Cancer Research Cell Death Mechanisms and Cancer Therapy  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramos-Nino, M. E.
Right arrow Articles by Mossman, B. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramos-Nino, M. E.
Right arrow Articles by Mossman, B. T.
[Cancer Research 63, 3539-3545, July 1, 2003]
© 2003 American Association for Cancer Research


Carcinogenesis

Microarray Analysis and RNA Silencing Link fra-1 to cd44 and c-met Expression in Mesothelioma1

Maria E. Ramos-Nino, Luca Scapoli, Marcella Martinelli, Susan Land and Brooke T. Mossman2

Department of Pathology, University of Vermont College of Medicine, Burlington, Vermont 05405 [M. E. R-N., L. S., M. M., B. T. M.], and Applied Genomics Technology Center, Wayne State University, Detroit, Michigan 48202 [S. L.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Malignant mesothelioma is a cancer with poor prognosis associated with exposures to asbestos. The mechanisms of asbestos-induced mesotheliomas are unclear, and studies are required to find diagnostic tools and therapies to improve the survival rates of patients. After oligonucleotide microarray analysis (Affymetrix array) of normal rat pleural mesothelial (RPM) cells, RPM cells exposed to crocidolite asbestos, and rat mesotheliomas, subsets of genes that changed in expression were categorized, including the highly up-regulated, early response proto-oncogene, fra-1. Increases in fra-1 in both rat and human mesotheliomas and a subset of genes common to both asbestos-exposed RPM cells and mesotheliomas that mimicked fra-1 patterns of expression were subsequently confirmed using real-time quantitative PCR. Using RNA interference technology, fra-1 gene silenced RPM cells were assayed by real-time quantitative PCR for the expression of possible fra-1-regulated genes. Results reveal that induction of cd44 and c-met is causally linked to fra-1 expression, connecting fra-1 with genes governing cell motility and invasion in mesothelioma. These studies suggest that inhibition of fra-1 signaling pathways may be a strategy for therapy of malignant mesothelioma.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Asbestos is a naturally occurring group of mineral fibers that gives rise to pulmonary and pleural fibrosis, lung cancers, and mesotheliomas (1) . The development of malignant mesotheliomas after exposures to crocidolite asbestos in man is well documented, although the molecular mechanisms of fiber-induced carcinogenesis are poorly understood.

Asbestos fibers may act at several stages of the multistage process of tumorigenesis. For example, fibers initiate DNA damage in vitro by causing oxidative lesions such as 8-oxo-deoxyguanosine in mesothelial cells and large base deletions associated with mutagenesis (2 , 3) . In addition, asbestos fibers stimulate DNA synthesis and hyperplasia in mesothelial and pulmonary epithelial cells after inhalation and are inflammatory agents (4 , 5) , thus suggesting their role as tumor promoters during the long latency period of tumor development. The chemical composition, length, and durability of different asbestos fiber types are critical in governing their deposition, reactivity, and biopersistence in lung and pleura and may be important in tumorigenicity (reviewed in Ref. 6 ).

We have demonstrated that crocidolite asbestos, the most pathogenic type of asbestos in the induction of human mesothelioma (1 , 7) , causes activation of ERK13 and ERK2 after phosphorylation of the epidermal growth factor receptor in mesothelial cells (8 , 9) . These events are linked to the increased expression of AP-1 family members (fos/jun) and transactivation of AP-1-dependent gene expression (10 , 11) . Increases in fra-1 (fos-related antigen-1) expression are particularly striking and protracted in both pulmonary epithelial and mesothelial cells after exposure to crocidolite asbestos fibers as opposed to nonpathogenic particles (10, 11, 12, 13) . Most recently, we have shown that fra-1 expression is causally related to phenotypic changes and anchorage-independent growth during the development of rat mesotheliomas (13) .

The objective of studies here was to characterize, using oligonucleotide microarray analysis, subsets of up- or down-regulated gene expression in mesothelial cells after acute exposures to asbestos and in mesotheliomas. After confirming that fra-1 mRNA was dramatically increased after exposures of RPM cells to asbestos and in both human and rat mesotheliomas, we selected four candidate genes following patterns of fra-1 expression. After confirmation of changes in mRNA levels using real-time Q-PCR, we then used RNA interference technology to address the hypothesis that expression of some genes would be fra-1 dependent. Our results reveal that expression of c-met and cd44, genes encoding receptors linked to migration and invasiveness of tumors, is linked to fra-1 expression in asbestos-treated mesothelial cells and mesotheliomas.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation and Culture of RPM Cells.
RPM cells were isolated from the parietal pleura of Fischer 344 rats by methods described previously (10) and propagated in DMEM:Ham’s F-12 medium (Life Technologies, Inc.) containing 10% fetal bovine serum and hydrocortisone (100 ng/ml), insulin (2.5 µg/ml), transferrin (2.5 µg/ml), and selenium [2.5 ng/ml (Sigma)]. Cells were used within 10 passages. For all experiments, cells were grown to near confluence before exposure to agents.

Mesothelioma Cell Lines.
Mesothelioma cell lines 11, 23, and 52 were developed in rats after i.p. injection of crocidolite asbestos and have been characterized previously (14) . Cells were propagated as described above for RPM cells. Human normal mesothelial and human mesothelioma cells were kindly provided by Drs. Michele Carbone (Loyola University, Chicago, IL), Mauro Tognon (University of Ferrara, Ferrara, Italy), and Luciano Mutti (Laboratory of Clinical Oncology and Toxicology, "S. Maugeri" Foundation for Research and Care, Pavia, Italy).

Exposure to Asbestos and Other Agents: Crocidolite Asbestos Fibers.
[(Na2(Fe3+)2(Fe2+)3Si8O22(OH)2], a high iron-containing amphibole fiber associated with the causation of human mesothelioma (Ref. 1 ; National Institute of Environmental Health Sciences reference sample), was suspended in HBSS (Life Technologies, Inc.) at a concentration of 1 mg/ml, triturated eight times through a 22-gauge needle to obtain a homogeneous suspension, and added directly to the medium of confluent RPM cells at a final concentration of 5 µg/cm2 dish for 24 h. Sham control dishes received medium without agents.

RNA Preparation.
Total RNA was prepared using TRIzol reagent (Invitrogen Life Technologies, Inc., Carlsbad, CA) according to the manufacturer’s protocol. After the ethanol precipitation step in the TRIzol extraction procedure, a cleanup was done using Rneasy Total RNA Isolation kit (Qiagen, Valencia, CA).

Microarray Assay.
Microarrays were performed using normal RPM, asbestos-exposed RPM, and three rat mesothelioma cell lines. The RNA target (biotin-labeled RNA fragments) was produced from 5 mg of total RNA collected from the pooling of five different experiments by first synthesizing double-stranded cDNA followed by an in vitro transcription reaction and a fragmentation reaction. A hybridization mixture containing the fragment cRNA, probe array control (Affymetrix, Santa Clara, CA), BSA, and herring sperm DNA was prepared and hybridized to the probe array at 45°C for 16 h. The hybridized probe array was then washed, and bound biotin-labeled cRNA was detected with a streptavidin phycoerythrin conjugate. Subsequent signal amplification was performed with a biotinylated anti-streptavidin antibody. The washing and staining procedures were automated using the Affymetrix fluidics station. Each probe array, Rat Genome U34A (Affymetrix), was scanned twice (Hewlett-Packard GeneArray Scanner), the images were overlaid, and the average intensities of each probe cell were compiled.

Real-Time Q-PCR.
Total RNA (1 µg) was reverse transcribed with random primers using the Promega Avian Myeloblastosis Virus Reverse Transcriptase kit (Promega, Madison, WI) according to the recommendations of the manufacturer. To quantify gene expression, we amplified the cDNA by TaqMan real-time Q-PCR using the 7700 Sequence Detector (Perkin-Elmer Applied Biosystems, Foster, CA). Reactions contained 1x TaqMan Universal PCR Master Mix, 900 nM forward and reverse primers, and 200 nM TaqMan probes. Thermal cycling was performed using 40 cycles of 95°C for 15 s and 60°C for 1 min. Original input RNA amounts were calculated with relative standard curves for both the mRNAs of interest and the HPRT control. Duplicate assays were performed with RNA samples isolated from at least 2 independent experiments. The values obtained from cDNAs and HPRT controls provided relative gene expression levels for the gene locus investigated. The primers and probe sequences used are presented in Table 1Citation .


View this table:
[in this window]
[in a new window]

 
Table 1 Primers and probes (6-carboxyflurescein (6-FAM)/N,N,N',N' tetramethyl-6-carboxyrhodamine (TAMRA) labeled) for real-time Q-PCR assays

 
Transfection Techniques and Constructs.
Sequence information on fra-1 mature mRNA was extracted from the expressed sequence tag database.4 The open frame region from the cDNA sequence around 100 nucleotides downstream of the start codon of the gene was selected to develop the 21-base duplex siRNA molecule (AAGCGCAGACACAGACAGUCC). The sequence was BLAST-searched (National Center for Biotechnology Information database) against expressed sequence tag libraries to ensure the specificity of the siRNA molecule. siRNA duplexes (Dharmacon Research, Lafayette, CO) were transfected into RPM cells using OligofectAMINE reagent (Invitrogen Life Technologies, Inc.) as recommended by the manufacturer. Transient transfections were carried out on subconfluent RPM cells using the siRNA fra-1 duplex and a siRNA scramble duplex (control; Dharmacon Research). All experiments were performed in duplicate.

EMSAs.
EMSAs were used to assess the binding of AP-1 to DNA and the composition of AP-1 complexes. Nuclear extracts were prepared and analyzed as described by Janssen et al. (15) . The amount of protein in each sample was determined using the Bio-Rad protein assay (Bio-Rad, Hercules, CA). For supershift assays, nuclear extracts were incubated with an antibody to Fra-1 (Santa Cruz Biotechnology, Santa Cruz, CA) for 15 min at room temperature before the addition of labeled oligonucleotide. Gels were quantitated using a Bio-Rad phosphorimager.

Statistical Analyses.
The microarray data were processed using GeneSpring software (Silicon Genetics, Redwood, CA). For all other experiments, we used duplicate or triplicate determinations (N = 2–3) per group, and experiments were performed in duplicate. Results were evaluated by one-way ANOVA using the Student-Newman-Keuls procedure for adjustment of multiple pairwise comparisons between treatment groups. Differences with Ps <= 0.05 were considered statistically significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Microarray Data Show a Subset of Genes Altered in Expression in Both RPM Cells Exposed to Asbestos and Mesotheliomas.
As shown in Fig. 1Citation , after microarray analysis using the RG-U34A chip from Affymetrix, subsets of genes were identified that increased or decreased during the development of mesotheliomas or in response to asbestos. The gene expression data (average difference as calculated by Affymetrix algorithms) were normalized against the control sample (RPM cells), and the fold changes were determined using GeneSpring software (Silicon Genetics). Genes exhibiting >1.5-fold changes and present in comparison with control cells were considered altered using the Affymetrix absolute call algorithm. Of the 8799 genes present in the chip, 576 (6.5%) were up-regulated in RPM cells exposed to asbestos. Seventy-eight (0.9%) of those genes were up-regulated after exposure to asbestos but down-regulated in all mesotheliomas. In contrast, 353 (4%) genes were up-regulated in mesotheliomas. Of these, 73 (0.8%) were up-regulated in mesotheliomas and down-regulated in asbestos-exposed cells. Overall, 77 genes (0.9%) were found to be up-regulated in both RPM cells exposed to asbestos and in mesotheliomas, and 242 genes (2.75%) were found to be down-regulated in both RPM cells exposed to asbestos and in mesotheliomas.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Numbers of genes increasing (>) or decreasing (<) in microarray analyses as determined using GeneSpring software. Asb, cells exposed for 24 h to crocidolite asbestos (5 µg/cm2 dish); Meso, mesothelioma.

 
Genes Up-Regulated during Acute Asbestos Exposures and in Mesotheliomas Are Mainly Enzymes or Transport-involved Genes, Whereas Down-Regulated Genes Are Mainly Phosphatases and Signal Transducer Ligands.
Although only 42% of the up-regulated genes in both acute exposure to asbestos and in mesotheliomas could be classified, 53% of those classified are enzymes, and 32% are involved in transport. Of the common down-regulated genes that could be classified (51%), 63% belong to the enzyme ontology (including phosphatases), 32% are signal transducer ligands, and 21% are cellular components. In accordance with our previous studies (10 , 16) , c-fos expression was increased by asbestos but was absent in mesotheliomas, whereas fra-1 message levels were elevated in both asbestos-exposed RPM cells and mesotheliomas. The absence of c-fos in mesotheliomas suggests that substitution of fra-1 for c-fos in AP-1 complexes occurs during tumorigenesis (13) .

Real-Time Q-PCR and Microarray Expression Analysis Show Similar Trends of Expression for Selected Genes in Rat and Human Mesothelial Cell Models.
Table 2Citation presents the fold increases in expression of nine selected genes after comparative analyses using real-time Q-PCR and microarray expression analysis. In addition to fra-1, which was dramatically increased, we focused on eight other genes at different levels of expression. The real-time Q-PCR probes developed and presented in Table 1Citation were designed to capture all isoforms of these genes. Although the algorithms used to obtain the fold changes in both cases are not the same, and the probes developed for real-time Q-PCR are detecting different isoforms of the same gene, the patterns of expression, as shown using this technique and microarrays (Table 2)Citation , are comparable. The fact that the genes selected were at different levels of expression (low, medium, and high according to arbitrary range) validates the results found in the microarrays for all genes in the analysis.


View this table:
[in this window]
[in a new window]

 
Table 2 Comparison of microarray and TaqMan results for different genes

Fold changes in microarray data are calculated with normalized values against the control (RPM). Fold changes in TaqMan data are calculated from normalized ratios (gene expression/HPRT expression) against the control RPM. SDs in TaqMan samples are <0.01 for all treatments.

 
Because increases in fra-1 expression were most dramatic by both microarray and TaqMan analyses, and in line with our hypothesis that this early response proto-oncogene may be critical to the expression of intermediate response genes involved in the development of mesotheliomas, we also examined fra-1 expression by real-time Q-PCR in normal human mesothelial cells exposed to asbestos and in human mesotheliomas (Fig. 2A)Citation . As can be seen, fra-1 mRNA levels increased strikingly in response to asbestos and in human mesotheliomas, validating our results in the rat model. Also, an EMSA supershift confirmed the increased level of Fra-1 protein in the AP-1 complex (Fig. 2B)Citation .



View larger version (74K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Increased levels of fra-1 and Fra-1 expression in human mesothelial cells (HMC) exposed to crocidolite asbestos (5 µg/cm2 dish for 24 h) and human mesotheliomas. Tag+, SV40 T antigen positive; Tag-, SV40 T antigen negative. Real-time Q-PCR (A) and EMSA supershift (B). Results are expressed as means ± SE. *, P <= 0.05 in comparison with control group.

 
RNA Silencing in RPM Cells Exposed to Asbestos Links fra-1 Expression to Increases in cd44 and c-met Expression.
We then used the RNA interference technique to silence the fra-1 gene in RPM cells exposed to asbestos and in a mesothelioma cell line to determine whether its expression was critical to induction of selected genes involved in cell signaling, invasiveness, and DNA damage. To verify the specificity of the sifra-1 RNA, we first performed real-time Q-PCR and EMSAs on RPM cells transfected with the sd and sifra-1 before a 24-h exposure to asbestos (Fig. 3)Citation . As shown in Fig. 3ACitation , RPM cells transfected with the sd showed increased expression of fra-1 after exposure to asbestos, whereas fra-1 expression was inhibited in sifra-1-transfected cells. Supershift analyses also showed decreased Fra-1 in AP-1 complexes of sifra-1-infected cells (Fig. 3B)Citation .



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Silencing of fra-1 using sifra-1 results in its decreased expression in RPM cells exposed to crocidolite asbestos (5 µg/cm2 for 24 h) and in mesothelioma 23. sd, groups transfected with sd (control). A, real-time Q-PCR results; B, EMSA supershift analysis for detection of Fra-1 in AP-1 complexes. Results are expressed as means ± SE. *, P <= 0.005 in comparison with control group. +, P <= 0.05 in comparison with sdRPM + asbestos. Sd, scramble duplex.

 
In subsequent analyses, we transfected cells with sd or sifra-1 and examined expression of four selected genes in RPM cells alone and after exposure to asbestos (Fig. 4A)Citation and in mesothelioma 23 (Fig. 4B)Citation . These studies revealed that from the subset of genes mimicking fra-1 patterns of expression, cd44 and c-met expression was strikingly diminished by siRNA gene silencing of fra-1, whereas mRNA levels of hmgI(Y) and gadd45 were unaffected after fra-1 silencing.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Real-time Q-PCR for quantitation of selected genes up-regulated in (A) asbestos-exposed RPM cells and (B) mesothelioma 23 after transfection with sifra-1 or sd. Results are expressed as means ± SE. *, P <= 0.05 in comparison with control group. +, P <= 0.05 in comparison with sdRPM + asbestos.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Malignant mesotheliomas are of contemporary importance because their incidence is increasing in several countries, and they have most recently been associated with the presence of SV40 T antigen as well as asbestos exposures (17) . The diagnostic tools and treatment regimens for these tumors are disappointing, and patients generally survive less than 18 months after initial diagnosis (18) . In an effort to dissect critical genes and signaling pathways involved in the development of mesotheliomas, we performed microarray analysis of mRNA expression patterns in normal RPM cells exposed to asbestos and in rat mesotheliomas. Because expression of the early response proto-oncogene, fra-1, was strikingly increased in both rat and human mesothelial cells exposed to asbestos and in mesotheliomas, and because fra-1 expression is critical to morphological transformation of mesothelial cells (13 , 19) , we hypothesized that its expression would govern the regulation of intermediate response genes linked to phenotypic changes in mesothelial cells. We show here, using a novel RNAi approach, that silencing of fra-1, a prominent component of AP-1 complexes in mesotheliomas (13 , 19) , results in abrogation of cd44 and c-met expression, genes that are critical to growth and invasiveness of tumors.

Many oncogenic and mitogenic pathways converge at the AP-1 transcription factor, suggesting an important role of this complex in cell transformation or responses to carcinogens and tumor promoters (reviewed in Ref. 20 ). The dimeric AP-1 complex is comprised of members of the Fos, Jun, and ATF family, and the constituents of this complex, particularly the interaction of binding partners, may govern cell responses. In contrast to other members of the Fos/Jun family, Fra-1 has only recently received attention. Some reports indicate that it lacks a functional transactivation domain (21 , 22) and is merely a suppressor of gene transcription. However, recent reports indicate that ERK-dependent transactivation of Fra-1 is critical to mitogenesis and tumor promotion in skin (23) and that both c-Fos and Fra-1 are capable of modulating transcription of target genes (24) . These studies support our results here and recently published work showing a functional role of ERK-dependent Fra-1 expression in transformation of mesothelial cells (13) .

The fra-1-dependent expression of cd44 is intriguing and has multiple ramifications in the process of mesothelioma development. CD44 is the principal cell surface receptor for the extracellular matrix glycosaminoglycan hyaluronan, which is increased in mesotheliomas (25) . The cell surface hyaluronan receptor CD44 is expressed in a variety of normal tissues and tumors. Binding of CD44 to hyaluronan mediates cell attachment and migration (26) . An association between overexpression of CD44 or its alternative spliced variants and aggressiveness and metastasis of a variety of human tumors shows the importance of this protein in tumor invasiveness in vitro (27 , 28) and in vivo (29 , 30) . CD44 also has been linked causally to the development of chronic inflammatory responses in lung (31 , 32) .

In support of an association between fra-1 and cd44, p21ras promotes transcription of the cd44 gene via an AP-1 binding site (33) . Moreover, a link between AP-1, CD44 induction, and cell invasion into extracellular matrix has been demonstrated (34) . Epidermal growth factor, a cytokine causing increased ERK activity in RPM cells in a manner similar to asbestos (8 , 35) , up-regulates CD44-dependent astrocytoma invasion in vitro (36) . Moreover, the ERK pathway regulates alternative pre-mRNA splicing variants of CD44 (37) .

Our observation that fra-1 expression up-regulates c-met also has mechanistic implications in the development of mesotheliomas by asbestos and SV40 T antigens, further supporting the concept that these diverse agents may act through similar cell signaling pathways (38) . The c-met proto-oncogene encodes a transmembrane tyrosine kinase receptor (Met) for HGF (or scatter factor), a multifunctional protein involved in tissue repair as well as in cancer and metastasis. Others have found a predominant role of HGF in mesothelioma cell invasion and regulation of matrix metalloproteinases and their inhibitors (39) . Met is also overexpressed in mesotheliomas and linked to growth, migration, and invasion of tumors (40 , 41) . Recent studies have confirmed that HGF is increased in bronchoalveolar and pleural lavage fluids after administration of crocidolite asbestos to rats and causes mitogenesis in mesothelial cells (42) . Moreover, SV40 viral replication in human mesothelial cells induces HGF/Met receptor activation via an autocrine loop that causes cell cycle progression into S phase (43) . RNA silencing using sifra-1 did not inhibit hmgI(Y) or gadd45 expression induced by asbestos. Both gadd45 and gadd153 were highly up-regulated in both asbestos-exposed RPM cells and mesotheliomas, observations that may relate to the fact that asbestos induces DNA damage and growth arrest in mesothelial cells (44) .

HMGI(Y)s are chromatin-associated proteins that are overexpressed in many types of human malignancies (45) . HMGI(Y) expression is also induced by tumor promoters in transformation-sensitive cells (46) . Furthermore, HMGI(Y)-positive carcinomas have invasive growth patterns, whereas the HMGI(Y)-negative carcinomas are either carcinomas in situ or tumors with minimal invasion (45) . This evidence suggests that HMGI(Y) may play a vital role in the oncogenic transformation of cells. Transcription of cd44 by AP-1 proteins is enhanced by HMGI(Y) (47) .

Other genes up-regulated in mesothelioma were related to changes in metabolic rates and are commonly expressed during tumorigenesis. For example, tumor cells are known to be highly glycolytic, and increased expression of glycolytic enzymes including hexokinase II, which catalyzes the phosphorylation of glucose, has been reported (48) . Glucose metabolism is partially regulated by phosphofructokinase C and is also increased during cell transformation (49) . Also, lysophosphatidic acid up-regulates exokinases, requiring both Ca2+-independent protein kinase Cs and mitogen-activated protein kinase pathways (50) .

The transport of pyruvate and lactate across cellular membranes is an essential process in mammalian cells and is mediated by monocarboxylate transporters that are highly expressed in cancer cells but low in normal cells (51) .

Acyl-CoA thioesterase, which cleaves acyl-CoA thioesters to free fatty acids, and CoA may serve to modulate cellular levels of acyl-CoAs to affect various cellular functions, including lipid metabolism (52) . LAT1, which transports neutral amino acids, is also highly expressed in tumors, presumably to support the increased protein synthesis needed for cell growth (53) . In addition, isovaleryl CoA dehydrogenase, an enzyme involved in the turnover of toxic metabolites and a product of endogenous catabolism, is also expressed in malignancies (54) .

Asbestos fibers generate reactive oxygen and nitrogen species and cause inflammation associated with the development of both cancers and fibrosis (55) . The up-regulated genes in mesotheliomas that are related to the development of inflammation include those belonging to the kallikrein-kinin system, including the bradykinin B2 receptor, which is activated by bradykinin, enhancing vascular permeability and producing tissue edema (56) . Bradykinin has also been linked to allergic airway inflammation and regulation of AP-1-related gene expression (57) .

In pulmonary inflammation, increases in nitric oxide production via inducible nitric oxide synthase and availability of the nitric oxide synthase substrate, L-arginine, are required. The increased nitrotyrosine levels in asbestos-exposed lungs (58) may be associated with increases in L-arginine resulting from an increase in cationic amino acid transporter 1 (59) . The ability of the known fibrotic agent, transforming growth factor ß, to up-regulate L-arginine transport and cause its metabolism to polyamines and L-proline, processes associated with transforming growth factor ß-stimulated collagen production, may contribute to remodeling at sites of damage (60) . Increased expression of interleukin 6, a cytokine increased by asbestos in macrophages and epithelial cells in vitro (61) and an autocrine growth factor for human cells (62) , was also observed in mesotheliomas. Increased levels of expression of this cytokine and its receptor have been observed during chronic inflammatory disease as well as tumorigenesis (63) . Other genes increased in our studies were glutathionate-dependent dehydroascorbate reductase, which reduces dehydroascorbic acid to ascorbic acid after it is oxidized during normal aerobic metabolism, and SOD-2 (MnSOD), a mitochondrial protein up-regulated in rat lungs after inhalation of asbestos (64) .

A number of protein kinases and proto-oncogenes including c-myc were increased in all samples. These include the serum and glucocorticoid-induced protein kinase, sgk, a multifunctional kinase that can be phosphorylated through a phosphatidylinositol 3'-kinase-dependent signaling pathway (65) , and the ras subfamily of GTPases, ralB. Ras proteins can activate at least three downstream signaling cascades mediated by the raf-mitogen-activated kinase (MEK)-ERK kinase family, phosphatidylinositol 3'-kinase, and Ral-specific guanine nucleotide exchange factors. The importance of the interaction between ERK pathways in the production of a malignant phenotypes has been demonstrated previously (66) .

In conclusion, our studies are the first to use a robust microarray analysis to demonstrate increases and decreases in gene expression in asbestos-exposed mesothelial cells and mesotheliomas. In support of our findings, a previous study using cDNA microarray methodology has shown increases in fra-1, egfr, and c-myc in asbestos-exposed RPM cells and in rat mesotheliomas (67) . The ability to modify gene expression of critical genes involved in metastasis of tumors by silencing of fra-1, an ERK-dependent gene, suggests that the development of novel therapeutic approaches to modify AP-1 and associated signaling pathways may be promising in the treatment of mesothelioma.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grants ES/HL09213 (to B. T. M.) and PO1 HL67004 (to B. T. M.). Back

2 To whom requests for reprints should be addressed, at Department of Pathology, University of Vermont, College of Medicine, 89 Beaumont Avenue, Burlington, VT 05405. Phone: (802) 656-0382; Fax: (802) 656-8892; E-mail: bmossman{at}zoo.uvm.edu Back

3 The abbreviations used are: ERK, extracellular signal-regulated kinase; AP-1, activator protein 1; EMSA, electrophoretic mobility shift assay; HMGI(Y), high mobility group I(Y); Q-PCR, quantitative PCR; RPM, rat pleural mesothelial; siRNA, small interfering RNA; sd, scrambled duplex; HPRT, hypoxanthine phosphoribosyl transferase; HGF, hepatocyte growth factor; Sifra-1, small interference fra-1 RNA. Back

4 www.ncbi.nlm.nih.gov. Back

Received 12/17/02. Accepted 4/23/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Mossman B., Bignon J., Corn M., Seaton A., Gee J. Asbestos: scientific developments and implications for public policy. Science (Wash. DC), 247: 294-301, 1990.[Abstract/Free Full Text]
  2. Fung H., Kow Y., Van Houten B., Mossman B. Patterns of 8-hydroxydeoxyguanosine (8OHdG) formation in DNA and indications of oxidative stress in rat and human pleural mesothelial cells after exposure to crocidolite asbestos. Carcinogenesis (Lond.), 18: 101-108, 1997.
  3. Hei T., Piao C., He Z., Vannais D., Waldren C. Chrysotile fiber is a strong mutagen in mammalian cells. Cancer Res., 52: 6305-6309, 1992.[Abstract/Free Full Text]
  4. BeruBe K., Quinlan T., Fung H., Magae J., Vacek P., Taatjes D., Mossman B. Apoptosis is observed in mesothelial cells after exposure to crocidolite asbestos. Am. J. Respir. Cell. Mol. Biol., 15: 141-147, 1996.[Abstract]
  5. Manning C., Vallyathan V., Mossman B. Diseases caused by asbestos: mechanisms of injury and disease development Luster M. I. Karol M. H. eds. . International Immunopharmacology, Vol. 2: 191-200, Elsevier Science Amsterdam, Netherlands 2002.
  6. Guthrie G. Mossman B. eds. . Health Effects of Mineral Dusts, Vol. 28: 1-584, Mineralogical Society of America Wash. DC 1993.
  7. McDonald J., Wagner A. The epidemiology of mesothelioma in historical context. Eur. Respir. J., 9: 1932-1942, 1996.[Abstract]
  8. Zanella C., Posada J., Tritton T., Mossman B. Asbestos causes stimulation of the ERK-1 mitogen-activated protein kinase cascade after phosphorylation of the epidermal growth factor receptor. Cancer Res., 56: 5334-5338, 1996.[Abstract/Free Full Text]
  9. Pache J., Janssen Y., Walsh E., Quinlan T., Zanella C., Low R., Taatjes D., Mossman B. Increased epidermal growth factor-receptor (EGF-R) protein in a human mesothelial cell line in response to long asbestos fibers. Am. J. Pathol., 152: 333-340, 1998.[Abstract]
  10. Heintz N., Janssen Y., Mossman B. Persistent induction of c-fos and c-jun expression by asbestos. Proc. Natl. Acad. Sci. USA, 90: 3299-3303, 1993.[Abstract/Free Full Text]
  11. Timblin C., Janssen Y., Mossman B. Transcriptional activation of the protooncogene c-jun by asbestos and H2O2 is directly related to increased proliferation and transformation of tracheal epithelial cells. Cancer Res., 55: 2723-2726, 1995.[Abstract/Free Full Text]
  12. Shukla A., Timblin C., BeruBe K., Gordon T., McKinney W., Driscoll K., Vacek P., Mossman B. Inhaled particulate matter causes expression of nuclear factor (NF)-{kappa}B-related genes and oxidant-dependent NF-{kappa}B activation in vitro. Am. J. Respir. Cell. Mol. Biol., 23: 182-187, 2000.[Abstract/Free Full Text]
  13. Ramos-Nino M., Timblin C., Mossman B. Mesothelial cell transformation requires increased AP-1 binding activity and ERK-dependent Fra-1 expression. Cancer Res., 62: 6065-6069, 2002.[Abstract/Free Full Text]
  14. Craighead J., Akley N., Gould L., Libbus B. Characteristics of tumors and tumor cells cultured from experimental asbestos-induced mesothelioma in rats. Am. J. Pathol., 129: 448-462, 1987.[Abstract]
  15. Janssen Y., Barchowsky A., Treadwell M., Driscoll K., Mossman B. Asbestos induces nuclear factor {kappa}B (NF-{kappa}B) DNA-binding activity and NF-{kappa}B-dependent gene expression in tracheal epithelial cells. Proc. Natl. Acad. Sci. USA, 92: 8458-8462, 1995.[Abstract/Free Full Text]
  16. Janssen Y., Heintz N., Marsh J., Borm P., Mossman B. Induction of c-fos and c-jun protooncogenes in target cells of the lung and pleura by carcinogenic fibers. Am. J. Respir. Cell. Mol. Biol., 11: 522-530, 1994.[Abstract]
  17. Klein G., Powers A., Croce C. Association of SV40 with human tumors. Oncogene, 21: 1141-1149, 2002.[Medline]
  18. Mossman B., Gee J. Asbestos related disease. N. Engl. J. Med., 320: 1721-1730, 1989.[Medline]
  19. Ramos-Nino M., Haegens A., Shukla A., Mossman B. Role of mitogen-activated protein kinases (MAPK) in cell injury and proliferation by environmental particulates. Mol. Cell. Biochem., 234/235: 111-118, 2002.
  20. Reddy S., Mossman B. Role and regulation of activator protein-1 (AP-1) in toxicant-induced responses of the lung. Am. J. Physiol. Lung Cell Mol. Physiol., 283: L1161-L1178, 2002.[Abstract/Free Full Text]
  21. Bergers G., Graninger P., Braselmann S., Wrighton C., Busslinger M. Transcriptional activation of the fra-1 gene by AP-1 is mediated by regulatory sequences in the first intron. Mol. Cell. Biol., 15: 3748-3758, 1995.[Abstract]
  22. Wisdom R., Verma I. Transformation by Fos proteins requires a C-terminal transactivation domain. Mol. Cell. Biol., 13: 7429-7438, 1993.[Abstract/Free Full Text]
  23. Young M., Nair R., Bucheimer N., Tulsian P., Brown N., Chapp C., Hsu T-C., Colburn N. Transactivation of Fra-1 and consequent activation of AP-1 occur extracellular signal-regulated kinase dependently. Mol. Cell. Biol., 22: 587-598, 2002.[Abstract/Free Full Text]
  24. Andersen H., Mahmood S., Tkach V., Cohn M., Kustikova O., Grigorian M., Berezin V., Bock E., Lukanidin E., Tulchinsky E. The ability of Fos family members to produce phenotypic changes in epithelioid cells is not directly linked to their transactivation potentials. Oncogene, 21: 4843-4848, 2002.[Medline]
  25. Li Y., Heldin P. Hyaluronan production increases the malignant properties of mesothelioma cells. Br. J. Cancer, 85: 600-607, 2001.[Medline]
  26. Lewis C., Townsend P., Isacke C. Ca2+/calmodulin-dependent protein kinase mediates the phosphorylation of CD44 required for cell migration on hyaluronan. Biochem. J., 357: 843-850, 2001.[Medline]
  27. Thomas L., Etoh T., Stamenkovic I., Mihm M. J., Byers H. Migration of human melanoma cells on hyaluronate is related to CD44 expression. J. Investig. Dermatol., 100: 115-120, 1993.[Medline]
  28. Faassen A., Schrager J., Klein D., Oegema T., Couchman J., McCarthy J. A cell surface chondroitin sulfate proteoglycan, immunologically related to CD44, is involved in type I collagen-mediated melanoma cell motility and invasion. J. Cell Biol., 116: 521-531, 1992.[Abstract/Free Full Text]
  29. Gunthert U., Hofmann M., Rudy W., Reber S., Zoller M., Haussmann I., Matzku S., Wenzel A., Ponta H., Herrlich P. A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell, 65: 13-24, 1991.[Medline]
  30. Guo Y., Ma J., Wang J., Che X., Narula J., Bigby M., Wu M., Sy M. Inhibition of human melanoma growth and metastasis in vivo by anti-CD44 monoclonal antibody. Cancer Res., 54: 1561-1565, 1994.[Abstract/Free Full Text]
  31. Teder P., Vandivier R., Jiang D., Liang J., Cohn L., Pure E., Henson P., Noble P. Resolution of lung inflammation by CD44. Science (Wash. DC), 296: 155-158, 2002.[Abstract/Free Full Text]
  32. Bourguignon L., Zhu D., Zhu H. CD44 isoform-cytoskeleton interaction in oncogenic signaling and tumor progression. Front. Biosci., 3: D637-D649, 1998.
  33. Hofmann M., Rudy W., Gunthert U., Zimmer S., Zawadzki V., Zoller M., Lichtner R., Herrlich P., Ponta H. A link between ras and metastatic behavior of tumor cells: ras induces CD44 promoter activity and leads to low-level expression of metastasis-specific variants of CD44 in CREF cells. Cancer Res., 53: 1516-1521, 1993.[Abstract/Free Full Text]
  34. Lamb R., Hennigan R., Turnbull K., Katsanakis K., MacKenzie E., Birnie G., Ozanne B. AP-1 mediated invasion requires increased expression of the hyaluronan receptor CD44. Mol. Cell. Biol., 17: 963-976, 1997.[Abstract]
  35. Zanella C., Timblin C., Cummins A., Jung M., Goldberg J., Raabe R., Tritton T., Mossman B. Asbestos-induced phosphorylation of epidermal growth factor receptor is linked to c-fos expression and apoptosis. Am. J. Physiol. (Lung Cell Mol. Physiol.), 277: L684-L693, 1999.
  36. Monaghan M., Mulligan K., Gillespie H., Trimble A., Winter P., Johnston P., McCormick D. Epidermal growth factor up-regulates CD44-dependent astrocytoma invasion in vitro. J. Pathol., 192: 519-525, 2000.[Medline]
  37. Weg-Remers S., Ponta H., Herrlich P., Konig H. Regulation of alternative pre-mRNA splicing by the ERK MAP-kinase pathway. EMBO J., 20: 4194-4203, 2001.[Medline]
  38. Mossman B., Gruenert D. SV40, growth factors, and mesothelioma: another piece of the puzzle. Am. J. Respir. Cell. Mol. Biol., 26: 167-170, 2002.[Free Full Text]
  39. Harvey P., Clark I., Jaurand M., Warn R., Edwards D. Hepatocyte growth factor/scatter factor enhances the invasion of mesothelioma cell lines and the expression of matrix metalloproteinases. Br. J. Cancer, 83: 1147-1153, 2000.[Medline]
  40. Klominek J., Baskin B., Liu Z., Hauzenberger D. Hepatocyte growth factor/scatter factor stimulates chemotaxis and growth of malignant mesothelioma cells through c-met receptor. Int. J. Cancer, 76: 240-249, 1998.[Medline]
  41. Tolnay E., Kuhnen C., Wiethege T., Konig J., Voss B., Muller K. Hepatocyte growth factor/scatter factor and its receptor c-Met are overexpressed and associated with an increased microvessel density in malignant pleural mesothelioma. J. Cancer Res. Clin. Oncol., 124: 291-296, 1998.[Medline]
  42. Adamson I., Bakowska J. KGF and HGF are growth factors for mesothelial cells in pleural lavage fluid after intratracheal asbestos. Exp. Lung Res., 27: 605-616, 2001.[Medline]
  43. Cacciotti P., Libener R., Betta P., Martini F., Porta C., Procopio A., Strizzi L., Penengo L., Tognon M., Mutti L., Gaudino G. SV40 replication in human mesothelial cells induces HGF/Met receptor activation: a model for viral-related carcinogenesis of human malignant mesothelioma. Proc. Natl. Acad. Sci. USA, 98: 12032-12037, 2001.[Abstract/Free Full Text]
  44. Jaurand M. Mechanisms of fibre-induced genotoxicity. Environ. Health Perspect., 105: 1073-1084, 1997.
  45. Abe N., Watanabe T., Izumisato Y., Masaki T., Mori T., Sugiyama M., Chiappetta G., Fusco A., Fujioka Y., Atomi Y. Diagnostic significance of high mobility group I(Y) protein expression in intraductal papillary mucinous tumors of the pancreas. Pancreas, 25: 198-204, 2002.[Medline]
  46. Cmarik J., Li Y., Ogram S., Min H., Reeves R., Colburn N. Tumor promoter induces high mobility group HMG-Y protein expression in transformation-sensitive but not -resistant cells. Oncogene, 16: 3387-3396, 1998.[Medline]
  47. Foster L., Wiesel P., Huggins G., Panares R., Chin M., Pellacani A., Perrella M. Role of activating protein-1 and high mobility group-I(Y) protein in the induction of CD44 gene expression by interleukin-1ß in vascular smooth muscle cells. FASEB J., 14: 368-378, 2000.[Abstract/Free Full Text]
  48. Smith T. Mammalian hexokinases and their abnormal expression in cancer. Br. J. Biomed. Sci., 57: 170-178, 2000.[Medline]
  49. Sanchez-Martinez C., Estevez A., Aragon J. Phosphofructokinase C isozyme from ascites tumor cells: cloning, expression, and properties. Biochem. Biophys. Res. Commun., 271: 635-640, 2000.[Medline]
  50. Coy P., Taneja N., Lee I., Hecquet C., Bryson J., Robey R. LPA is a novel lipid regulator of mesangial cell hexokinase activity and HKII isoform expression. Am. J. Physiol. Renal Physiol., 283: F271-F279, 2002.[Abstract/Free Full Text]
  51. Lin R., Vera J., Chaganti R., Golde D. Human monocarboxylate transporter 2 (MCT2) is a high affinity pyruvate transporter. J. Biol. Chem., 273: 28959-28965, 1998.[Abstract/Free Full Text]
  52. Kuramochi Y., Nishimura S., Takagi-Sakuma M., Watanabe T., Kuroda J., Hiratsuka K., Nagae Y., Suga T., Yamada J. Immunohistochemical localization of acyl-CoA hydrolase/thioesterase multigene family members to rat epithelia. Histochem. Cell Biol., 117: 211-217, 2002.[Medline]
  53. Kanai Y., Segawa H., Miyamoto K., Uchino H., Takeda E., Endou H. Expression cloning and characterization of a transporter for large neutral amino acids activated by the heavy chain of 4F2 antigen (CD98). J. Biol. Chem., 273: 23629-23632, 1998.[Abstract/Free Full Text]
  54. Millington D., Roe C., Maltby D., Inoue F. Endogenous catabolism is the major source of toxic metabolites in isovaleric acidemia. J. Pediatr., 110: 56-60, 1987.[Medline]
  55. Mossman B., Churg A. State-of-the-art: mechanisms in the pathogenesis of asbestosis and silicosis. Am. J. Respir. Crit. Care Med., 157: 1666-1680, 1998.
  56. Kaplanski J., Pruneau D., Asa I., Artru A., Azez A., Ivashkova Y., Rudich Z., Shapira Y. LF 16-0687 Ms, a bradykinin B2 receptor antagonist, reduces brain edema and improves long-term neurological function recovery after closed head trauma in rats. J. Neurotrauma, 19: 953-964, 2002.[Medline]
  57. Christiansen S., Eddleston J., Woessner K., Chambers S., Ye R., Pan Z., Zuraw B. Up-regulation of functional kinin B1 receptors in allergic airway inflammation. J. Immunol., 169: 2054-2060, 2002.[Abstract/Free Full Text]
  58. Tanaka S., Choe N., Hemenway D., Zhu S., Matalon S., Kagan E. Asbestos inhalation induces reactive nitrogen species and nitrotyrosine formation in the lungs and pleura of the rat. J. Clin. Investig., 102: 445-454, 1998.[Medline]
  59. Nelin L., Krenz G., Chicoine L., Dawson C., Schapira R. L-Arginine uptake and metabolism following in vivo silica exposure in rat lungs. Am. J. Respir. Cell Mol. Biol., 26: 348-355, 2002.[Abstract/Free Full Text]
  60. Durante W., Liao L., Reyna S., Peyton K., Schafer A. Transforming growth factor-ß1 stimulates L-arginine transport and metabolism in vascular smooth muscle cells: role in polyamine and collagen synthesis. Circulation, 103: 1121-1127, 2001.[Abstract/Free Full Text]
  61. Luster M., Simeonova P. Asbestos induces inflammatory cytokines in the lung through redox sensitive transcription factors. Toxicol. Lett., 102–103: 271-275, 1998.
  62. Fujino S., Yokoyama A., Kohno N., Hiwada K. Interleukin 6 is an autocrine growth factor for normal human pleural mesothelial cells. Am. J. Respir. Cell Mol. Biol., 14: 508-515, 1996.[Abstract]
  63. Willenberg H., Path G., Vogeli T., Scherbaum W., Bornstein S. Role of interleukin-6 in stress response in normal and tumorous adrenal cells and during chronic inflammation. Ann. N. Y. Acad. Sci., 966: 304-314, 2002.[Medline]
  64. Quinlan T., Marsh J., Janssen Y., Leslie K., Hemenway D., Vacek P., Mossman B. Dose responsive increases in pulmonary fibrosis after inhalation of asbestos. Am. J. Respir. Crit. Care Med., 149: 795-802, 1994.[Abstract]
  65. Brickley D., Mikosz C., Hagan C., Conzen S. Ubiquitin modification of serum and glucocorticoid-induced protein kinase-1 (SGK-1). J. Biol. Chem., 277: 43064-43070, 2002.[Abstract/Free Full Text]
  66. Ward Y., Wang W., Woodhouse E., Linnoila I., Liotta L., Kelly K. Signal pathways which promote invasion and metastasis: critical and distinct contributions of extracellular signal-regulated kinase and Ral-specific guanine exchange factor pathways. Mol. Cell. Biol., 21: 5958-5969, 2001.[Abstract/Free Full Text]
  67. Sandhu H., Dehnen W., Roller M., Abel J., Unfried K. mRNA expression patterns in different stages of asbestos-induced carcinogenesis in rats. Carcinogenesis (Lond.), 21: 1023-1029, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J DAIRY SCIHome page
P. Accornero, E. Martignani, S. Miretti, L. Starvaggi Cucuzza, and M. Baratta
Epidermal growth factor and hepatocyte growth factor receptors collaborate to induce multiple biological responses in bovine mammary epithelial cells
J Dairy Sci, August 1, 2009; 92(8): 3667 - 3675.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. B. Manning, T. Sabo-Attwood, R. F. Robledo, M. B. MacPherson, M. Rincon, P. Vacek, D. Hemenway, D. J. Taatjes, P. J. Lee, and B. T. Mossman
Targeting the MEK1 Cascade in Lung Epithelium Inhibits Proliferation and Fibrogenesis by Asbestos
Am. J. Respir. Cell Mol. Biol., May 1, 2008; 38(5): 618 - 626.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. E. Ramos-Nino, S. R. Blumen, T. Sabo-Attwood, H. Pass, M. Carbone, J. R. Testa, D. A. Altomare, and B. T. Mossman
HGF Mediates Cell Proliferation of Human Mesothelioma Cells through a PI3K/MEK5/Fra-1 Pathway
Am. J. Respir. Cell Mol. Biol., February 1, 2008; 38(2): 209 - 217.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Adiseshaiah, D. J. Lindner, D. V. Kalvakolanu, and S. P. Reddy
FRA-1 Proto-Oncogene Induces Lung Epithelial Cell Invasion and Anchorage-Independent Growth In vitro, but Is Insufficient to Promote Tumor Growth In vivo
Cancer Res., July 1, 2007; 67(13): 6204 - 6211.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Linse, C. Cabaleiro-Lago, W.-F. Xue, I. Lynch, S. Lindman, E. Thulin, S. E. Radford, and K. A. Dawson
From the Cover: Nucleation of protein fibrillation by nanoparticles
PNAS, May 22, 2007; 104(21): 8691 - 8696.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
B. T. Mossman, K. M. Lounsbury, and S. P. Reddy
Oxidants and Signaling by Mitogen-Activated Protein Kinases in Lung Epithelium
Am. J. Respir. Cell Mol. Biol., June 1, 2006; 34(6): 666 - 669.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Zhang, P. Adiseshaiah, D. V. Kalvakolanu, and S. P. Reddy
A Phosphatidylinositol 3-Kinase-regulated Akt-Independent Signaling Promotes Cigarette Smoke-induced FRA-1 Expression
J. Biol. Chem., April 14, 2006; 281(15): 10174 - 10181.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
I. Lynch, K. A. Dawson, and S. Linse
Detecting Cryptic Epitopes Created by Nanoparticles
Sci. Signal., March 21, 2006; 2006(327): pe14 - pe14.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Jagadeeswaran, P. C. Ma, T. Y. Seiwert, S. Jagadeeswaran, O. Zumba, V. Nallasura, S. Ahmed, R. Filiberti, M. Paganuzzi, R. Puntoni, et al.
Functional Analysis of c-Met/Hepatocyte Growth Factor Pathway in Malignant Pleural Mesothelioma
Cancer Res., January 1, 2006; 66(1): 352 - 361.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. M. Schewe, T. Biller, G. Maurer, I. A. Asangani, J. H. Leupold, E. R. Lengyel, S. Post, and H. Allgayer
Combination Analysis of Activator Protein-1 Family Members, Sp1 and an Activator Protein-2{alpha}-Related Factor Binding to Different Regions of the Urokinase Receptor Gene in Resected Colorectal Cancers
Clin. Cancer Res., December 15, 2005; 11(24): 8538 - 8548.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Mukohara, G. Civiello, I. J. Davis, M. L. Taffaro, J. Christensen, D. E. Fisher, B. E. Johnson, and P. A. Janne
Inhibition of the Met Receptor in Mesothelioma
Clin. Cancer Res., November 15, 2005; 11(22): 8122 - 8130.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Cacciotti, D. Barbone, C. Porta, D. A. Altomare, J. R. Testa, L. Mutti, and G. Gaudino
SV40-Dependent AKT Activity Drives Mesothelial Cell Transformation after Asbestos Exposure
Cancer Res., June 15, 2005; 65(12): 5256 - 5262.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. J. Gordon, G. N. Rockwell, R. V. Jensen, J. G. Rheinwald, J. N. Glickman, J. P. Aronson, B. J. Pottorf, M. D. Nitz, W. G. Richards, D. J. Sugarbaker, et al.
Identification of Novel Candidate Oncogenes and Tumor Suppressors in Malignant Pleural Mesothelioma Using Large-Scale Transcriptional Profiling
Am. J. Pathol., June 1, 2005; 166(6): 1827 - 1840.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Hoffmann, A. Thiefes, D. Buhrow, O. Dittrich-Breiholz, H. Schneider, K. Resch, and M. Kracht
MEK1-dependent Delayed Expression of Fos-related Antigen-1 Counteracts c-Fos and p65 NF-{kappa}B-mediated Interleukin-8 Transcription in Response to Cytokines or Growth Factors
J. Biol. Chem., March 11, 2005; 280(10): 9706 - 9718.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Tanaka, Y. Tomaru, Y. Nomura, H. Miura, M. Suzuki, and Y. Hayashizaki
Comprehensive search for HNF-1{beta}-regulated genes in mouse hepatoma cells perturbed by transcription regulatory factor-targeted RNAi
Nucleic Acids Res., May 17, 2004; 32(9): 2740 - 2750.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Q. Zhang, S. R. Kleeberger, and S. P. Reddy
DEP-induced fra-1 expression correlates with a distinct activation of AP-1-dependent gene transcription in the lung
Am J Physiol Lung Cell Mol Physiol, February 1, 2004; 286(2): L427 - L436.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramos-Nino, M. E.
Right arrow Articles by Mossman, B. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramos-Nino, M. E.
Right arrow Articles by Mossman, B. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online