| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Cancer Research UK Oncology Unit, Cancer Sciences Division, University of Southampton School of Medicine, Southampton General Hospital, Southampton S016 6YD, United Kingdom
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
|
BAG-1 also interacts with the proteasome and has been suggested to act as bridge to link chaperone molecules with the proteasome, the major nonlysosomal protease in cells (29 , 30) . Although precise protein regions required for interaction are not known, binding does require the BAG-1S NH2 terminus that contains a ULD, similar to ubiquitin and the ULD found in other proteins such as Rad23 (10 , 31) . The Rad23 ULD mediates binding to the proteasome, strongly suggesting that BAG-1 binding to the proteasome is also mediated via its ULD. Although BAG-1 NH2-terminal deletions inactivate the survival functions of BAG-1 (12 , 23) , the role of specific amino acid residues within the ULD has not been determined.
BAG-1 expression is frequently altered in human cancer (2 , 32, 33, 34, 35, 36) . In breast cancer, overexpression of nuclear or cytoplasmic BAG-1 protein has been detected in the majority of cases, and this can correlate with clinicopathological features and clinical outcome (2 , 32, 33, 34) . Elevated levels of cytoplasmic BAG-1 expression are associated with improved prognosis in early-stage breast cancer independent of nodal status, suggesting that BAG-1 may have clinical utility as a prognostic marker (33) . We have also shown that nuclear BAG-1 expression is associated with improved survival in patients treated with hormonal therapy.5 By contrast, Tang et al. (34) demonstrated that increased expression of BAG-1 was associated with a poorer outcome. These findings suggest that BAG-1 overexpression plays an important role in the development and response to therapy in breast cancer.
Despite these encouraging findings, the functional consequences and mechanism of action of BAG-1 in breast cancer cells have not been studied in detail. Here we demonstrate that BAG-1 overexpression has profound effects on the long-term survival of breast cancer cells exposed to cellular stresses, mediated via interaction with chaperone molecules.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cells were exposed to stress by heat shocking [42°C for 1 h in a Hybaid Micro-4 microhybridization oven (Hybaid)], hypoxia [24 h, <0.1% O2 using an anaerobic chamber (Oxoid, Basingstoke, United Kingdom)], or ionizing radiation (4 Gy). Cells were exposed to chemotoxic drugs [cisplatin (10 µg/ml), paclitaxel (1.6 nM), doxorubicin (50 nM), etoposide (50 nM), or vincristine (1.6 nM)] for 24 h. These "levels" of stress (i.e., temperature, time of hypoxia, amount of radiation, and concentration of cytotoxic drug) were selected to give approximately equivalent levels of growth reduction (7090%) in long-term clonogenic assays. Cells were allowed to recover at 37°C after heat shock, or after washing to remove drugs, before analysis.
Long-term Growth Assays.
Long-term growth assays were performed in two ways, using MCF7 cell-derived clones stably overexpressing BAG-1S or after transient transfection of BAG-1 isoform or mutant expression constructs. In the first assay, stably transfected BAG-1S-overexpressing or pcDNA3 control clones were exposed to heat shock, allowed to recover for at least 16 h, and then serially diluted 10-fold in 24-well plates. Cells were cultured for 2128 days to allow colonies to form. In the second assay, parental MCF7 cells were transfected with control or BAG-1 expression constructs and allowed to recover overnight. Transfected cells were then exposed to heat shock, hypoxia, radiation, or chemotoxic drugs; allowed to recover for at least 16 h; and then serially diluted 10-fold in 24-well plates. Cells were cultured for 2128 days (in the presence of G418 to eliminate untransfected cells) to allow colonies to form. Plates were rinsed with PBS and fixed for 7 min with methanol. The plates were allowed to air dry for 10 min followed by the addition of Wright-Giemsa stain (Sigma) for 3 min. The plates washed by submersion in distilled water and then allowed to air dry. Colonies were counted using a colony counter.
TRAIL-induced Apoptosis.
Cells were incubated with recombinant FLAG-tagged TRAIL (100 or 250 ng/ml) and an anti-FLAG antibody (both from Alexis Biochemicals) to enhance receptor cross-linking for 3 days. Cell viability was measured using the Cell Titre 96 Aqueous CellProliferation assay (Promega).
Fluorescence-activated Cell Sorting.
Cells were collected by trypsinization, washed in PBS, and fixed in 70% (v/v) ethanol. Fixed cells were collected by centrifugation and incubated with propidium iodide (0.05 mg/ml) and RNase A (0.1 mg/ml) in PBS for 60 min at room temperature in the dark. DNA content was determined by flow cytometry using a FacsCalibur (Becton Dickinson). The proportion of cells with sub-G1 content as a percentage of total cells was determined.
Plasmids.
Deletion and site-directed mutagenesis were used to generate pcDNA3-derived plasmids that uniquely expressed human BAG-1S, BAG-1M, or BAG-1L.5
BAG-1S deletion mutants were generated by PCR using the following primers: (a) BAG-1S89230, 5'-GCCACCATGGCACTTGGAATACAA and 5'-TGCTACACCTCACTCGGCCAGGGC; (b) BAG-1S1155, 5'- ACCCAGGGCGAAGAGATGAATCGG and 5'- TCAAGCTTCAGCTTGCAAATC; and (c) BAG-1S1132, 5'-ACCCAGGGCGAAGAGATGAATCGG and 5'-TCATGTTTCCATTTCCTTCAG. The BAG-1SK80A mutant was generated by a two-step PCR. The first step used primers 5'-ACCCAGGGCGAAGAGATGAATCGG and 5'-CTTCAGAGAAGCTCCCTTAAA to give product A and primers 5'-TTTAAGGGAGCTTCTCTGAAGGAAATGGAAACACCGTTG and 5'-TGCTACACCTCACTCGGCCAGGGC to give product B. Equal amounts of products A and B were combined and amplified with flanking primers 5'-ACCCAGGGCGAAGAGATGAATCGG and 5'-TGCTACACCTCACTCGGCCAGGGC. PCR products were TA-cloned into the pCR-TOPO vector (Invitrogen), verified by sequencing, and subcloned into pcDNA3 (Invitrogen). Wild-type mouse BAG-1S and mouse BAG-1SC204A constructs (28)
were a kind gift of Prof. Richard I. Morimoto (Northwestern University, Evanston, Chicago, IL) and express HA-epitope-tagged proteins.
Coimmunoprecipitation and Immunoblotting.
Cells were resuspended in 1 ml of HMKEN buffer [Ref. 14
; 10 mMn-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (pH 7.2), 5 mM MgCl2, 142 mM KCl, 2 mM ethylene glycol-bis(b-aminoethylether)N,N,N',N'-tetraacetic acid, 0.2% (v/v) NP40, and Protease Inhibitor Cocktail (Sigma)] by trituration through a 21-gauge needle, lysed on ice for 30 min, and clarified by centrifugation (12,000 rpm for 10 min in a microfuge). Ten percent of the lysate was retained as a whole cell (input) lysate. The remaining sample was precleared using protein G-Sepharose beads (Amersham Pharmacia Biotech) for 30 min at 4°C. Protein G-Sepharose beads were removed by centrifugation. For human BAG-1 immunoprecipitations, the lysate was divided and incubated with the BAG-1-specific rabbit polyclonal antibody TB2 (7)
or with preimmune control serum (both at 5 µl/450 µl lysate). Mouse BAG-1 was immunoprecipitated using the HA-epitope tag-specific mouse monoclonal antibody F-7 (Santa Cruz Biotechnology) or purified mouse IgG (BD PharMingen) as a control (both at 1.8 µg/µl). After 5 (mouse BAG-1) or 16 h (human BAG-1) at 4°C, the lysate was incubated with protein G-Sepharose beads for 1 h, and immunocomplexes were removed by centrifugation. The beads were washed five times using HMKEN buffer, resuspended in SDS-PAGE sample buffer, and heated at 95°C for 5 min. Subcellular fractions were prepared as described previously (7)
. All nuclear fractions contained <5% cytoplasmic contamination as measured using lactate dehydrogenase activity (data not shown).
Immunoblotting was performed as described previously (6) using mouse monoclonal antibodies 3.10 G3E2 and 3.10 G3F11 or rabbit polyclonal antibodies TB2 (7) and C-16 (Santa Cruz Biotechnology) for human BAG-1, rabbit polyclonal antibody m10 (6) for mouse BAG-1, the Hsc70-specific mouse monoclonal antibody B6 (Santa Cruz Biotechnology), Hsp70-specific mouse monoclonal (Stressgen), or the PARP-specific mouse monoclonal antibody C-20 (R&D Systems).
Immunofluorescence.
Cells were cultured overnight on FCS-coated glass coverslips, washed twice in PBS, and fixed in PBS containing 4% (w/v) paraformaldehyde for 15 min at room temperature. Cells were washed with PBS and incubated with PBS containing 10% (v/v) newborn calf serum and 0.05% (w/v) sodium azide for 20 min at 4°C. Cells were washed and permeabilized by incubation in permeabilization buffer [PBS containing 10% (v/v) newborn calf serum and 1% (v/v) Triton X-100] for 20 min at room temperature. Cells were washed and then incubated with the polyclonal anti-BAG-1 antibody TB2 (7)
diluted 1:1000 in permeabilization buffer for 20 min at room temperature. Cells were washed and incubated with 2 µg/ml FITC-conjugated antirabbit immunoglobulins (Sigma) diluted in permeabilization buffer for 1 h at room temperature. Coverslips were then washed in PBS and mounted on glass slides using Fluorescent Mounting Media (Dako). Cells were visualized on an Axiovert 100 fluorescence microscope (Zeiss).
| RESULTS |
|---|
|
|
|---|
|
We tested whether BAG-1 inhibited long-term growth inhibition induced by other cellular stresses. In this assay, parental MCF7 cells were transfected with BAG-1S expression construct or empty vector as a control. Sixteen h after transfection, cells were exposed to
-radiation, hypoxia, or chemotoxic drugs and allowed to recover overnight. Cells were then serially diluted, and the long-term growth potential of successfully transfected (i.e., G418-resistant) cells was determined. BAG-1S overexpression partially suppressed long-term growth inhibition induced by
-radiation, hypoxia, and paclitaxel, doxorubicin, etoposide, and vincristine, although to a lesser extent than heat shock (Fig. 2)
. BAG-1S did not affect growth inhibition induced by cisplatin. Therefore, the protective effects of BAG-1 are not restricted to heat shock, and BAG-1 protects cells from the growth-inhibitory effects of a wide range of cellular stresses.
|
|
We generated human BAG-1 isoform-specific expression constructs and demonstrated that the constructs expressed the expected protein products at approximately equivalent levels. Coimmunoprecipitation experiments confirmed that all BAG-1 isoforms interacted to an equivalent level with Hsc70 and Hsp70 (Fig. 4A)
. Similar to the stably transfected MCF7 clones (Fig. 1D)
, heat shock reduced the clonogenic potential of MCF7 cells transfected with pcDNA3 by approximately 90%, and this was significantly inhibited by expression of high levels of BAG-1S (Fig. 4B)
. Titration experiments using different amounts of expression constructs demonstrated that the extent of rescue was dose dependent, and the three BAG-1 isoforms were approximately equally effective in rescuing cells from growth inhibition. Consistent with the dose response observed in long-term growth assays in MCF7 cells, we demonstrated that expression of BAG-1 from the isoform expression plasmids was also titratable and equivalent between isoforms over this range of plasmid concentrations.6
These experiments were performed in HEK 293 cells, which have very low endogenous BAG-1 expression. It was not possible to perform this analysis in MCF7 cells because the relatively high levels of endogenous BAG-1 proteins masked low-level exogenous expression.
|
We tested whether the nonfunctional mutants interfered with the activity of the wild-type molecule (Fig. 5D)
. Coexpression of BAG-1S1155, BAG-1S89230, or BAG-1SK80A partially abrogated the protective effects of BAG-1S, demonstrating that they can act in a transdominant fashion to inhibit BAG-1 function. Coexpression of the mutants did not interfere with expression of wild-type BAG-1S or association with Hsc70/Hsp70 (Fig. 5, C and D)
. Interestingly, both the BAG-1S89230 and BAG-1SK80A mutants containing an intact BAG domain gave a modest decrease in the clonogenic potential of the control (nonstressed) MCF7 cells (Fig. 5B)
, suggesting that endogenous BAG-1 is important for the normal growth of these cells. This effect was reproducible but failed to reach statistical significance.
Regulation of BAG-1 Localization and Interaction after Heat Shock.
BAG-1 isoforms are differentially localized in breast cancer cells, with BAG-1S located predominantly in the cytoplasm, and BAG-1L located predominantly in the nucleus (7)
. It was surprising therefore that these isoforms were equally effective at protecting cells from stress. However, the localization of BAG-1 proteins can be regulated (1
, 38)
, and we therefore determined the effect of heat shock on BAG-1 localization in MCF7 cells. Consistent with previous reports, BAG-1S was predominantly present in the cytoplasm of control MCF7 cells (Fig. 6A)
. Although the expression of BAG-1 isoforms was not altered for up to 16 h after heat shock,6
BAG-1S relocalized from the cytoplasm to the nucleus, and after 4 h of recovery at 37°C, approximately half of the BAG-1S was detected in the nuclear fraction. As expected (39)
, Hsc70 also relocalized to the nucleus. The accumulation of endogenous BAG-1 in the nucleus after heat shock was confirmed by immunofluorescence (Fig. 6B)
. Similar results were obtained after analysis of BAG-1S-overexpressing MCF7 cell-derived clones, with nuclear accumulation of BAG-1 without alterations in expression levels.6
|
Site-directed Mutagenesis of the BAG Domain.
The BAG-1 COOH terminus interacts with Hsc/Hsp70 and Raf-1 through overlapping yet separable binding sites (28)
. To test the relative contribution of chaperones and Raf-1 binding for BAG-1 function, we used a murine BAG-1S point mutant (E208A; a kind gift of Prof. Richard I. Morimoto) that is specifically defective in binding to chaperones yet retains the ability to bind and activate Raf-1 (28)
. If BAG-1 promotes growth via Raf-1, one would expect this mutant to be active or possibly hyperactive because it would not be subject to negative regulation by Hsc/Hsp70. In contrast, if Hsc/Hsp70 binding is essential for BAG-1 function, then this mutant would be nonfunctional. Similar to human BAG-1S, mouse BAG-1S effectively suppressed long-term growth inhibition (Fig. 7A)
. By contrast, the BAG-1S COOH-terminal point mutant was completely inactive, although it was expressed at equivalent levels (Fig. 7B)
. The failure of this protein to interact with Hsc70 was confirmed in coimmunoprecipitation experiments in MCF7 cells (Fig. 7B)
. Therefore, binding to Hsc/Hsp70 is required to suppress growth inhibition. A second mouse BAG-1S mutant (C204A) deficient in chaperone binding (28)
was also unable to suppress long-term growth inhibition; however, the expression of this protein in MCF7 cells was significantly reduced compared with wild-type murine BAG-1S.6
|
| DISCUSSION |
|---|
|
|
|---|
It appears paradoxical that whereas this and other tissue culture studies demonstrate that BAG-1 prevents cell death, BAG-1 expression is associated with improved prognosis in some (32 , 33 , 36) but not all malignancies (41) . This has been discussed previously (2 , 33) and is not unique for BAG-1 because expression of Bcl-2 is also associated with improved prognosis in breast cancer. It is possible that inactivation of cell death pathways by increased expression of these proteins leads to a less aggressive tumor phenotype than other changes involving, for example, p53 mutation and/or altered growth factor receptor expression. Changes in BAG-1 expression may therefore still be important in the development of the tumors with which they are associated, although the tumors produced might have a less aggressive phenotype.
BAG-1 interferes with apoptosis induced by a wide range of factors and is considered a broadly active survival protein. However, it is important to note that in many of these studies, the effects of BAG-1 overexpression are rather modest and reflect a delay in the kinetics rather than prevention of cell death. Consistent with this, we have shown that BAG-1S overexpression has relatively modest effects on TRAIL-induced apoptosis. Like cytokine withdrawal and Fas-induced apoptosis, TRAIL-induced cell killing would not be expected to involve cell damage and/or activation of a stress response. Although additional studies are required in other cell types to determine whether this is a consistent finding, we hypothesize that stress-induced cell death pathways are the primary targets of BAG-1 in apoptosis control, although BAG-1 does impact on other cell death pathways. Consistent with this proposed primary role in controlling cellular responses to stress, translation of BAG-1S can occur by internal ribosome entry, a translation mechanism that is maintained after heat shock, in contrast to cap-dependent scanning (42) .
How does BAG-1 function to suppress the effects of stress? BAG-1 proteins have been shown to interact with a wide range of cell targets that might contribute to the survival effects of BAG-1, including the antiapoptotic Bcl-2 protein, the Raf-1 kinase, chaperone molecules, and some growth factor receptors (1, 2, 3, 4, 5 , 10 , 12 , 26) . BAG-1L and BAG-1M also interact nonspecifically with DNA through basic amino acids that form part of the NH2-terminal NLS and prevent global suppression of transcription in heat-shocked cells (38 , 43) . However, all BAG-1 isoforms were equally active in suppressing growth inhibition, suggesting that DNA binding does not play a key role. We have also shown that BAG-1 enhances estrogen-dependent transcription in breast cancer cells.5 However, only BAG-1L stimulates estrogen receptor function, thereby discounting the possibility that the effects of overexpression were due to stimulation of estrogen-dependent cell survival pathways in MCF7 cells.
Our deletion mutagenesis demonstrated that both the NH2-terminal and COOH-terminal parts of BAG-1 were required for protection from stress. The COOH-terminal BAG domain interacts with both chaperone molecules and the Raf-1 kinase, both of which have prosurvival functions and might theoretically account for the effects of BAG-1. To dissect the role of these target molecules, we used a well-characterized point mutant of mouse BAG-1S that no longer interacted with chaperones but retained the ability to bind and activate Raf-1 (28) . Although many functions of BAG-1 are suggested to be mediated by interaction with Hsc70/Hsp70, only regulation of androgen and glucocorticoid receptor function has been demonstrated to be dependent on chaperone binding (20 , 44) . Many other studies have shown a requirement of the BAG-1 COOH-terminal for survival function, however, these deletions would prevent binding to both chaperones and Raf-1. Indeed, the only study to dissect the role of these proteins suggested that BAG-1 activation of Raf-1 was negatively regulated by Hsp70, and mutants that failed to interact with chaperones were more active than the wild-type molecule in preventing heat shock-induced growth inhibition (28) . In our cell system, the mutant defective in chaperone binding failed to prevent stress-induced growth inhibition, demonstrating for the first time that the prosurvival function of BAG-1S can be mediated by interaction with chaperones. The different results obtained in breast cancer cells and fibroblasts suggest that BAG-1 has multiple mechanisms of action to overcome growth-inhibitory effects of stress and that these may be cell type dependent.
Heat shock proteins appear to be key for BAG-1 function in breast cancer cells and, in addition to protein refolding, are involved in a range of other functions including ubiquitylation. Ubiquitin is a low molecular weight protein that is attached to substrates to target them for rapid turnover via the proteasome. A series of reactions catalyzed by E1, E2, and E3 enzymes culminate in the transfer of multiple ubiquitin moieties to specific protein substrates (45) . In addition to chaperone binding, BAG-1 interacts with and regulates other components of the system, including the proteasome and E3 ligases, Siah and CHIP (5 , 29 , 30 , 46 , 47) . BAG-1 interacts with the proteasome via its NH2-terminal parts, and although the requirement for specific residues for proteasome binding is not known, we have now demonstrated that a key conserved lysine residue is essential for BAG-1 function. Thus, our data are consistent with a model whereby BAG-1 exerts its protective effects, at least in part, by coordinating the function of chaperones and the ubiquitin/proteasome system to regulate the turnover of specific protein substrates (30) . Presumably, the protein targets of BAG-1 regulated via turnover are key regulators of apoptosis and cell cycle.
It was initially surprising that the BAG-1 isoforms were functionally equivalent in protecting cells from effects of heat shock because they reside in different cellular compartments. However, we demonstrated that like chaperones and BAG-1M (38 , 39) , both endogenous and overexpressed BAG-1S relocated to the nucleus after heat shock. Therefore, although initially localized differentially, the BAG-1 isoforms may share a common site of action and substrates in the nucleus after heat shock. Surprisingly, endogenous BAG-1 and Hsc70/Hsp70 dissociated after heat shock, although the levels of BAG-1 and Hsc70 were not reduced in the nucleus of cells. We hypothesize that the BAG-1-chaperone interaction is regulated by stress signals and that a sufficiently severe "stress" leads to dissociation of BAG-1 and Hsc70/Hsp70, depriving cells of BAG-1-mediated survival functions and thereby contributing to cell death. By contrast, elevated BAG-1 levels increased BAG-1·chaperone complexes, and although they were decreased after heat shock, these complexes were still readily detectable. Thus, dynamic regulation of the BAG-1-Hsc70/Hsp70 interaction by stress signals and its perturbation by BAG-1 overexpression may play a critical role in controlling cellular response. The mechanism(s) controlling association and relocalization remains to be determined. Nuclear localization of BAG-1S is unlikely to be dependent on chaperone binding because it is maintained after dissociation but may involve a putative bipartite NLS present within BAG-1S (17) .
We also demonstrated that nonfunctional BAG-1 mutants interfered with wild-type BAG-1 function in a transdominant manner, consistent with the idea that these domains are important for protein-protein interaction. Interestingly, the growth of control MCF7 cells was consistently reduced by expression of nonfunctional BAG-1 mutants with an intact BAG domain, suggesting that activity of endogenous BAG-1 proteins is important for cell growth in breast cancer cells. BAG-1 mutants lacking the BAG domain also interfered with BAG-1 function in ZR-75-1 cells and decreased tumor size (25) .
The profound effects on the response of cells to stress-induced growth inhibition suggest that BAG-1 overexpression confers a significant growth advantage to tumor cells, allowing them to survive within a stressful nutrient-deprived and/or hypoxic tumor environment. Our results also suggest that BAG-1 plays a significant role in determining resistance of tumor cells to therapies, such as cytotoxic drugs and radiation. We have also shown that BAG-1L stimulates estrogen receptor function,5 another key pathway determining growth and response to therapy in breast cancer. Taken together, these data suggest that the high-level expression of BAG-1 observed in breast cancer is likely to have an important role in the malignant properties of these cells and that targeting the BAG-1-chaperone interaction is an attractive strategy to counter BAG-1 function in cancer cells.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by the Association for International Cancer Research, Breast Cancer Campaign, Cancer Research UK and Hope (Wessex Medical Trust). ![]()
2 Present address: Medical Molecular Biology Unit, Institute of Child Health, University College London, 30 Guildford Street, London WC1N 1EH, United Kingdom. ![]()
3 To whom requests for reprints should be addressed, at Cancer Research UK Oncology Unit, The Somers Cancer Sciences Building (MP824), University of Southampton School of Medicine, Southampton General Hospital, Southampton SO16 6YD, United Kingdom. Phone: 44-23-8079-6192; Fax: 44-23-8078-3839; E-mail: G.K.Packham{at}soton.ac.uk ![]()
4 The abbreviations used are: NLS, nuclear localization sequence; ULD, ubiquitin-like domain; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; PCNA, proliferating cell nuclear antigen; HA, hemagglutinin; PARP, poly(ADP-ribose) polymerase. ![]()
5 R. I. Cutress, P. A. Townsend, A. Sharp, A. Maison, L. Wood, R. Lee, M. Brimmell, M. A. Mullee, P. W. M. Johnson, G. T. Royle, A. C. Bateman, and G. Packham. Nuclear BAG-1 expression is associated with improved survival in breast cancer patients treated with hormonal therapy and enhances oestrogen-dependent transcription. Oncogene, in press. ![]()
6 P. Townsend, R. Cutress, and G. Packham, unpublished data. ![]()
Received 7/30/02. Accepted 5/ 8/03.
| REFERENCES |
|---|
|
|
|---|
-fodrin cleavage but dispensable for cleavage of other death substrates in apoptosis. J. Biol. Chem., 273: 15540-15545, 1998.This article has been cited by other articles:
![]() |
A. Sharp, S. J. Crabb, P. W. M. Johnson, A. Hague, R. Cutress, P. A. Townsend, A. Ganesan, and G. Packham Thioflavin S (NSC71948) Interferes with Bcl-2-Associated Athanogene (BAG-1)-Mediated Protein-Protein Interactions J. Pharmacol. Exp. Ther., November 1, 2009; 331(2): 680 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Clemo, T. J. Collard, S. L. Southern, K. D. Edwards, M. Moorghen, G. Packham, A. Hague, C. Paraskeva, and A. C. Williams BAG-1 is up-regulated in colorectal tumour progression and promotes colorectal tumour cell survival through increased NF-{kappa}B activity Carcinogenesis, April 1, 2008; 29(4): 849 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Doukhanina, S. Chen, E. van der Zalm, A. Godzik, J. Reed, and M. B. Dickman Identification and Functional Characterization of the BAG Protein Family in Arabidopsis thaliana J. Biol. Chem., July 7, 2006; 281(27): 18793 - 18801. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liman, S. Ganesan, C. P. Dohm, S. Krajewski, J. C. Reed, M. Bahr, F. S. Wouters, and P. Kermer Interaction of BAG1 and Hsp70 Mediates Neuroprotectivity and Increases Chaperone Activity Mol. Cell. Biol., May 1, 2005; 25(9): 3715 - 3725. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A Townsend, R. I. Cutress, C. J. Carroll, K. M. Lawrence, T. M. Scarabelli, G. Packham, A. Stephanou, and D. S. Latchman BAG-1 Proteins Protect Cardiac Myocytes from Simulated Ischemia/Reperfusion-induced Apoptosis via an Alternate Mechanism of Cell Survival Independent of the Proteasome J. Biol. Chem., May 14, 2004; 279(20): 20723 - 20728. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |