
[Cancer Research 63, 3750-3754, July 1, 2003]
© 2003 American Association for Cancer Research
Glioblastoma Induces Vascular Endothelial Cells to Express Telomerase in Vitro1
Maria Laura Falchetti,
Francesco Pierconti,
Patrizia Casalbore,
Nicola Maggiano,
Andrea Levi,
Luigi Maria Larocca and
Roberto Pallini2
Institutes of Neurobiology and Molecular Medicine [M. L. F., A. L.] and Cell Biology [P. C.], Consiglio Nazionale delle Ricerche, Rome 00137 and Institutes of Human Pathology [F. P., N. M., L. M. L.] and Neurosurgery [R. P.], Catholic University, Rome 00168, Italy
 |
ABSTRACT
|
|---|
Angiogenesis is essential for the growth of solid tumors. We have observed previously that the vascular endothelial cells of astrocytic brain tumors express human telomerase reverse transcriptase (hTERT) mRNA, suggesting a role for telomerase in the angiogenesis of these neoplasms. Here, we used an in vitro model to demonstrate that the telomerase machinery might be trans-activated in primary endothelial cells by glioblastoma tumor cells. We found that glioblastoma cells in vitro do induce hTERT mRNA and hTERT protein expression, as well as telomerase enzyme activity in the endothelial cells, and that this phenomenon is mediated by diffusible factor(s). These results provide strong evidence of the involvement of telomerase in tumor angiogenesis and will stimulate research on antitelomerase drugs for treatment of malignant brain gliomas.
 |
INTRODUCTION
|
|---|
Angiogenesis is essential for the growth of solid tumors beyond volumes so small that they can be fed and drained by diffusion only. Tumor angiogenesis is regulated at large by proangiogenic and antiangiogenic factors. These factors might be released from tumor cells, endothelial cells, and macrophages in response to alterations in the immediate microenvironment or to a systemic stimulus. It is believed that the switch from avascular to vascular phenotype in an early tumor is governed by the change in the relative balance between inducers and inhibitors of angiogenesis (1)
. GBM,3
a WHO grade IV, highly aggressive glioma, is regarded as the prototype of a tumor capable of inducing angiogenesis (2)
. The vascular phenotype of this tumor is so prominent that it represents a hallmark for the diagnosis (3)
.
Telomerase is a specialized reverse transcriptase that specifically duplicates the ends of linear chromosomes, the telomeres (4)
. In the absence of telomerase, cellular replication is followed by a gradual loss of telomeric sequence because of the inability of conventional DNA polymerases to copy the 3' termini of the chromosome. This progressive shortening of telomeres confers cells a limited life span. After the cells have reached a critical telomere shortening, they enter an irreversible block of proliferation termed senescence. Telomere dynamic determines cellular life span, and telomerase activation is thought to be a crucial event in cell transformation as well as infinite tumor growth (5)
. Reactivation of telomerase is a common feature of transformed cells, and regulation of telomerase activity is achieved mainly by regulating the expression of its reverse transcriptase-like subunit, hTERT (6)
.
Inhibition of angiogenesis and inactivation of telomerase are among the most promising approaches for treating cancer diseases. We have shown recently that hTERT mRNA is expressed not only by the glioma tumor cells, as expected, but also by the proliferating endothelial cells of the tumor vasculature (7)
. However, the expression of hTERT mRNA by endothelial cells does not merely reflect the proliferative status of these cells; conversely, it seems to represent a specific feature of tumor angiogenesis. In fact, hTERT mRNA expression was not observed in the endothelial cell proliferation that occurs in non-neoplastic brain angiogenesis (7)
. Although the presence of hTERT mRNA does not necessarily imply an active telomerase enzyme, we hypothesized that telomerase activity in the endothelial cells might support tumor angiogenesis. However, our previous study did not give hints on the mechanisms whereby telomerase expression is induced in the endothelial cells.
In the present study, we show that primary human endothelial cells, which were either cocultured with human GBM cells or exposed to GBM-conditioned medium, express the hTERT mRNA and hTERT protein, and exhibit an active telomerase enzyme. These data suggest that diffusible factor(s) released by the tumor might act on the endothelial cells, in the absence of other stimuli, like cell-to-cell adhesion, cell matrix components, or hypoxia. Our results strongly support the hypothesis that telomerase is involved in the angiogenesis of brain gliomas, and confer a new value to antitumoral strategies targeted to telomerase, which would indeed be effective not only against neoplastic cells proliferation but also against tumor angiogenesis.
 |
MATERIALS AND METHODS
|
|---|
Immunohistochemistry for hTERT, GFAP, CD31, and p53
Immunohistochemistry was performed on deparaffinized sections of surgically resected tumors and on cell cultures using the avidin-biotin methods (ABC-Elite kit; Vector, Burlingame, CA). The expression of hTERT protein was investigated with the monoclonal antibody NCL-hTERT (Novocastra Laboratories, Newcastle upon Tyne, United Kingdom). The expression of GFAP and CD31, which are well-defined phenotypic markers for astrocytic and endothelial cells, respectively, was assessed with the monoclonal antibodies anti-GFAP and anti-CD31 (Dako, Glostrup, Denmark) as elsewhere described (8)
. The expression of p53 was detected with the monoclonal antibody DO-7 (Dako), which recognizes a determinant of wild-type and mutant p53 protein in formalin-fixed sections (9)
. Endogenous biotin was saturated by biotin blocking kit (Vector). For antigen retrieval, paraffin sections were microwave-treated in 0.01 M citric acid buffer at pH 6.0 for 10 min. For immunohistochemical double staining studies, the Dako EnVision Doublestain System was used (Dako).
Coculture of Glioblastoma Cells and HUVECs
HUVECs (Bio-Wittaker, Walkersville, MD) were maintained in complete endothelial cell growth medium (EGM-2; Bio-Wittaker) containing endothelial cell basal medium (EBM-2; Bio-Wittaker) supplemented with endothelial cell Bullet kit (Bio-Wittaker; 2% FCS, hEGF-2, hFGF-2, hVEGF, R3-IGF-1, ascorbic acid, hydrocortisone, heparin, gentamicin, and amphotericin-B). Cells were grown at 37°C in a humidified atmosphere of 5% CO2-95% air. Cells used for the experiments were between passage 3 and 5. Two human glioblastoma cell lines were used. The TB10 human glioma cell line was obtained in our laboratory by dissociation of human GBM tumor (10)
. The cells were passaged >200 times in culture. Major features of the TB10 cell line included maintenance of the glial phenotype, expression of the EGF receptor, and mutation of p53 protein. The second cell line was T98G (11)
. TB10 and T98G cells were grown in DMEM (high glucose; Life Technologies, Inc., Milan, Italy) supplemented with 10% heath-inactivated fetal bovine serum. Three experimental paradigms were used.
Poly/L/lysine-treated Glass Slides as Substrates.
The HUVECs were plated on one half of the glass slide by placing a sterile 24 x 24 mm cover glass on the other half side. After cell adhesion, the cover glass was moved to cover the adhered cells, and freshly suspended GBM cells were added. Three to 4 h later, the cover glass was removed leaving the two cell populations in close proximity. Parallel cultures consisting of a single GBM and HUVEC population were used as control cultures. Both the single culture of HUVECs and the cocultures were grown in EGM-2.
Transwell Polycarbonate Membrane Polystyrene Plates.
HUVECs and GBM cell lines were plated in transwell polycarbonate membrane polystyrene plates (pore size 0.4 µm; Corning Costar Inc., New York, NY) at the density of 5 x 103 cells/cm2 in separated compartments and maintained in complete endothelial cell growth medium, EGM-2. Cultures were processed at different time intervals up to subconfluence. Single cultures of GBM cells and of HUVECs were maintained in DMEM and in EGM-2, respectively, for corresponding time intervals and used as controls.
Conditioned Medium.
GBM cells were cultured for 4 days in complete endothelial cell growth medium, EGM-2. Conditioned medium was collected, centrifuged, and used to maintain HUVECs for 3 days. Parallel cultures of HUVECs and GBM cells were used as controls.
ISH
Digoxigenin-labeled antisense and sense riboprobes were generated by in vitro transcription from a cDNA encoding hTERT, cloned in both orientations under T7 RNA polymerase promoter, using the SP6/T7 Transcription kit (Roche Diagnostics GmbH, Mannheim, Germany). For ISH, the cells were fixed with 4% paraformaldehyde, rinsed in PBS, and treated with 10 µg/ml proteinase K (Sigma/Aldrich, St. Louis, MO) for 10 min at 37°C. The slides were washed in 2x SSC and air dried. Hybridization procedures were carried out as reported elsewhere (12)
. Hybridization was detected using an alkaline phosphate conjugate antidigoxigenin antibody (Boehringer Mannheim Corporation, Indianapolis, IN) with nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate as substrate, according to the manufacturers instructions. Control samples, which were both hybridized with digoxigenin-labeled sense riboprobe and pretreated for 60 min with 100 µg/ml RNase (Sigma), did not display any signal.
RT-PCR
RNA was extracted according to Chomczynski and Sacchi (13)
. An amount of 2 µg of total RNA were retro-transcribed by oligodeoxythymidylic acid primer (Promega, Madison, WI), and one-fifth of the resulting cDNA amplified via PCR. Amplification of G3PDH was used to normalize PCR reaction. The primer sets used were: F-TERT/3280 (ACCAAGCATTCCTGCTCAAGCTG) and R-TERT/3685 (CGGCAGGTGTGCTGGACACTC) for hTERT, and F-G3PDH/4205 (ACCACAGTCCATGCCATCAC) and R-G3PDH/4762 (TCCACCACCCTGTTGCTGTA) for G3PDH. PCR was performed using 1.5 mM MgCl2, 200 µM deoxynucleoside triphosphates, 10 pmol of each primer, and 2 units of Taq polymerase (Promega). cDNA was amplified by 35 cycles with the following settings: 94°C for 30 s; 65°C for 45 s; 72°C for 30 s, for hTERT, and 28 cycles at 94°C for 30 s; 60°C for 45 s; and 72°C for 30 s, for G3PDH.
TRAP Assay
The PCR-based TRAP assay was used to analyze telomerase enzyme activity as described (14)
. One-fifth of the PCR reaction was electrophoresed on 10% polyacrylamide nondenaturing gel and visualized by autoradiography.
 |
RESULTS
|
|---|
hTERT Protein Expression in GBM Tumor Tissue.
In previous works, we demonstrated the expression of hTERT mRNA by vascular endothelial cells of astrocytic tumors (7
, 15)
. This expression was related to the histological grade of the tumor and was detectable in all of the GBM tumors (7)
. Conversely, the endothelial cells of normal brain vessels as well as the proliferating endothelial cells of non-neoplastic brain angiogenesis did not express hTERT mRNA (7)
. To extend this observation, we here investigated the expression of hTERT protein on secondary GBM tissue sections using a monoclonal antibody directed against hTERT. In secondary GBM, the tumor cells migrating along blood vessels can be identified by their p53-positive staining (16)
. The glomeruloid neoangiogenic vessels of GBM are mainly constituted of endothelial cells, as revealed by the expression of CD31, a well-defined phenotypic marker for the endothelial cells (Fig. 1A)
. Neoplastic glial cells were identified by the high nuclear expression of p53 (Fig. 1B)
. The hTERT protein was revealed by a microgranular reaction in the nuclei both of the tumor cells and of the vascular endothelial cells of GBM vasculature (Fig. 1C)
. To rule out the possibility that the hTERT immunoreactive cells at the luminal surface of the blood vessels were tumor cells ("mosaic cells"), we used double immunostaining with anti-hTERT and anti-CD31 monoclonal antibodies on the same tissue section (Fig. 1D)
. Both double immunostaining and p53 immunostaining confirmed the endothelial nature of the hTERT-labeled vascular cells (Fig. 1, B and D)
.

View larger version (150K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. hTERT protein expression in human glomeruloid vessels of secondary GBM tissue. Staining with CD31 monoclonal antibody on endothelial cells of neoangiogenic vessels (A). Specific p53 nuclear staining on neoplastic glial cells (B). Nuclear staining with NCL-hTERT monoclonal antibody both on neoplastic glial cells and on endothelial cells (C). Two-color immunohistochemistry with CD31 monoclonal antibody (cytoplasmic reaction in red) and with NCL-hTERT monoclonal antibody (nuclear granular staining in brown) coexpressed in endothelial cells (D). ABC-px method, hematoxylin counterstain. Scale bar, 40 µm.
|
|
Expression of hTERT mRNA and of hTERT Protein in Cocultures.
To explore the mechanisms of hTERT induction in the endothelial cells, we tested whether GBM cells might be able to induce in vitro a trans-activation of hTERT. Therefore, we cocultured HUVECs with human GBM cells on glass slides. Fig. 2
shows the specific expression of the phenotypic markers CD31 and GFAP by HUVECs (Fig. 2A)
and GBM cells (Fig. 2B)
, respectively, on glass slide cocultures. Results of ISH for hTERT mRNA are presented in Fig. 3, AD
. As expected, a strong cytoplasmic signal characterized the ISH reaction of GBM cells (Fig. 3A)
, whereas there was no hybridization signal on the control HUVECs (Fig. 3B)
. Conversely, the endothelial cells, which were cocultured with GBM cells, revealed a specific, strictly cytoplasmic staining (Fig. 3, C and D)
. Twelve h after plating, the HUVECs showed a light, microgranular staining in the cytoplasm of a number of cells (Fig. 3C)
. At 4 and 8 days, the ISH signal became stronger and widespread throughout the cytoplasm of most of the HUVECs (Fig. 3D)
. The expression of hTERT protein in cocultured HUVECs is shown in Fig. 3, EH
. Glioblastoma cells were characterized by an intense, diffuse, and microgranular nuclear staining (Fig. 3E)
. Control HUVEC did not display hTERT protein immunoreaction (Fig. 3F)
. After 24 h of cocultivation with GBM cells, a specific nuclear signal was detectable in some of the HUVECs (Fig. 3G)
, and at 4 days most HUVECs expressed hTERT protein as demonstrated by the heavy staining of their nuclei (Fig. 3H)
. Therefore, the expression of hTERT protein in cocultured HUVECs resembled the kinetics of mRNA expression observed by ISH. Both the TB10 and T98G GBM cell lines were able to induce hTERT trans-activation in the cocultured HUVEC cells.

View larger version (91K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Immunohistochemistry of GBM cells and HUVECs cocultured on glass slides. Staining for GFAP on the human glioblastoma cell line TB10 (A; scale bar, 25 µm). Staining for CD31 on HUVECs (B; scale bar, 20 µm). High magnifications of CD31-positive HUVECs cocultured with TB10 (arrows; C and D; scale bars, 15 µm). ABC-px method, hematoxylin counterstain.
|
|

View larger version (98K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Expression of hTERT mRNA and hTERT protein in HUVECs cocultured with GBM cells on glass slides. ISH cytoplasmic staining for hTERT mRNA and nuclear microgranular immunostaining for hTERT protein on GBM cells (A and E, respectively). Negative ISH and negative immunostaining for hTERT on HUVECs (B and F, respectively). Cytoplasmic ISH staining on HUVECs cocultured with GBM cells for 12 h and 4 days (C and D, respectively). Nuclear staining for hTERT protein on HUVECs cocultured with GBM cells for 24 h and 4 days (G and H, respectively). AD, ISH for hTERT mRNA. EH, ABC-px method. Scale bars, 25 µm.
|
|
Expression of hTERT and Telomerase Activity in HUVECs Exposed to the Conditioned Medium of Glioblastoma.
To assess whether the induction of hTERT in cocultured HUVECs might be ascribed to contact mechanisms or, alternatively, to the release of diffusible factor(s) by GBM cells, we used transwells where a polycarbonate membrane physically keeps the two cell populations separated during culturing. The expression of hTERT in HUVECs was detected by RT-PCR (Fig. 4)
. After 12 h of culturing in the transwells, we could not reveal any hTERT transcript. However, after 3 days, hTERT was expressed at a high level, and at 5 days hTERT expression additionally increased to levels comparable with those seen in GBM cells (Fig. 4)
. It is worth noting that single cultures of HUVECs did not show any hTERT expression (Fig. 4)
, demonstrating that the complete endothelial cell growth medium, which contains FCS, EGF, FGF-2, and VEGF, cannot induce per se hTERT activation. With this experiment, we demonstrated that GBM cells induce an activation of hTERT gene transcription and that this activation is likely mediated by soluble factor(s), which act on endothelial cells.

View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Induction of hTERT transcription in HUVECs by GBM-conditioned medium. RT-PCR for G3PDH (top panel) and hTERT (bottom panel). a-c, HUVECs cocultured in transwells with TB10 for 12 h, 3 days, and 5 days, respectively. d, control culture of TB10. e, HUVECs exposed to TB10-conditioned medium for 3 days. f, control culture of HUVECs. g, HUVECs cocultured in transwells with T98G for 5 days. h, HUVECs exposed to T98G-conditioned medium for 5 days. i, control culture of T98G. l, control culture of HUVECs.
|
|
To confirm that a soluble factor was responsible for GBM-mediated trans-activation of hTERT in endothelial cells, we exposed HUVECs to EGM-2 medium conditioned by GBM cells, as described in "Materials and Methods." After 3 days of culturing with GBM-conditioned medium, the HUVECs were harvested and processed. RT-PCR for hTERT revealed a specific amplification (Fig. 4)
, confirming that cell-to-cell contact mechanisms are not required to activate hTERT transcription.
To investigate whether GBM cells even drive in vitro the reactivation of telomerase in HUVECs, we assessed telomerase enzyme activity by TRAP assay on HUVECs, which were either cocultured in transwells with GBM cells or exposed to GBM-conditioned medium. A parallel culture of HUVEC was tested as negative control. In the transwell coculture paradigm, the HUVECs displayed detectable levels of telomerase after 3 days of culturing, and the telomeric ladder intensity increased after 5 days (Fig. 5)
. After 3 days of exposure to GBM-conditioned medium, we observed a telomerase ladder in HUVECs that was comparable with that obtained with the transwell model at the same time (Fig. 5)
. Both the TB10 and T98G cell lines were able to induce hTERT expression and telomerase activation in HUVECs in the transwell, as well as in the conditioned medium paradigms. Of note, telomerase activity was not detectable in HUVEC extracts after 12 h of cocultivation in the transwell. This result is in agreement with the RT-PCR data, and likely reflects the fact that telomerase activity and hTERT mRNA are below the detection limit of TRAP and RT-PCR, respectively, in the early phase of reactivation, when only a percentage of the HUVEC population is hTERT positive (Fig. 3, C and G)
. In this respect, the ISH technique, which detects hTERT expression at the single cell level, was more sensitive than TRAP and RT-PCR as well.

View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Induction of telomerase activity in HUVECs by GBM-conditioned medium as assessed by TRAP. a-c, HUVECs cocultured in the transwells with TB10 for 12 h, 3 days, and 5 days, respectively. d, HUVECs exposed for 3 days to TB10-conditioned medium. e, control culture of HUVECs. f and g, TB10 and 293 cells, respectively. h, HUVECs cocultured in transwells with T98G for 5 days. i, HUVECs exposed to T98G-conditioned medium for 5 days. l, control culture of HUVECs. m, control culture of T98G.
|
|
To assess whether the induction of telomerase activity mediated by GBM was cell-specific, we also performed RT-PCR and TRAP assay on primary human fibroblasts exposed to GBM-conditioned medium. Under these conditions, neither the presence of hTERT mRNA nor the enzymatic activity was detected (data not shown), suggesting that the phenomenon of GBM trans-activation of telomerase selectively involves the endothelial cells.
 |
DISCUSSION
|
|---|
Despite the efforts spent to understand tumor angiogenesis, little is known about the molecular mechanisms that control the development of the tumor vasculature. Our group demonstrated recently on histological material that the endothelial cells of astrocytic tumors express hTERT mRNA, suggesting that telomerase, other than in tumor cell immortalization, might also have a role in tumor angiogenesis (7)
. The expression of hTERT mRNA by endothelial cells seems to be a specific feature of tumor angiogenesis, and it does not appear to merely reflect the proliferative status of these cells. Endothelial hTERT transcription is tumor specific, because it was not observed in non-neoplastic brain angiogenesis, like the endothelial cell proliferation of newly formed vessels surrounding brain infarcts (7)
. A relationship between hTERT mRNA expression and endothelial cell proliferation, as assessed by the MIB-1 staining index, was clearly found only in GBM tumors (7)
. Conversely, in low-grade astrocytoma and in anaplastic astrocytoma, hTERT expression did not correlate with the proliferation rate of endothelial cells (7)
. These results suggest that hTERT mRNA expression by vascular endothelial cells is an early event in the progression of astrocytic tumors that heralds the endothelial cells proliferation.
Starting from these observations, we investigated in vitro the molecular interaction between GBM, which is considered the prototype of tumor capable of inducing angiogenesis, and the primary endothelial cells, HUVECs. We show that GBM cells per se are able to induce hTERT transcription in normal endothelial cells, which activate telomerase enzyme activity. Such trans-cellular induction of telomerase does not necessarily involve contact mechanisms, as demonstrated by the transwell and the conditioned medium paradigms, whereas it is likely because of diffusible factor(s) of which the signal transduction impinge on transcriptional regulation of the hTERTgene. It is worth noticing that growth factors, like FCS, EGF, FGF-2, and VEGF, which are present in the endothelial cell culture medium EGM-2, do not seem to be responsible for hTERT up-regulation and telomerase activation in the endothelial cells, because control cultures of HUVECs, which were grown in EGM-2, did not show hTERT transcript and telomerase activity as well. At present, we have only a few suggestions on the identity of the hTERT activator(s), which is supposedly released by GBM tumor cells. We have demonstrated elsewhere that the proangiogenic factor VEGF, which is known to be released by GBM at high doses (17)
, is not responsible for hTERT up-regulation in HUVECs, because addition to the culture medium of VEGF at concentrations similar to those found in GBM tissue does not activate hTERT transcription in these cells (7)
. FGF-2 has been shown to enhance the angiogenesis processes in hTERT-transduced human endothelial cells more powerfully than VEGF (18)
. However, in our experiment, control HUVECs that were grown in the presence of FGF-2 did not display any telomerase activity. Independently from the identity of the factor, recent data from literature suggest that the signal transduction mechanism responsible for telomerase activation might involve the phosphoinositol 3-kinase action (19)
).
One might speculate on the biological advantage that telomerase activation confers to the proliferating vascular endothelial cells of GBM tumor vessels. Telomerase, by maintaining telomere length, might sustain proliferation of endothelial cells, preventing the irreversible block of division triggered by a critical telomere shortening. This model is supported by the recent observations by Franco et al. (20)
, who reported that in late generation mice knockouts for TERT, short telomeres result in a sharp decrease in angiogenesis both in Matrigel implants and in murine melanoma grafts. These data indicate that telomere length might be related with the angiogenic potential and tumor growth rate in vivo, and that the tumor-mediated trans-activation of telomerase in endothelial cells might be a feature shared by neoplasms other than the astrocytic ones. Consistently with this model, it is well documented that telomerase is reactivated in normal adult tissues in instances of high proliferation, like in proliferating T lymphocytes and in the bulb-containing fragment of hair follicles (21
, 22)
. However, several studies seem to support a nonparadigmatic role for telomerase in different cell systems, not directly linked to prevent telomere attrition at repeated cell cycles. Wang et al. (23)
and our group, Falchetti et al. (24)
, demonstrated that the oncogene myc activates telomerase in primary cells, up-regulating TERT transcription. This reactivation rapidly follows the expression of a viral oncogene. The early activating function of myc could be justified if the addition of new telomeric repeats to the end of chromosomes regulates functions involved in the establishment of transformation, because a mere action on the stabilization of telomere length is not necessary in the early phases of the oncogene activity. More recently, Oh et al. (25)
reported that a forced expression of telomerase by retroviral infection of TERT in cultured cardiac mouse myocytes not only conferred protection from apoptosis, promoting cardiac myocyte survival, but led to a pronounced cell enlargement (hypertrophy) of the myocytes. All of these functions required active TERT and were not evoked by a catalytically defective mutation. Furthermore, Venetsanakonos et al. (26)
showed that telomerase-immortalized microvascular endothelial cells, but not the corresponding primary culture, undergo cell tubulogenesis in the absence of collagen or Matrigel, when cocultured with a GBM-derived cell line. These data indicate that telomerase might be involved in morphogenetic changes associated with tumor angiogenesis. Therefore, it is conceivable that the reactivation of telomerase, which we observed in the endothelial cells of tumor vasculature, might play one of these noncanonical roles.
Altogether, our results are in favor of an important role of telomerase in brain tumor angiogenesis and confer a new value to antitumoral strategies targeted to telomerase. Should reactivation of telomerase in the tumor be necessary not only to sustain the uncontrolled growth of neoplastic cells but also to support tumor angiogenesis, then a strategy to inhibit telomerase activity might be effective both on neoplastic cell proliferation and on tumor angiogenesis. Tumor cells might escape an antitelomerase therapy, because the failure of checkpoints and/or tumor suppressor pathways, which are common events in tumors, may allow their survival and division, despite critically short or dysfunctional telomeres (27)
. On the contrary, the vascular endothelial cells of the tumor vasculature, which do not bear transforming mutations, might likely be sensitive to antitelomerase treatments.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Daniela DArcangelo for helpful comments and Dr. Daniela Falchetti for critical revision of the manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by Fondi dAteneo and Fondi dAteneo per Giovani Ricercatori, Università Cattolica, and Sigma-Tau Industrie Farmaceutiche Riunite spa. M. L. F. is supported by Compagnia di San Paolo. 
2 To whom requests for reprints should be addressed, at Institute of Neurosurgery, Catholic University, Largo A. Gemelli 8, Rome 00168, Italy. 
3 The abbreviations used are: GBM, glioblastoma multiforme; hTERT, human telomerase reverse transcriptase; HUVEC, human umbilical vein endothelial cell; GFAP, glial fibrillary acidic protein; ISH, in situ hybridization; TRAP, telomeric repeat amplification protocol; EGF, epidermal growth factor; RT-PCR, reverse transcription-PCR; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; FGF, fibroblast growth factor; VEGF, vascular endothelial growth factor; TERT, telomerase reverse transcriptase. 
Received 6/26/02.
Accepted 4/30/03.
 |
REFERENCES
|
|---|
- Hanahan D., Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell, 86: 353-364, 1996.[Medline]
- Plate K. H., Breier G., Weich H. A., Risau W. Vascular endothelial growth factor and glioma angiogenesis factor in human gliomas in vivo. Nature (Lond.), 359: 845-848, 1992.[Medline]
- Russel D. S., Rubinstein L. J. . Patholology of Tumors of the Nervous System, Ed. 3 83-350, Williams and Wilkins Baltimore 1989.
- Greider C. W., Blackburn E. H. A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature (Lond.), 337: 331-337, 1989.[Medline]
- Shay J. W., Zou Y., Hiyama E., Wright W. E. Telomerase and cancer. Hum. Mol. Genet., 7: 677-685, 2001.
- Bodnar A. G., Ouellette M., Frolkis M., Holt S. E., Chiu C. P., Morin G. B., Harley C. B., Shay J. W., Lichtsteiner S., Wright W. E. Extension of life-span by introduction of telomerase into normal human cells. Science (Wash. DC), 279: 349-352, 1998.[Abstract/Free Full Text]
- Pallini R., Pierconti F., Falchetti M. L., DArcangelo D., Fernandez E., Maira G., DAmbrosio E., Larocca L. M. Evidence for telomerase involvement in the angiogenesis of astrocytic tumors. Expression of human telomerase reverse transcriptase (hTERT) messenger RNA by vascular endothelial cells. J. Neurosurg., 94: 961-971, 2001.[Medline]
- Pallini R., Casalbore P., Mercanti D., Maggiano N., Larocca L. M. Phenotypic change of human cultured meningioma cells. J. Neuro-Oncol., 49: 9-17, 2000.[Medline]
- Vojtesek B., Bartek J., Midgley C. A., Lane D. P. An himmunochemical analysis of human nuclear phosphoprotein p53: new monoclonal antibodies and epitope mapping using recombinant p53. J. Immunol. Methods, 151: 237-244, 1992.[Medline]
- De Stasio G., Casalbore P., Pallini R., Gilbert B., Sanita F., Ciotti M. T., Rosi G., Festinesi A., Larocca L. M., Rinelli A., Perret D., Mogk D. W., Perfetti P., Mehta M. P., Mercanti D. Gadolinium in human glioblastoma cells for gadolinium neutron capture therapy. Cancer Res., 10: 4272-4277, 2001.
- Stein G. H. T98G: an anchorage-independent human tumor cell line that exhibits stationary phase G1 arrest in vitro. J. Cell Physiol., 99: 43-54, 1979.[Medline]
- Maggiano N., Piantelli M., Ricci R., Larocca LM., Capelli A., Ranelletti F. O. Detection of growth hormone-producing cells in human thymus by immunohistochemistry and non-radioactive in situ hybridization. J. Histochem. Cytochem., 42: 1349-1354, 1994.[Abstract]
- Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
- Falchetti M. L., Levi A., Molinari P., Verna R., DAmbrosio E. Increased sensitivity and reproducibility of TRAP assay by avoiding direct primers interaction. Nucleic Acids Res., 26: 862-863, 1998.[Abstract/Free Full Text]
- Falchetti M. L., Pallini R., DAmbrosio E., Pierconti F., Martini M., Cimino Reale G., Verna R., Maira G., Larocca L. M. In situ detection of telomerase catalytic subunit mRNA in glioblastoma multiforme. Int. J. Cancer, 88: 895-901, 2000.[Medline]
- De Angelis L. M. Brain tumors. N. Engl. J. Med., 344: 114-123, 2001.[Free Full Text]
- Takano S., Yoshii Y., Kondo S., Suzuki H., Maruno T., Shirai S., Nose T. Concentration of vascular endothelial growth factor in the serum and tumor tissue of brain tumor patients. Cancer Res., 56: 2185-2190, 1996.[Abstract/Free Full Text]
- Yang J., Nagavarapu U., Relloma K., Sjaastad MD., Moss WC., Passaniti A., Herron S. Telomerized human microvasculature is functional in vivo. Nature Biotechnol., 19: 219-224, 2001.[Medline]
- Breitschopf K., Zeiher A. M., Dimmeler S. Pro-atherogenic factors induce telomerase inactivation in endothelial cells through an Akt-dependent mechanism. FEBS Lett., 493: 21-25, 2001.[Medline]
- Franco S., Segura I., Riese H. H., Blasco M. Decreased B16F10 melanoma growth and impaired vascularization in telomerase-deficient mice with critically short telomeres. Cancer Res., 62: 552-559, 2002.[Abstract/Free Full Text]
- Hiyama K., Hirai Y., Kyoizumi S., Akiyama M., Hiyama E., Piatyszek M. A., Shay J. W., Ishioka S., Yamakido M. Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J. Immunol., 155: 3711-3715, 1995.[Abstract]
- Harle-Bachor C., Boukamp P. Telomerase activity in the regenerative basal layer of the epidermis in human skin and in immortal and carcinoma-derived skin keratinocytes. Proc. Natl. Acad. Sci. USA, 93: 6476-6481, 1996.[Abstract/Free Full Text]
- Wang J., Xie L. Y., Allan S., Beach D., Hannon G. J. Myc activates telomerase. Genes Dev., 12: 1769-1774, 1998.[Abstract/Free Full Text]
- Falchetti M. L., Falcone G., DAmbrosio E., Verna R., Alemà S., Levi A. Induction of telomerase activity in v-myc-transformed avian cells. Oncogene, 18: 1515-1519, 1999.[Medline]
- Oh H., Taffet G. E., Youker K. A., Entman M. L., Overbeek P. A., Michael L. H., Schneider M. D. Telomerase reverse transcriptase promotes cardiac muscle cell proliferation, hypertrophy, and survival. Proc. Natl. Acad. Sci. USA, 18: 10308-10313, 2001.
- Venetsanakonos E., Mirza A., Fanton C., Romanov S. R., Tlsty T., McMahon M. Induction of tubulogenesis in telomerae-immortalized human microvascular endothelial cells by glioblastoma cells. Exp. Cell Res., 273: 21-33, 2002.[Medline]
- Chin L., Artandi S. E., Shen Q., Tam A., Lee S. L., Gottlieb G. J., Greider C. W., DePinho R. A. p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis. Cell, 97: 527-538, 1999.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
R. Pallini, L. Ricci-Vitiani, G. L. Banna, M. Signore, D. Lombardi, M. Todaro, G. Stassi, M. Martini, G. Maira, L. M. Larocca, et al.
Cancer Stem Cell Analysis and Clinical Outcome in Patients with Glioblastoma Multiforme
Clin. Cancer Res.,
December 15, 2008;
14(24):
8205 - 8212.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Fuster and V. Andres
Telomere Biology and Cardiovascular Disease
Circ. Res.,
November 24, 2006;
99(11):
1167 - 1180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-L. Wu, C. Dudognon, E. Nguyen, J. Hillion, F. Pendino, I. Tarkanyi, J. Aradi, M. Lanotte, J.-H. Tong, G.-Q. Chen, et al.
Immunodetection of human telomerase reverse-transcriptase (hTERT) re-appraised: nucleolin and telomerase cross paths
J. Cell Sci.,
July 1, 2006;
119(13):
2797 - 2806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. De Stasio, D. Rajesh, J. M. Ford, M. J. Daniels, R. J. Erhardt, B. H. Frazer, T. Tyliszczak, M. K. Gilles, R. L. Conhaim, S. P. Howard, et al.
Motexafin-Gadolinium Taken Up In vitro by at Least 90% of Glioblastoma Cell Nuclei
Clin. Cancer Res.,
January 1, 2006;
12(1):
206 - 213.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Edo and V. Andres
Aging, telomeres, and atherosclerosis
Cardiovasc Res,
May 1, 2005;
66(2):
213 - 221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Pascale, G. C. Reale, and E. D'Ambrosio
Tumor Cells Fail to trans-Induce Telomerase in Human Umbilical Vein Endothelial Cell Cultures
Cancer Res.,
November 1, 2004;
64(21):
7702 - 7705.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Serrano and V. Andres
Telomeres and Cardiovascular Disease: Does Size Matter?
Circ. Res.,
March 19, 2004;
94(5):
575 - 584.
[Abstract]
[Full Text]
[PDF]
|
 |
|