3813, 1999.[Abstract/Free Full Text]
  25. Seoane J., Pouponnot C., Staller P., Schader M., Eilers M., Massague J. TGFß influences Myc. Miz-1 and Smad to control the CDK inhibitor p15INK4b. Nat. Cell Biol., 3: 400-408, 2001.[Medline]
  26. Campisi J. Gene expression in quiescent and senescent fibroblasts. Ann. N. Y. Acad. Sci., : 195-201, 1993.
  27. Chen C-R., Kang Y., Siegel P. M., Massague J. E2F4/5 and p107 as smad cofactors linking the TGFß receptor to c-myc repression. Cell, 110: 19-32, 2002.[Medline]
  28. Pelengaris S., Littlewood T., Khan M., Elia G., Evan G. Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol. Cell, 3: 565-577, 1999.[Medline]
  29. Feng X. H., Lin X., Derynck R. Smad2. Smad3 and Smad4 cooperate with Sp1 to induce p15(Ink4B) transcription in response to TGF-ß. EMBO J., 19: 5178-5193, 2000.[Medline]
  30. Oft M., Akhurst R. J., Balmain A. Metastasis is driven by sequential elevation of H-ras and Smad2 levels. Nat. Cell Biol., 4: 487-494, 2002.[Medline]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
A. Shukla, Y. Ho, X. Liu, A. Ryscavage, and A. B. Glick
Cripto-1 Alters Keratinocyte Differentiation via Blockade of Transforming Growth Factor-{beta}1 Signaling: Role in Skin Carcinogenesis
Mol. Cancer Res., March 1, 2008; 6(3): 509 - 516.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. A. Stepp, Y. Liu, S. Pal-Ghosh, R. A. Jurjus, G. Tadvalkar, A. Sekaran, K. LoSicco, L. Jiang, M. Larsen, L. Li, et al.
Reduced migration, altered matrix and enhanced TGFbeta1 signaling are signatures of mouse keratinocytes lacking Sdc1
J. Cell Sci., August 15, 2007; 120(16): 2851 - 2863.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Wei, S. Ku, G. K. Ma, S. Saito, A. A. Tang, J. Zhang, J.-H. Mao, E. Appella, A. Balmain, and E. J. Huang
HIPK2 represses beta-catenin-mediated transcription, epidermal stem cell expansion, and skin tumorigenesis
PNAS, August 7, 2007; 104(32): 13040 - 13045.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. S. Suh, M. Mutoh, T. Mutoh, L. Li, A. Ryscavage, J. M. Crutchley, R. A. Dumont, C. Cheng, and S. H. Yuspa
CLIC4 mediates and is required for Ca2+-induced keratinocyte differentiation
J. Cell Sci., August 1, 2007; 120(15): 2631 - 2640.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Li, D. Xu, J. Li, M. C. Berndt, and J.-P. Liu
Transforming Growth Factor beta Suppresses Human Telomerase Reverse Transcriptase (hTERT) by Smad3 Interactions with c-Myc and the hTERT Gene
J. Biol. Chem., September 1, 2006; 281(35): 25588 - 25600.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Ju, A. Ogawa, J. Heyer, D. Nierhof, L. Yu, R. Kucherlapati, D. A. Shafritz, and E. P. Bottinger
Deletion of Smad2 in Mouse Liver Reveals Novel Functions in Hepatocyte Growth and Differentiation
Mol. Cell. Biol., January 15, 2006; 26(2): 654 - 667.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. G. Li, S.-L. Lu, M.-X. Zhang, C. Deng, and X.-J. Wang
Smad3 Knockout Mice Exhibit a Resistance to Skin Chemical Carcinogenesis
Cancer Res., November 1, 2004; 64(21): 7836 - 7845.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Liu, J. Lee, M. Cooley, E. Bhogte, S. Hartley, and A. Glick
Smad7 but not Smad6 Cooperates with Oncogenic ras to Cause Malignant Conversion in a Mouse Model for Squamous Cell Carcinoma
Cancer Res., November 15, 2003; 63(22): 7760 - 7768.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vijayachandra, K.
Right arrow Articles by Glick, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vijayachandra, K.
Right arrow Articles by Glick, A. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online