| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Laboratory for Experimental Medicine and Endocrinology, Department of Developmental Biology, Gasthuisberg, Catholic University of Leuven, B-3000 Leuven, Belgium
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Several studies using chemical inhibitors of FASE show that blockage of FASE activity severely attenuates growth and survival of tumor cells (3 , 17, 18, 19) . One of the best known and most studied inhibitors of FASE is cerulenin, a natural mycotoxin (3) . Cerulenin inhibits growth, is cytotoxic for different human cancer cells in vitro, and slows down development of ovarian cancer xenografts in mice in vivo (3 , 20, 21, 22) . However, FASE inhibitors such as cerulenin have several shortcomings. Cerulenin harbors a very reactive epoxide group that may interact also with other proteins and may affect processes other than fatty acid synthesis. In this respect, cerulenin has been shown to suppress protein palmitoylation, a posttranslational modification allowing key signaling proteins to attach to the plasma membrane (23 , 24) . Analysis of a range of cerulenin analogues showed that inhibition of palmitoylation is independent of its effects on fatty acid synthesis and is more closely related to growth inhibition of cancer cells than inhibition of FASE activity (24) . Moreover, cerulenin also suppresses cholesterol synthesis (25 , 26) and inhibits proteolysis (27 , 28) . In addition, the use of cerulenin as a FASE inhibitor is limited because of its chemical instability (3) . More stable FASE inhibitors such as C75 have recently become available (18) , but the specificity of these compounds requires additional investigation.
In this article, we have used an entirely different approach to interfere with FASE activity and to definitely establish a role for FASE as a key target for antineoplastic therapy. This approach is based on selective gene silencing by RNAi. RNAi is a cellular process resulting in enzymatic cleavage and breakdown of mRNA, guided by sequence-specific double-stranded RNA oligonucleotides (siRNAs; Ref. 29 ). Exogenously added synthetic 21-nucleotide siRNA duplexes were shown to act as very potent and highly sequence-specific agents to silence homologous gene expression, thereby holding great potential for the analysis of gene function and for gene-specific therapeutic approaches (30) . In the present work, we assessed the potential of siRNAs as alternative agents to molecularly target FASE and induce growth arrest and apoptosis in cancer cells.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RNAi.
Transfection of LNCaP cells or fibroblasts with siRNA-targeting FASE or luciferase was carried out as described previously (30
, 31) . Synthetic sense and antisense oligonucleotides were purchased from Dharmacon (Lafayette, CO). For design of siRNA oligos targeting FASE, a DNA sequence of the type AA(N19) was selected (AACCCTGAGATCCCAGCGCTG) according to the manufacturer’s protocol. This sequence corresponded to the nucleotides 1210–1231 located 3' to the first nucleotide of the start codon of the human FASE cDNA. The DNA sequence was submitted to a BLAST search against the human genome sequence to ensure that only the FASE gene was targeted. As a nonspecific siRNA control, the GL2 luciferase siRNA duplex was used as described previously (30)
. The corresponding single-stranded sense and antisense siRNA oligos (20 µM) were annealed by incubation in annealing buffer [100 mM potassium acetate, 30 mM HEPES-KOH (pH 7.4), and 2 mM magnesium acetate] for 1 min at 90°C, followed by 1 h at 37°C. Transfections were performed in 60-mm dishes at a density of 0.4 x 106 LNCaP cells/dish or 105 fibroblasts/dish using Oligofectamine (Invitrogen) and 0.33 nmol of siRNA duplex. The final concentration of siRNA in the 60-mm dishes was 166 nM. At the indicated time points after transfection, cells were used for cell proliferation/cytotoxicity assays, immunoblotting analysis, FASE activity assays, 2-14C-labeled acetate incorporation assays, and Oil red O stainings. For Hoechst 33342 and Annexin V-EGFP/propidium iodide stainings, transfections were carried out in Lab-Tek II chamber slides (Nalge Nunc International, Naperville, IL; 1.2 x 105 LNCaP cells or 3 x 104 fibroblasts/chamber) using Oligofectamine (Invitrogen) and 0.088 nmol of siRNA duplex, resulting in a final siRNA concentration of 166 nM.
Immunoblot Analysis.
At the indicated times, cells were washed and lysed in a reducing SDS buffer [62.5 mM Tris (pH 6.8), 2% SDS, 0.715 M 2-mercaptoethanol, and 8.7% glycerol]. Protein concentrations were determined on diluted samples using a bicinchoninic acid procedure (Pierce Biochemical Company, Rockford, IL). Equal amounts of protein were separated on NuPAGE Tris-acetate gels (Invitrogen), which were blotted onto polyvinylidene difluoride membranes (Roche, Mannheim, Germany). Membranes were blocked in a Tris-buffered saline solution with 5% nonfat dry milk and incubated with antibodies against cytokeratin 18 (Santa Cruz Biotechnology, Santa Cruz, CA) or FASE (13)
. Horseradish peroxidase-conjugated secondary antibodies (Dako, Carpinteria, CA) were used for detection of immunoreactive proteins by chemiluminescence (Renaissance; New England Nuclear, Dreiech, Germany).
Assay of FASE activity (in Vitro).
At the indicated times, cells were washed with PBS, harvested by scraping in 500 µl of PBS, pelleted by centrifugation, and resuspended in 200 µl of a hypotonic buffer [1 mM DTT, 1 mM EDTA, and 20 mM Tris-HCl (pH 7.5)]. Equal amounts of protein (40 and 100 µg for LNCaP cells and fibroblasts, respectively) were used to measure FASE activity as described previously (10)
.
Incorporation of 2-14C-Acetate into Cellular Lipids.
Seventy-two h after transfection with siRNA, cells were refed, and 2-14C-labeled acetate (57 mCi/mmol; 2 µCi/dish; Amersham International, Aylesbury, United Kingdom) was added to the culture medium. After 4 h of incubation at 37°C, cells were washed with PBS (culture medium and wash fluid were collected), trypsinized, and resuspended in 0.8 ml of PBS. Lipids were extracted using the Bligh Dyer method as previously described (32)
, and radioactivity was measured by scintillation counting. Measurements were performed in triplicate, and values were normalized for sample protein content. Acetate incorporation into specific lipids was analyzed after separation of lipids by TLC. Therefore, lipid extracts and appropriate lipid standards were spotted on silica gel G plates (Merck, Darmstadt, Germany). For separation of neutral lipids, plates were developed in hexane-diethyl ether-acetic acid (70:30:1, vol/vol/vol); development in chloroform-methanol-acetic acid (65:25:10, vol/vol/vol) was used for separation of phospholipids. Lipid samples and standards were visualized by autoradiography and iodine vapor, respectively. Lipid fractions were quantified using PhosphorImager screens (Molecular Dynamics, Sunnyvale, CA) and normalized for sample protein content.
Oil Red O Staining.
Lipid accumulation was determined by Oil red O staining as described previously (32)
.
Proliferation/Cytotoxicity Assay.
Growth and viability of LNCaP cells and fibroblasts (transfected with siRNA-targeting FASE or luciferase) was analyzed with the Trypan Blue Dye Exclusion assay. At the indicated times, cells were trypsinized and combined with the floating cells in the culture medium. Cells were pelleted by centrifugation at 200 x g for 10 min, resuspended in a trypan blue solution, and counted using a hemocytometer. The cells with and without blue dye staining inside were recorded as dead and alive, respectively. Measurements were performed in triplicate.
Detection of Apoptosis by Fluorescence Microscopy.
Cells were plated in chamber slides as described above, transfected with siRNA targeting FASE or luciferase, and analyzed for apoptosis 72 h after transfection. For analysis of changes in nuclear morphology during apoptosis, Hoechst dye 33342 (Sigma, Bornem, Belgium) was added to the culture medium. Fragmentation of the nucleus into oligonucleosomes and chromatin condensation was detected by fluorescence microscopy using a filter for Hoechst 33342 (365 nm). Apoptosis was also determined with an Annexin V-EGFP/propidium iodide Apoptosis Detection Kit (BD Biosciences, Palo Alto, CA) according to the manufacturer’s protocol. Briefly, the cells were washed and subsequently incubated for 15 min at room temperature in the dark in 300 µl of 1x binding buffer containing 5 µl of Annexin V-EGFP and 10 µl of propidium iodide. Afterward, apoptosis was analyzed by fluorescence microscopy using a dual-filter set for EGFP (490 nm) and propidium iodide (560 nm).
Statistical Analysis.
Comparison of values was performed using a nonparametric Mann-Whitney U test or a one-way ANOVA test. If significant differences were observed after ANOVA analysis, values were compared with a Tukey test. P < 0.05 was considered statistically significant. Data are expressed as means ± SD. All observations were confirmed by three independent experiments.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Silencing of the FASE gene was already visible 48 h after transfection, reached an optimum after 72 h, and lasted for at least another 48 h (through 120 h after transfection; Fig. 1A
). No effects of RNAi were observed on the expression of cytokeratin 18, which was used as an internal control for specificity and loading.
|
. When compared with untransfected cells (Fig. 1B)
or cells transfected with luciferase siRNAs (Fig. 1C)
, FASE siRNA-transfected cells grew less dense, were smaller in volume, made only poor cell-cell contacts, and showed an astrocyte-like phenotype with the presence of multiple extrusions (Fig. 1D)
.
FASE RNAi Decreases FASE Activity and Lipid Synthesis in LNCaP Cells.
To analyze whether FASE RNAi resulted in decreased enzymatic activity, FASE activity of LNCaP cell protein extracts was measured by quantification of 2-14C-labeled malonyl-CoA incorporation into fatty acids in vitro. At 48 h after transfection, FASE RNAi resulted in a significant decrease of FASE activity in LNCaP extracts (Fig. 2)
. The effect of RNAi on FASE activity was even more pronounced 72 h after transfection and lasted for at least 3 days (through 120 h after transfection).
|
To investigate the impact of RNAi-mediated FASE silencing on different lipid species, lipid extracts were analyzed by TLC. As shown in Fig. 3
, the majority of 14C label in control cells is incorporated into phospholipids, and FASE RNAi caused a 3-fold decrease in the labeling of these lipids. Smaller but substantial amounts of label were found in triglycerides (typical storage products of fatty acids, present in lipid droplets; Ref. 32
) and in free cholesterol. FASE RNAi caused a 7-fold decrease in the synthesis of triglycerides (Fig. 3)
, resulting in the disappearance of lipid droplets, as evidenced by staining with Oil red O (Fig. 4)
. In support of the specificity of FASE RNAi, no effect was observed on the production of free cholesterol (Fig. 3)
.
|
|
. The number of trypan blue-positive cells increased from 8% in the control cells to up to 34% in the FASE siRNA-treated cells, indicating that FASEgene silencing also induced cell death (Fig. 5B)
. Staining of the nuclear DNA of FASE siRNA-transfected cells with Hoechst 33342 revealed nuclear fragmentation and chromatin condensation (Fig. 6B)
, typical hallmarks of apoptosis that were not detected in control cells transfected with luciferase siRNA (Fig. 6A)
. Additional evidence for the occurrence of apoptosis was obtained by double staining of the cultures with propidium iodide (which stains the nuclei of dead cells) and Annexin V-EGFP, a protein that binds with high affinity to phosphatidylserine, which is translocated from the inner to the outer membrane leaflet early in the apoptotic process. As shown in Fig. 6C
, control cells stained negative for both propidium iodide and Annexin V-EGFP. FASE siRNA-transfected cultures, on the other hand, showed many annexin V-positive cells (Fig. 6D)
. The majority of the cells were negative for propidium iodide, indicating that they were at an early stage of apoptosis. The double positive staining of particular cells (Fig. 6D)
revealed that these cells were at a late apoptotic (or necrotic) stage. Taken together, these findings provide strong evidence that RNAi-mediated silencing of FASE induced cell death through apoptosis.
|
|
and 2
), fibroblasts showed a 10-fold lower FASE expression and FASE activity (Fig. 7, A and B)
. Similar to the observations in LNCaP cancer cells, siRNA targeting FASE severely decreased the (already low) expression and activity of FASE in fibroblasts (Fig. 7, A and B)
. In contrast with LNCaP cells, silencing of the FASEgene by RNAi did not inhibit proliferation of fibroblasts, which showed comparable growth rates as control fibroblasts (transfected with luciferase siRNA; Fig. 7C
). Furthermore, fibroblasts transfected with FASE siRNA did not reveal any signs of apoptosis but showed normal viability, similar to that of control fibroblasts, as evidenced by staining with trypan blue, Hoechst, or Annexin V-EGFP/propidium iodide (data not shown). These findings clearly demonstrate that RNAi-mediated FASEsilencing selectively induces cell death in LNCaP cells but not in normal human fibroblasts, thereby lending additional support to the contention that FASE is a selective target for antineoplastic therapy.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In this article, we have used siRNA to target the FASE gene, which is markedly overexpressed in a wide variety of human cancers. Treatment of LNCaP cells with siRNA-targeting FASE caused a 4-fold reduction of FASE expression and of FASE activity. Moreover, a single transfection with siRNA caused a sustained down-regulation of FASE for at least 4 days. Suppression of FASE by RNAi resulted in a marked decrease of lipogenesis and more particularly in a reduced synthesis of phospholipids and triglycerides. In support of the selectivity of RNAi-mediated FASE gene silencing and in contrast with the chemical FASE inhibitor cerulenin, no effect was observed on cholesterol synthesis. As a result of FASE RNAi, LNCaP cells underwent striking morphological changes. The cells became smaller, made poor cell-cell contacts, and displayed multiple spider-like extensions. Suppression of FASE expression significantly inhibited the growth of LNCaP cells and ultimately resulted in apoptosis and cell death. To explore whether FASE RNAi causes a selective growth disadvantage to cancer cells expressing high levels of FASE, we wanted to evaluate the effects of FASE RNAi in a control line with low levels of FASE expression. Unfortunately, all tumor lines tested and even subcultures of normal prostate epithelial cells [as prepared in our laboratory (33) or as supplied by BioWhittaker] displayed high FASE activity. Subcultures from nonmalignant human fibroblasts, however, were found to have a level of FASE activity 10 times lower than that observed in LNCaP. Interestingly, in these fibroblasts, siRNA-targeting FASE still reduced FASE activity, but this reduction did not result in growth inhibition and apoptosis. These data support the contention that FASE RNAi-mediated growth inhibition, and apoptosis is selective for cancer cells with high levels of FASE expression.
The mechanisms by which FASE silencing selectively reduces growth and provokes apoptosis in tumor cells certainly merit additional investigation. The finding that the majority of the radiolabeled acetate incorporated in the lipid fraction goes to phospholipids and that suppression of FASE expression has major effects on the production of these phospholipids is compatible with a role of FASE in the synthesis of membranes required for proliferation. If membrane synthesis were the only site of action, however, growth reduction would also have been expected in fibroblast cultures, unless membrane synthesis in these cells is less dependent on FASE. The selective occurrence of growth inhibition and apoptosis in cell lines expressing high levels of FASE and the observation that in tumor cells FASE overexpression is part of a more general activation of lipogenic gene expression rather point to the alternative possibility that inhibition of FASE expression promotes accumulation of toxic intermediary metabolites such as malonyl-CoA as observed with chemical inhibitors of FASE activity (22 , 34 , 35) .
Taken together, RNAi-mediated silencing of the FASE gene definitely establishes FASE as a potential target for antineoplastic therapy. Moreover, RNAi provides a novel, convenient, and selective way to interfere with FASE expression and to study the role of FASE in cancer cell biology. The feasibility of RNAi-mediated gene silencing as a novel tool to arrest tumor growth and to kill cancer cells is being tested in several laboratories, and initial results are certainly promising (36, 37, 38, 39) . Additional success will depend on the development of (cell-selective) vector systems able to deliver RNAi-inducing sequences in tumor cells.
|
FOOTNOTES |
|---|
1 Supported by cancer research grants from FB Insurance (Fortis Bank) and VIVA, by a grant from the Geconcerteerde Onderzoeksactie van de Vlaamse Gemeenschap, by research grants from the Fund for Scientific Research-Flanders (Belgium) (FWO), and by a grant Interuniversity Poles of Attraction Programme-Belgian State, Prime Minister’s Office, Federal Office for Scientific, Technical and Cultural Affairs. 
2 To whom requests for reprints should be addressed, at Laboratory for Experimental Medicine and Endocrinology, Gasthuisberg, O&N9, K. U. Leuven, Herestraat 49, B-3000, Leuven, Belgium. Phone: 32-16-34-59-70; Fax: 32-16-34-59-34; E-mail: johan.swinnen{at}med.kuleuven.ac.be
3 The abbreviations used are: FASE, fatty acid synthase; LNCaP, lymph node carcinoma of the prostate; RNAi, RNA interference, siRNA, small interfering RNA; EGFP, enhanced green fluorescent protein.
Received 12/ 9/02. Accepted 5/ 1/03.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. Tamura, A. Makino, F. Hullin-Matsuda, T. Kobayashi, M. Furihata, S. Chung, S. Ashida, T. Miki, T. Fujioka, T. Shuin, et al. Novel Lipogenic Enzyme ELOVL7 Is Involved in Prostate Cancer Growth through Saturated Long-Chain Fatty Acid Metabolism Cancer Res., October 15, 2009; 69(20): 8133 - 8140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Migita, S. Ruiz, A. Fornari, M. Fiorentino, C. Priolo, G. Zadra, F. Inazuka, C. Grisanzio, E. Palescandolo, E. Shin, et al. Fatty Acid Synthase: A Metabolic Enzyme and Candidate Oncogene in Prostate Cancer J Natl Cancer Inst, April 1, 2009; 101(7): 519 - 532. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Knowles, C. Yang, A. Osterman, and J. W. Smith Inhibition of Fatty-acid Synthase Induces Caspase-8-mediated Tumor Cell Apoptosis by Up-regulating DDIT4 J. Biol. Chem., November 14, 2008; 283(46): 31378 - 31384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Migita, T. Narita, K. Nomura, E. Miyagi, F. Inazuka, M. Matsuura, M. Ushijima, T. Mashima, H. Seimiya, Y. Satoh, et al. ATP Citrate Lyase: Activation and Therapeutic Implications in Non-Small Cell Lung Cancer Cancer Res., October 15, 2008; 68(20): 8547 - 8554. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Uddin, A. K. Siraj, M. Al-Rasheed, M. Ahmed, R. Bu, J. N. Myers, A. Al-Nuaim, S. Al-Sobhi, F. Al-Dayel, P. Bavi, et al. Fatty Acid Synthase and AKT Pathway Signaling in a Subset of Papillary Thyroid Cancers J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 4088 - 4097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhan, N. Ginanni, M. R. Tota, M. Wu, N. W. Bays, V. M. Richon, N. E. Kohl, E. S. Bachman, P. R. Strack, and S. Krauss Control of Cell Growth and Survival by Enzymes of the Fatty Acid Synthesis Pathway in HCT-116 Colon Cancer Cells Clin. Cancer Res., September 15, 2008; 14(18): 5735 - 5742. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ross, A. M. Najjar, M. Sankaranarayanapillai, W. P. Tong, K. Kaluarachchi, and S. M. Ronen Fatty acid synthase inhibition results in a magnetic resonance-detectable drop in phosphocholine Mol. Cancer Ther., August 1, 2008; 7(8): 2556 - 2565. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Accioly, P. Pacheco, C. M. Maya-Monteiro, N. Carrossini, B. K. Robbs, S. S. Oliveira, C. Kaufmann, J. A. Morgado-Diaz, P. T. Bozza, and J. P.B. Viola Lipid Bodies Are Reservoirs of Cyclooxygenase-2 and Sites of Prostaglandin-E2 Synthesis in Colon Cancer Cells Cancer Res., March 15, 2008; 68(6): 1732 - 1740. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Liu, Y. Liu, and J.-T. Zhang A new mechanism of drug resistance in breast cancer cells: fatty acid synthase overexpression-mediated palmitate overproduction Mol. Cancer Ther., February 1, 2008; 7(2): 263 - 270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Orita, J. Coulter, C. Lemmon, E. Tully, A. Vadlamudi, S. M. Medghalchi, F. P. Kuhajda, and E. Gabrielson Selective Inhibition of Fatty Acid Synthase for Lung Cancer Treatment Clin. Cancer Res., December 1, 2007; 13(23): 7139 - 7145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Beckers, S. Organe, L. Timmermans, K. Scheys, A. Peeters, K. Brusselmans, G. Verhoeven, and J. V. Swinnen Chemical Inhibition of Acetyl-CoA Carboxylase Induces Growth Arrest and Cytotoxicity Selectively in Cancer Cells Cancer Res., September 1, 2007; 67(17): 8180 - 8187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Brusselmans, L. Timmermans, T. Van de Sande, P. P. Van Veldhoven, G. Guan, I. Shechter, F. Claessens, G. Verhoeven, and J. V. Swinnen Squalene Synthase, a Determinant of Raft-associated Cholesterol and Modulator of Cancer Cell Proliferation J. Biol. Chem., June 29, 2007; 282(26): 18777 - 18785. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Zhou, W. F. Han, L. E. Landree, J. N. Thupari, M. L. Pinn, T. Bililign, E. K. Kim, A. Vadlamudi, S. M. Medghalchi, R. El Meskini, et al. Fatty Acid Synthase Inhibition Activates AMP-Activated Protein Kinase in SKOV3 Human Ovarian Cancer Cells Cancer Res., April 1, 2007; 67(7): 2964 - 2971. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Priolo, D. Tang, M. Brahamandan, B. Benassi, E. Sicinska, S. Ogino, A. Farsetti, A. Porrello, S. Finn, J. Zimmermann, et al. The Isopeptidase USP2a Protects Human Prostate Cancer from Apoptosis. Cancer Res., September 1, 2006; 66(17): 8625 - 8632. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Lupu and J. A. Menendez Targeting Fatty Acid Synthase in Breast and Endometrial Cancer: An Alternative to Selective Estrogen Receptor Modulators? Endocrinology, September 1, 2006; 147(9): 4056 - 4066. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. P. Kuhajda Fatty Acid synthase and cancer: new application of an old pathway. Cancer Res., June 15, 2006; 66(12): 5977 - 5980. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bandyopadhyay, R. Zhan, Y. Wang, S. K. Pai, S. Hirota, S. Hosobe, Y. Takano, K. Saito, E. Furuta, M. Iiizumi, et al. Mechanism of Apoptosis Induced by the Inhibition of Fatty Acid Synthase in Breast Cancer Cells Cancer Res., June 1, 2006; 66(11): 5934 - 5940. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Chajes, M. Cambot, K. Moreau, G. M. Lenoir, and V. Joulin Acetyl-CoA Carboxylase {alpha} Is Essential to Breast Cancer Cell Survival. Cancer Res., May 15, 2006; 66(10): 5287 - 5294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Liu, Y. Shi, V. L. Giranda, and Y. Luo Inhibition of the phosphatidylinositol 3-kinase/Akt pathway sensitizes MDA-MB468 human breast cancer cells to cerulenin-induced apoptosis. Mol. Cancer Ther., March 1, 2006; 5(3): 494 - 501. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Moreau, E. Dizin, H. Ray, C. Luquain, E. Lefai, F. Foufelle, M. Billaud, G. M. Lenoir, and N. D. Venezia BRCA1 Affects Lipid Synthesis through Its Interaction with Acetyl-CoA Carboxylase J. Biol. Chem., February 10, 2006; 281(6): 3172 - 3181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lee, J. Chen, G. Zhou, R. Z. Shi, G. G. Bouffard, M. Kocherginsky, X. Ge, M. Sun, N. Jayathilaka, Y. C. Kim, et al. Gene expression profiles in acute myeloid leukemia with common translocations using SAGE PNAS, January 24, 2006; 103(4): 1030 - 1035. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Brusselmans, E. De Schrijver, G. Verhoeven, and J. V. Swinnen RNA Interference-Mediated Silencing of the Acetyl-CoA-Carboxylase-{alpha} Gene Induces Growth Inhibition and Apoptosis of Prostate Cancer Cells Cancer Res., August 1, 2005; 65(15): 6719 - 6725. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. V. Swinnen, A. Beckers, K. Brusselmans, S. Organe, J. Segers, L. Timmermans, F. Vanderhoydonc, L. Deboel, R. Derua, E. Waelkens, et al. Mimicry of a Cellular Low Energy Status Blocks Tumor Cell Anabolism and Suppresses the Malignant Phenotype Cancer Res., March 15, 2005; 65(6): 2441 - 2448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Brusselmans, R. Vrolix, G. Verhoeven, and J. V. Swinnen Induction of Cancer Cell Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity J. Biol. Chem., February 18, 2005; 280(7): 5636 - 5645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Menendez, L. Vellon, I. Mehmi, B. P. Oza, S. Ropero, R. Colomer, and R. Lupu Inhibition of fatty acid synthase (FAS) suppresses HER2/neu (erbB-2) oncogene overexpression in cancer cells PNAS, July 20, 2004; 101(29): 10715 - 10720. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. V. Stewart and N. L. Weigel Vitamin D and Prostate Cancer Experimental Biology and Medicine, April 1, 2004; 229(4): 277 - 284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Kridel, F. Axelrod, N. Rozenkrantz, and J. W. Smith Orlistat Is a Novel Inhibitor of Fatty Acid Synthase with Antitumor Activity Cancer Res., March 15, 2004; 64(6): 2070 - 2075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Fan, P. Tam, G. V. Woude, and Y. Ren Normalization and analysis of cDNA microarrays using within-array replications applied to neuroblastoma cell response to a cytokine PNAS, February 3, 2004; 101(5): 1135 - 1140. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Zhou, P. J. Simpson, J. M. McFadden, C. A. Townsend, S. M. Medghalchi, A. Vadlamudi, M. L. Pinn, G. V. Ronnett, and F. P. Kuhajda Fatty Acid Synthase Inhibition Triggers Apoptosis during S Phase in Human Cancer Cells Cancer Res., November 1, 2003; 63(21): 7330 - 7337. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
