| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Synuclein1
Department of Radiation Oncology, Long Island Jewish Medical Center, The Long Island Campus for the Albert Einstein College of Medicine, New Hyde Park, New York 11040 [Y. J., Y. E. L., I. D. G., Y. E. S.], and Veterans Affairs Palo Alto Health Care System, Palo Alto, California 94304 [A. L., A. G., J. L.]
| ABSTRACT |
|---|
|
|
|---|
Synuclein (SNCG) is also highly associated with breast cancer and ovarian cancer progression. Whereas most studies of this group of proteins have been directed to the elucidation of their role in the formation of depositions in brain tissue, the normal cellular function of this highly conserved synuclein family remains largely unknown. A notable finding in this study is that SNCG, identified previously as a breast cancer-specific gene 1, strongly stimulated the ligand-dependent transcriptional activity of estrogen receptor-
(ER-
) in breast cancer cells. Augmentation of SNCG expression stimulated transcriptional activity of ER-
, whereas compromising endogenous SNCG expression suppressed ER-
signaling. The SNCG-stimulated ER-
signaling was demonstrated in three different cell systems including ER-
-positive and SNCG-negative MCF-7 cells, ER-
-positive and SNCG-positive T47D cells, and SNCG-negative and ER-
-negative MDA-MB-435 cells. The SNCG-mediated stimulation of ER-
transcriptional activity is consistent with its stimulation of the ligand-dependent cell growth. Whereas overexpression of SNCG stimulated the ligand-dependent cell proliferation, suppression of endogenous SNCG expression significantly inhibited cell growth in response to estrogen. The stimulatory effect of SNCG on ER
-regulated gene expression and cell growth can be effectively inhibited by antiestrogens. These data indicate that SNCG is required for efficient ER-
signaling and, thus, stimulated hormone-responsive mammary tumors. | Introduction |
|---|
|
|
|---|
We have reported previously the isolation of differentially expressed genes in the cDNA libraries from normal breast and infiltrating breast cancer using differential cDNA sequencing approach (8
, 14)
. Of many putative differentially expressed genes, a breast cancer-specific gene, BCSG1, was identified as a putative breast cancer-specific gene, which was highly expressed in a breast cancer cDNA library but scarcely in a normal breast cDNA library (8)
. Interestingly, BCSG1 revealed no homology to any other known growth factors or oncogenes; rather, BCSG1 revealed extensive sequence homology to neural protein synuclein, having 54% and 56% sequence identity with SNCA and SNCB, respectively. Subsequent to the isolation of BCSG1, synuclein
(13)
and persyn (15)
were cloned independently from a brain genomic library and a brain cDNA library. In fact, BCSG1, SNCG, and persyn appear to be the same protein. Thus, the previously identified BCSG1, which is also highly expressed in brain, has been renamed as SNCG (16)
.
Although synucleins are abundant proteins expressed in presynaptic terminals and tightly associated with amyloid plaque in AD and Lewy body in PD, the normal cellular function of this highly conserved synuclein family remains largely unknown. Being identified as a breast cancer-specific gene, SNCG expression in breast follows a stage-specific manner: SNCG was undetectable in normal or benign breast lesions, showed partial expression in ductal carcinoma in situ, but expressed at an extremely high level in advanced infiltrating breast cancer (8
, 11)
. Overexpression of SNCG in cancer cells led to significant increase in cell motility and invasiveness in vitro, profound augmentation of metastasis in vivo (9)
, and resistance to chemotherapeutic drug-induced apoptosis (17)
. Overexpression of synucleins, especially SNCG and SNCB, also correlated with ovarian cancer development (11
, 13)
. Whereas synuclein (
, ß, and
) expression was not detectable in normal ovarian epithelium, 87% (39 of 45) of ovarian carcinomas were found to express either SNCG or SNCB, and 42% (19 of 45) expressed all three of the synucleins (
, ß, and
) simultaneously (11)
. The involvement of SNCG in hormone-responsive cancers of breast and ovary prompted us to explore the potential role of SNCG in cellular response to estrogen. In the present study, we evaluated the biological functions of SNCG on regulation of estrogen-receptor transcriptional activity in human breast cancer cells. The results suggest that one of the critical functions of SNCG on breast cancer pathogenesis is to stimulate ER-
transcriptional activity.
| Materials and Methods |
|---|
|
|
|---|
transcriptional activity.
Gene Transfection.
Subconfluent proliferating cells in 12-well plate were incubated with 2 µg of expression vectors in 1 ml of serum-free IMEM containing LipofectAMINE for 5 h. Culture was washed to remove the excess vector and LipofecTAMINE, and then postincubated for 24 h in fresh culture medium to allow the expression of transfected gene.
Assays for the Transcriptional Activity of ER-
.
Cells were transiently transfected with a firefly luciferase reporter construct (pERE4-Luc) containing four copies of the ERE (18)
. For the cotransfection experiments, the plasmid DNA ratio of pERE4Luc to expression vectors of ER-
or SNCG was 2:1. A renilla luciferase reporter, pRL-SV40-Luc, was used as an internal control for transfection efficiency. Luciferase activities in total cell lysate were measured using the Promega Dual Luciferase Assay System. Absolute ERE promoter firefly luciferase activity was normalized against renilla luciferase activity to correct for transfection efficiency. Triplicate wells were assayed for each transfection condition, and at least three independent transfection assays were performed.
RT-PCR Analysis.
MCF-7-derived cells were cultured in ligand-free medium for at least 5 days, and treated with 10-9 M E2 for 4 h as indicated. Total RNA from cells were isolated using RNeasy Kit (Qiagen Inc.). Approximately 4 µg of total RNA was subjected to semiquantitative RT-PCR analysis following a procedure described previously for estrogen-responsive genes (19
, 20)
. The primer sequences (5'-3') are as follows: TGF-
, sense CGCCCTGTTCGCTCTGGGTAT, antisense AGGAGGTCCGCATGCTCACAG (240-bp product); cathepsin-D, sense CCAGCCCCCAATCCCAACCCCACCTCCAG, antisense ACTGAAGCTGGGAGGCAAAGGCTACAAGC (842-bp product); and PS2, sense CATGGAGAACAAGGTGATCTG, antisense CAGAAGCGTGTCTGAGGTGTC (336-bp product).
Stable Expression of SNCG Antisense mRNA in T47D Cells.
A 285-bp DNA fragment corresponding to the exon 1 region (-169 to +116) of SNCG gene was amplified from the plasmid pBS-SNCG759 and was cloned into the EcoRI site of the expression vector pcDNA3.1. The antisense or sense orientation of the exon 1 in the pcDNA3.1 vector was determined by restriction enzyme digestion and was verified by DNA sequencing. Vectors expressing SNCG antisense mRNA (pcDNA-SNCG-As) or SNCG sense mRNA (pcDNA-SNCG-S) were transfected separately into T47D cells by Effectin reagent. Isolated clones were picked up after G418 selection. The expression of SNCG antisense and sense mRNAs (285 bp) in the individual clones was confirmed by RT-PCR reaction. For antisense mRNA, the primer sets are: T7 as the forward primer, 5' TAATACGACTCACTATAGGG 3' and SNCG-Wf as the reverse primer, ACGCAGGGCTGGCTGGGCTCCA. The primer sets for detection of sense mRNA are: T7 as the forward primer, 5' TAATACGACTCACTATAGGG 3' and SNCG-Wr as the reverse primer, 5' CCTGCTTGGTCTTTTCCACC 3'.
Cell Proliferation Assay.
For [3H]thymidine incorporation, cells were cultured and synchronized in the conditioned medium for 4 days as described in "Conditioned Cell Culture." Cells were treated with or without 1 nM of E2 for 24 h. [3H]Thymidine was added 12 h before harvesting. [3H]Thymidine incorporation was determined by precipitation with 10% trichloroacetic acid followed by liquid scintillation counting. Triplicate wells were assayed for each cellular proliferation condition, and at least three independent assays were performed. Cell growth was also measured using a cell proliferation kit (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt; Roche Molecular Biochemicals, Indianapolis, IN). Briefly, exponentially growing cells were seeded in quadruplicate at 1500 cells per well (96-well plate) in the conditioned medium. Cells were treated with indicated chemicals for 6 days before harvesting.
Soft Agar Colony Formation Assay.
The anchorage-independent growth was carried out in 12-well plates as we described previously (10)
. The bottom layer consists of 0.5 ml of 5% charcoal-striped calf serum/IMEM containing 0.6% agar. The top layer consists of 0.25 ml of 5% charcoal-striped calf serum/IMEM containing 0.4% agar and
2000 cells. In the E2-treated groups, the top layer also contains 1 nM of E2. Cells were cultured under high humidity condition. Cells were fed with 0.1 ml of culture medium with or without E2 every 4 days. After 2 weeks, the number of colonies in each well was counted under a Nikon microscope at x100 amplification. Triplicate wells were assayed for each condition.
| Results |
|---|
|
|
|---|
.
and ER-ß (21
, 22)
. Because ER-
is the major ER in mammary epithelia, we measured the effect of SNCG on modulating the transcriptional activity of ER-
in human breast cancer cells. We first selected ER
-positive and SNCG-negative MCF-7 cells as recipients for SNCG transfection (Fig. 1, A and B)
expression under the conditions both with and without E2 (Fig. 1A)
on control and SNCG-transfected cells are the same. Although treatment of the control cells with E2 resulted in a significant decrease in ER-
level, overexpression of SNCG did not affect E2-mediated degradation of ER-
. Transfection of SNCG significantly stimulated E2-mediated activation of ER-
(Fig. 1B)
was ligand-dependent, because SNCG had no significant effect on the transcriptional activity of ER-
in the absence of E2.
|
, SNCG also stimulated E2-regulated genes in MCF-7 cells (Fig. 2)
in the absence of E2, transcription of Cat-D, PS2, and TGF-
were increased 3.9-fold, 3.2-fold, and 4.2-fold in SNCG transfected cells versus control cells in the presence of E2, respectively (Fig. 2A)
-regulated genes, we treated the cells with an antiestrogen ICI. As demonstrated in Fig. 2B
.
|
in ER
-negative and SNCG-negative MDA-MB-435 breast cancer cells (Fig. 3)
-transfected MDA-MB-435 cells with E2 activated reporter activity, indicating the functional transcriptional activity of the transfected ER-
gene. A significant stimulation of ER-
signaling by SNCG was observed in MDA-MB-435 cells when the cells were cotransfected with ER-
and SNCG constructs. SNCG increased ligand-dependent transcriptional activity 3.7-fold over the control cells.
|
.
transactivation was additionally demonstrated by inhibiting endogenous SNCG expression with SNCG antisense mRNA in T47D cells that express high levels of SNCG (8)
. Stable transfection of the SNCG antisense construct into T47D cells significantly reduced SNCG expression to 25% of that in control T47D cells (Fig. 4A)
in SNCG antisense-transfected T47D cells indicated that SNCG stimulated ligand-dependent transcriptional activity of ER-
.
|
signaling, we analyzed the effect of SNCG overexpression on the growth of breast cancer cells. To determine whether SNCG overexpression affects ligand-dependent or ligand-independent cell growth, the cellular proliferation of the previously established two stable SNCG-transfected MCF-7 cell clones, MCF-SNCG2 and MCF-SNCG6, were compared with that of SNCG-negative cells, MCF-neo1 and MCF-neo2 (10)
. Data in Fig. 5A
, we investigated the effect of the antiestrogen tamoxifen and ICI. As shown in Fig. 5B
.
|
-negative MDA-MB-435 cells (9)
.
|
| Discussion |
|---|
|
|
|---|
. Here we reported that SNCG strongly stimulated the ligand-dependent transcriptional activity of ER-
. Whereas SNCG overexpression stimulated transcriptional activity of ER-
, compromising SNCG expression suppressed ER-
signaling. The SNCG-stimulated ER-
signaling was demonstrated in three different cell systems including: (a) overexpression of SNCG in ER-
-positive and SNCG-negative MCF-7 cells; (b) antisense blocking SNCG expression in ER-
-positive and SNCG-positive T47D cells; and (c) cotransfection of SNCG and ER-
into SNCG-negative and ER-
-negative MDA-MB-435 cells. The results shown in this report demonstrated that human ER-
requires SNCG for efficient transcriptional activity.
The SNCG-mediated stimulation of ER-
transcriptional activity is consistent with its stimulation of the ligand-dependent cell growth. It has been demonstrated in different systems that the interaction between SNCG and ER-
stimulated cell growth. First, whereas expression of SNCG in MCF-7 cells had no effect on the cell growth in the absence of E2, SNCG significantly stimulated the ligand-dependent cell growth, which can be blocked by antiestrogens. This growth stimulation was also demonstrated previously in the anchorage-independent growth assay (10)
. Second, when endogenous SNCG expression in T47D cells was blocked by expressing SNCG antisense mRNA, the anchorage-independent growth in response to E2 was significantly suppressed in the cells expressing antisense SNCG. Third, although the alternation of SNCG expression affected the cell growth of ER-
-positive MCF-7 and T47D cells, it had no effect on the cell growth of ER-
-negative MDA-MB-435 cells (9)
. Consistent with the requirement of E2 for SNCG-stimulated cell growth, we also demonstrated previously that SNCG has no significant effect on tumor growth of ER-
-negative MDA-MB-435 cells (9)
.
To acquire the ability to bind hormone, steroid hormone receptors undergo a series of transformation steps in which they are brought into the correct conformation by molecular chaperones and cochaperones. The most extensively studied chaperones for steroid receptors are a multiprotein Hsp70- and Hsp90-based chaperone system, which includes Hsp90, Hsp70, Hop, Hsp40, and p23 (21, 22, 23)
. Hsp70 and Hsp90 associate with the unliganded steroid hormone receptors, and maintain the conformational state for efficient ligand binding and receptor activation (21
, 23)
. Interestingly, the chaperone-like activity has been suggested for synucleins based on the cell-free system (24)
. However, the molecular targets for synuclein-mediated chaperone activity remain to be identified. It is likely that SNCG is a new member of molecular chaperone proteins that participate in Hsp-based chaperone complex for regulating ER-
activity. Studies are under way to investigate the mechanism by which SNCG regulates ER-
signaling.
Like SNCA of which the mutations have been detected in several cases of familial PD (1)
, mutations of SNCG could be linked to the development of breast carcinomas. However, after analysis of a number of breast tumors and breast cancer cell lines, it was found that the malignant phenotype correlated with the high level expression of wild-type SNCG protein (8
, 11
, 15)
. Moreover, in addition to the absence of mutation, SNCG gene amplification was also not detected in breast tumors (15)
. To elucidate the molecular mechanisms underlying the abnormal transcription of SNCG in breast cancer cells, we isolated a 2195-bp promoter fragment of human SNCG gene and demonstrated that demethylation of exon 1 region of SNCG gene is an important factor responsible for the aberrant expression of SNCG in breast carcinomas (12)
. However, the molecular targets of SNCG aberrant expression for breast cancer have not been identified. Here we demonstrated ER-
as one of the critical target molecules for the action of SNCG in breast cancer pathogenesis. Thus, aberrant expression of SNCG stimulates breast cancer growth and progression, at least in part, by enhancing the transcriptional activity of ER-
. The role of SNCG in breast cancer progression may also be involved in non-ER-mediated functions such as stimulation of tumor motility and metastasis as we described previously in hormone-independent breast cancer cells (9)
.
The preventive effect of estrogen on AD has become clear with epidemiological data, suggesting that estrogen may act as a neuroprotectant against the neurodegenerative diseases (25, 26, 27, 28)
. The cellular functions of synucleins remain elusive. The demonstration of ER-
as the critical target for SNCG may indicate a new direction of normal cellular function of synucleins. In this regard, SNCG-mediated stimulation of ER-
signaling not only supports its pathological role in the growth of steroid-responsive tumors, but may also shed some light on the cellular functions of synucleins in brain cells and their complex roles in the development of neurodegenerative disorders.
| FOOTNOTES |
|---|
1 This study was supported in part by Grant 99-028-04-CCE from American Cancer Society, Grants DAMD17-98-1-8118 and DAMD17-01-1-0352 from the United States Army Medical Research and Development Command, Grant from the Department of Veterans Affairs (Office of Research and Development, Medical Research Service), and by Grant 1RO1CA83648-01 from National Cancer Institute. ![]()
2 To whom requests for reprints should be addressed, at Department of Radiation Oncology, Long Island Jewish Medical Center, New Hyde Park, NY 11040. Phone: (718) 470-3086; Fax: (718) 470-9756; E-mail: shi{at}lij.edu ![]()
3 The abbreviations used are: SNCA,
synuclein; AD, Alzheimers disease; BCSG1, breast cancer specific gene 1; ER, estrogen receptor; Cat-D, cathepsin D; Hsp, heat shock protein; PD, Parkinsons disease; PR, progesterone receptor; SNCB, ß synuclein; SNCG,
synuclein; ERE, estrogen response element; RT-PCR, reverse transcription-PCR; E2, 17ß-estradiol; TGF, transforming growth factor; ERE4-Luc, ERE4-Luciferase; ICI, ICI 182,780. ![]()
Received 11/19/02. Accepted 6/ 2/03.
| REFERENCES |
|---|
|
|
|---|
-Synuclein in Lewy bodies. Nature (Lond.), 388: 839-840, 1997.[Medline]
This article has been cited by other articles:
![]() |
M. N. Singh, H. F. Stringfellow, S. E. Taylor, K. M. Ashton, M. Ahmad, K. R. Abdo, O. M.A. El-Agnaf, P. L. Martin-Hirsch, and F. L. Martin Elevated expression of CYP1A1 and {gamma}-SYNUCLEIN in human ectopic (ovarian) endometriosis compared with eutopic endometrium Mol. Hum. Reprod., November 1, 2008; 14(11): 655 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ahmad, S. Attoub, M. N. Singh, F. L. Martin, and O. M. A. El-Agnaf {gamma}-Synuclein and the progression of cancer FASEB J, November 1, 2007; 21(13): 3419 - 3430. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujita, S. Sugama, M. Nakai, T. Takenouchi, J. Wei, T. Urano, S. Inoue, and M. Hashimoto {alpha}-Synuclein Stimulates Differentiation of Osteosarcoma Cells: RELEVANCE TO DOWN-REGULATION OF PROTEASOME ACTIVITY J. Biol. Chem., February 23, 2007; 282(8): 5736 - 5748. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Singh, Y. Zhou, J. A. Marsh, V. N. Uversky, J. D. Forman-Kay, J. Liu, and Z. Jia Synuclein-{gamma} Targeting Peptide Inhibitor that Enhances Sensitivity of Breast Cancer Cells to Antimicrotubule Drugs Cancer Res., January 15, 2007; 67(2): 626 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, W. Liu, Y. Wu, Y. Zhou, R. Xue, C. Luo, L. Wang, W. Zhao, J.-D. Jiang, and J. Liu Loss of Epigenetic Control of Synuclein-{gamma} Gene as a Molecular Indicator of Metastasis in a Wide Range of Human Cancers Cancer Res., September 1, 2005; 65(17): 7635 - 7643. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jiang, Y. E. Liu, I. D. Goldberg, and Y. E. Shi {gamma} Synuclein, a Novel Heat-Shock Protein-Associated Chaperone, Stimulates Ligand-Dependent Estrogen Receptor {alpha} Signaling and Mammary Tumorigenesis Cancer Res., July 1, 2004; 64(13): 4539 - 4546. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |