Cancer Research Annual Meeting 2010  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barrett, M. T.
Right arrow Articles by Rabinovitch, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barrett, M. T.
Right arrow Articles by Rabinovitch, P. S.
[Cancer Research 63, 4211-4217, July 15, 2003]
© 2003 American Association for Cancer Research


Tumor Biology

Molecular Phenotype of Spontaneously Arising 4N (G2-Tetraploid) Intermediates of Neoplastic Progression in Barrett’s Esophagus1

Michael T. Barrett2, David Pritchard, Corinna Palanca-Wessels, Judy Anderson, Brian J. Reid and Peter S. Rabinovitch3

Divisions of Human Biology [M. T. B., B. J. R., P. S. R.] and Public Health Sciences [B. J. R.], Fred Hutchinson Cancer Research Center, Seattle, Washington 98104; LifeSpan Biosciences, Seattle, Washington 98121 [D. P.]; and Departments of Medicine (Gastroenterology Division) [B. J. R.], Pathology [C. P-W., J. A., P. S. R.], and Genetics [B. J. R.], University of Washington, Seattle, Washington 98195


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Elevated 4N (G2-tetraploid) cell populations are unstable intermediates in the development of many human cancers. However, 4N cell populations are intermixed with larger diploid fractions in vivo, limiting investigation of these key intermediates of neoplastic progression. Therefore, to study elevated 4N cell populations in human neoplasia, we used flow cytometry to purify populations of spontaneously arising TP53wt and TP53mut 4N cells from cell strains derived from premalignant Barrett’s esophagus biopsies. Using oligonucleotide arrays, we identified 625 genes differentially expressed in at least one replicate 2N/4N comparison in each strain and in hTERT-immortalized cultures of the TP53mut strains. Strikingly, when hierarchically clustered, these data contained a large node of 124 genes that were up-regulated in 4N TP53mut cells in the absence of condensed chromosomes. Most of these genes function in G2-M to mediate processes such as chromosome condensation and segregation. These results describe the molecular phenotype of dysregulated G2-M functions and cell cycle checkpoints in a key intermediate of human neoplastic progression.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Neoplastic progression frequently arises as a result of an acquired genetic instability and the subsequent evolution of clonal populations with accumulated genetic lesions. This nonlinear evolutionary process typically involves the appearance of multiple cell lineages with combinations of somatic lesions. One of the most common lesions in human cancers is the development of ploidy abnormalities. Elevated 4N (G2-tetraploid) cell populations have been detected in several human neoplasias and are associated with subsequent progression in a variety of cancers (1 , 2) . We have shown that in patients with the premalignant condition BE,4 increased 4N flow-cytometric fractions (>=6%) arise interdependently with TP53 lesions in diploid cells, predict progression to aneuploidy, and have a 57% chance of progressing to cancer within 5 years (3, 4, 5, 6, 7) . However, 4N cell populations are transient intermediates and intermixed with larger diploid fractions in vivo, limiting investigation of these key intermediates of neoplastic progression. Studies in model systems have shown that elevated 4N fractions and the development of aneuploidy are associated with loss of cell cycle regulation, including lesions in the TP53 and Rb pathways, inactivation of G2-M checkpoints, and disruption of the mitotic spindle (8, 9, 10, 11, 12) . However, these studies have relied primarily on immortalized cell systems and cell cycle synchronization, which is often difficult to maintain, in order to purify 4N cells of interest (e.g., G2-M and tetraploid G1).

BE is a premalignant condition associated with chronic gastroesophageal reflux in which the normal squamous epithelium is replaced by a metaplastic columnar epithelium. Patients with BE typically have symptoms of gastroesophageal reflux such as heartburn, and they frequently seek medical attention before they develop cancer. The Barrett’s epithelium can be safely visualized and biopsied during upper gastrointestinal endoscopy, providing a highly favorable model for studying human neoplastic progression in vivo (13 , 14) . We have previously shown that diploid clones with CDKN2A lesions are early prevalent lesions in BE capable of extensive clonal expansion (15, 16, 17) . Furthermore, in the presence of somatically acquired TP53 lesions, these progenitors develop elevated 4N fractions, predisposing them to aneuploidy and to progressive clonal evolution that begins in premalignant cells, proceeds to cancer over a period of years, and continues after the emergence of cancer (5) .

Primary cultures of Barrett epithelial cells [KR-42421 (CP-A), CP-52731 (CP-B), and CP-94251 (CP-C)] have been previously established from biopsies of patients with premalignant BE (18) . Immortalized strains of primary cultures were derived by hTERT transduction to increase the number of replicate cultures and facilitate molecular studies of these cells. The Barrett epithelial cells contain CDKN2A abnormalities (9pLOH, with mutation or promoter hypermethylation in the remaining allele, CP-A, CP-B, CP-C) and TP53 abnormalities (17p LOH and mutation in the remaining allele, CP-B, CP-C). All three cultures have elevated flow cytometric 4N (G2-tetraploid) DNA content fractions (CP-A 11.6%, CP-B 24.9%, and CP-C 22.8%) in the absence of aneuploidy. These same abnormalities were also present within the esophagi from which the cell strains were derived.

To investigate the molecular phenotype of these cell populations, we have used flow cytometry to enrich for tetraploid cells in the spontaneously arising 4N populations present in each of the BE cell cultures. The number of tetraploid cells in each sorted population was determined by FISH analysis with chromosome-specific centromeric probes. We used oligonucleotide arrays to identify genes that were differentially expressed in replicate 2N/4N comparisons in each cell strain and in hTERT-immortalized cultures of the TP53mut strains. This allowed a direct comparison of 4N cell populations of interest with isogenic diploid populations in the same experiment. In addition, to further characterize the cell cycle defects in these cells, we compared the expression profiles of sorted tetraploid cells to matching isogenic G2-sorted cells. Our analyses provide a detailed description of a key intermediate in neoplastic progression.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Culture.
Cell strains were established from BE biopsies and were maintained in modified MCDB 153 as described previously (18) . The three parental strains used in this study were designated as KR-42421 (CP-A), CP-52731 (CP-B), and CP-94251 (CP-C). Two of the three cultures (CP-B and CP-C) were derived from biopsies taken from regions of high-grade dysplasia, whereas the third culture (CP-A) was initiated from biopsies taken from a region of nondysplastic metaplasia.

Flow Cytometry.
Cells were incubated in growth media containing 10 µM Hoechst 33342 (Calbiochem, La Jolla, CA) for 30 min at 37°C. Cells were subsequently trypsinized, resuspended in fresh media containing Hoechst dye, and kept at room temperature until sorting. All sorting was done using a Beckman-Coulter Elite cell sorter (Fullerton, CA).

RNA Extraction.
All samples used for RNA preparations were fixed in RNAlater (Ambion, Austin TX) before extraction. Each sample was then homogenized by resuspension in lysis solution and passage through a Qiashredder (Qiagen, Valencia, CA) column. Total RNA was extracted with the Qiagen RNeasy Mini kit using the supplier’s protocol.

cDNA Preparation.
For each sample, double-stranded cDNA was prepared with GIBCO/BRL Superscript II (Invitrogen Life Technologies, Inc., Carlsbad, CA) using 5–10 µg of total RNA as template. Subsequently, biotin-labeled cRNA was generated using the Enzo Bioarray RNA transcript-labeling kit (Affymetrix, Santa Clara, CA). All in vitro transcription reactions were carried out for 4–5 h according to the supplier’s instructions. All RNA and cRNA samples were verified by ethidium bromide-stained gel analysis and quantified by SyBrII (Molecular Probes, Eugene, OR) fluorescence.

Array Hybridization and Data Analysis.
All hybridizations were done with FL6800 chips (Affymetrix). A total of 25–50 µg of each cRNA preparation was fragmented for 35 min at 94°C in buffer [40 mM Tris-acetate (pH 8.1)/100 mM magnesium acetate]. Aliquots of each cRNA preparation were then mixed with hybridization buffer at a final volume of 200 µl. Each array was hybridized, washed, and scanned according to the manufacturer’s instructions. Scanned output files for each independent experiment were analyzed by GeneChip MAS 5.0 software (Affymetrix) and exported into the database program Microsoft Access for additional analysis. The complete set of raw data files is available on line.5 Expression values for each experiment were derived from the Affymetrix absolute difference expression values. Genes differentially expressed between 2N and 4N cells were identified as follows: 2N/4N expression ratio and log 2-transformed expression ratios were first calculated. We then selected genes to analyze by using a filter to select genes consistently differentially expressed in both independent sets of a particular 2N to 4N comparison for both samples in 1 or more of the 10 experimental comparisons. Thus, the gene had to show a consistent increase [increase (I) or marginally increase (MI)] or decrease [decrease (D) or marginally decrease (MD), using the Affymetrix MAS 5.0 differential expression calls, in both pairs of a sample (19) . The differential expression call corresponded to P of differential expression of <0.003 as generated by the MAS 5.0 software (19) . Because the replicate samples were truly independent (the cells for each pair of replicate were grown, processed, and hybridized at different times), the probability of consistent differential expression for one gene across both replicates of an experiment must be <0.00009. Because a gene was clustered if it was consistently up- or down-regulated in any 1 of the 10 replicate experiments, the expected number of observed differentially expressed genes under the null hypothesis that no genes were differentially expressed is 1 - (1 - 0.00009)10 x (analyzed experiments) x 2 x 7129 x (number of genes on the array) = 7.6 genes. In our cluster analysis, we identified 625 genes that were consistently differentially expressed between 2N/4N samples in both replicate samples from one cell line comparison. Thus, we identified many more differentially expressed genes than the expected number of false positive genes under the null hypothesis.

The log 2-transformed expression ratios for these genes were subjected to pair wise average-linkage cluster analysis with the Cluster program (Michael Eisen)6 using Pearson’s correlation as a distance metric. The log ratio used for clustering was the log ratio generated by MAS 5.0, except that in cases where MAS 5.0 called a no change (NC), the log 2 ratio was set to 0. The hierarchical tree was visualized using TreeView (M. Eisen).6 To identify genes differentially expressed in TP53wt versus TP53mut cells, clustering and data visualization followed the procedure used for the 2N/4N comparisons. All statistical tests used for this analysis were performed using Microsoft Excel.

FISH.
Sorted cells were resuspended in 5 mM CaCl2 then dropped onto clean slides and allowed to dry overnight. Slides were then processed for FISH as previously described using a rhodamine-labeled (red) chromosome 11 centromere probe (Vysis, Inc., Downers Grove, IL) and a FITC-labeled (green) chromosome 17 centromere probe (Vysis, Inc.) (20) . Slides were counterstained with 0.23 µg/ml 4', 6-diamindino-2-phenyl indole (Sigma), examined with x100 oil immersion on an epifluorescence microscope, and the numbers of red and green FISH spots were counted in each of at least 100 nuclei by a blinded observer. Cells were simultaneously evaluated for the presence of condensed mitotic chromatin. Cells were scored as tetraploid if they contained four or more red and four or more green spots. Because a FISH spot is sometimes overlapping or otherwise missed, cells with four red and three green or three red and four green spots were also counted as tetraploid.

Quantitative RT-PCR.
Aliquots from total RNA samples used in the array experiments were used in real time PCR (TaqMan) assays. All assays were performed on the ABI Prism 7900 detection system (Applied Biosystems) using TaqMan EZ RT-PCR Core Reagents with glyceraldehyde-3-phosphate dehydrogenase controls for normalization. All reactions were done in triplicate according to the supplier’s instructions. The primers and probes used in this study were: p55CDC20F, CATTCACCCAGCATCAAGGG; p55CDC20 probe, CTGTCAAGGCCGTAGCATGGTGTCC; p55CDC20R, CCAGGACATTGGACTGCCA; NEK2F, TGAGGACTATGAAGTGTTGTACACCA; NEK2 probe, TGGCACAGGCTCCTACGGCCG; NEK2R, CCTCCGGATCTTCTGGCA; CENPAF, CCTTACATGCAGGCCGAGTT; CENPA probe, CTCTCTTCCCAAAGGATGTGCAACTGG; CENPAR, CCCCGGATCCTCCGG; RRM1F, CCTTCAGAGCCTCAGCCACTAG; RRM1 probe, TGCGATGCATGTGATCAAGCGAGA; and RRM1R, CTCGTTCTTGGCGGCC.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To enrich for tetraploid cells in each 4N population, cells from asynchronous cultures were viably sorted into 2N (diploid G1) and 4N (G2-tetraploid) fractions (Fig. 1)Citation . The 2N cell fractions were stored, whereas the 4N cell fractions were recultured for 12–14 days to allow G2 or transiently arrested cells to progress through the cell cycle and then re-sorted to obtain enriched 4N (tetraploid) cells. The expression profiles of single-sorted 2N and re-sorted 4N cell populations from each culture were compared in duplicate independent experiments. A total of 695 genes was identified that the GeneChip scoring software indicated were significantly differentially expressed (P < 0.003) in each of duplicate experiments comparing 2N versus 4N cells in each culture. Approximately 8 of these genes would be expected to be false positives (see "Materials and Methods"). Pairwise average linkage clustering identified a single predominant node of 124 genes (Fig. 2a)Citation . Strikingly, all of these genes were uniquely overexpressed in the 4N TP53mut cultures and of those showing >=1.5-fold changes (101 of 124), most have G2-M-related functions (Table 1Citation Citation ). These genes are hereafter referred to as the TP53mut gene cluster.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Cell sorting enrichment of tetraploid and G2 cells. a, asynchronous cultures containing 2N and 4N populations were sorted viably by DNA content (ploidy) using Hoechst 33242. The 2N cells (diploid G1) from the first sort (e) were stored. The 4N cells (diploid G2-tetraploid G1) from the same sort (b) were returned to culture for 12–14 days to enrich for tetraploid-arrested cells (c). These were then resorted by ploidy to obtain enriched samples of 4N tetraploid cells (d). In separate experiments, populations of G2 cells were obtained from 2N cells (diploid G1) from the first sort (e) by returning these cells to culture for 24–48 h and resorting for G2 cells (g). Samples e and d were processed in parallel for 2N/4N array analyses, whereas samples e and g were processed in parallel for 2N/G2 array analyses.

 


View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Clustering and identification of genes differentially expressed in tetraploid Barrett’s epithelial cells. Replicate experiments comparing flow sorted diploid and tetraploid populations were done with each of five cultures (CP-A, CP-B, CP-C, CP-BhTERT, and CP-ChTERT) with hierarchical clustering of the 695 differentially expressed genes (see text), illustrating (a) the cluster of 124 genes up-regulated in TP53 mutant 4N Barrett’s epithelial cells. Expression of these same genes in G2-G1 comparisons is also illustrated (b).

 

View this table:
[in this window]
[in a new window]

 
Table 1 Biological Function of Genes in TP53-/- Tetraploid Cluster

 

View this table:
[in this window]
[in a new window]

 
Table 1A Continued

 
Examples of these genes include CDK1 and regulators of CDK1 activation (CDC25C, CCNB, CCNA, CCNF, CKS1, CKS2, and CDKN3) that control progression through G2 and entry into mitosis (21 , 22) . The largest functional group consists of mitosis-associated genes. These include mediators of chromosome segregation such as the centrosomal kinase NEK2, regulators of the anaphase-promoting complex (p55CDC20, PLK, CSE1L, and E2-EPF), microtubule-dependent motor proteins (CENPF, CENPE, and HKSP), and cohesin (SMC) subunits (23, 24, 25, 26, 27) . The node also contained genes associated with chromatin structure and condensation (CENPA, core histones, XCAPH, and EZH2), cell adhesion (RHAMM, TROAP, and MCAM), and 7 genes of unknown function that may also mediate some of these processes. The striking functional conservation of these genes additionally validates our clustering results. The altered expression of 4 of the genes in the node, RRM1, p55CDC2, CENP-A, and NEK2 was confirmed by real-time RT-PCR (supplemental Fig. 1Citation available on line),5 although the absolute magnitude of expression differences was larger by RT-PCR, as has been found by many other investigators.

Although these genes included some of the major regulators of the G2-M phase of the cell cycle, we did not detect mitotic chromosomes in the nuclei of the re-sorted 4N cell populations. FISH analysis with chromosome 11 and 17-specific centromeric probes revealed variable numbers of tetraploid cells (23.5–81.5%) in each of the re-sorted 4N cell populations (Table 2)Citation . However, the mean expression level of the 124 gene 4N TP53mut cluster was not significantly related to the percentage of tetraploid cells in the sorted 4N fractions by regression analysis and was similar in TP53mut cells with low (CP-B, CP-BhTERT) or high (CP-C, CP-ChTERT) proportions of tetraploid cells (paired t test).


View this table:
[in this window]
[in a new window]

 
Table 2 FISH analysis of flow-sorted cells

 
In comparison, 4N TP53wt cells (CP-A), although mainly (73%) tetraploid by FISH analysis, displayed little difference in expression pattern with their isogenic 2N cells (2.5% tetraploid) in the filtered set of 695 genes (Fig. 2a)Citation . Therefore, we reanalyzed the absolute expression values for all 20 hybridizations in the 2N versus re-sorted 4N cell populations dataset and looked for differences between TP53wt and TP53mut strains. This identified a unique set of 42 genes that was up-regulated in both 2N and 4N TP53wt cells compared with the TP53mut cell populations and included TP53-regulated inhibitors of G1-S and G2-M such as CDKN1A and SFN (supplemental Figs. 2, A and B, available on line).5

G2 Cell Populations.
To additionally characterize the molecular phenotype of the 4N cell populations, we used flow cytometry to obtain enriched populations of G2 cells from TP53wt strain (CP-A) and a TP53mut population (CP-ChTERT) with high tetraploid cell content (81.5%) in the 4N fraction. 2N (diploid G1) cells from asynchronous cultures were viably sorted and then returned to culture for 24–48 h to allow cells to transit through the cell cycle into G2; the G2 cells were then purified by re-sorting according to DNA content (Fig. 1)Citation . The time points used between 24 and 48 h were selected based on the reappearance of G2 cells in the culture and the absence of tetraploid cells as determined in FISH analyses (data not shown). There were 452 genes overexpressed in one or more G2 cell culture, and 135 that were underexpressed (supplemental Fig. 3 available on line).5 The expression profiles of TP53mut G2 populations were similar to the re-sorted 4N TP53mut cells. In contrast, the expression profile of TP53wt G2 cells was distinct from isogenic re-sorted 4N and 2N cells but was similar to that of the TP53mut G2 populations and included the up-regulation of many of the cell cycle-specific genes in the 4N TP53mut cluster.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous studies using flow cytometry and genotyping have validated the role of elevated 4N fractions (>6%) in diploid biopsies as a key transition in the development of aneuploidy and the subsequent progression to cancer (3 , 5, 6, 7) . However, the genetic and cellular heterogeneity of solid tumors makes it difficult to comprehensively study this key intermediate of neoplastic progression. Several reports using tumor cell line model systems have shown that elevated 4N fractions are associated with lesions in the cell cycle and disruption of G2-M. However, investigating G2-M cell populations in these studies typically relies on the synchronization of immortalized cells, which is frequently imperfect (22 , 28 , 29) .

The cell cultures in this study were derived from endoscopic biopsies obtained from patients with premalignant BE in the absence of cancer. Each of the strains has a finite life span and contains genetic lesions associated with early stages of neoplastic progression in vivo, including inactivation of CDKN2A and TP53 (18) . These same lesions were present in the biopsies from which they were derived. Furthermore, each of the strains and the hTERT-immortalized cultures of the TP53mut strains contain spontaneously arising 4N cell fractions in the absence of aneuploidy. Therefore, our combination of flow cytometry, FISH, and oligonucleotide array expression analysis provides the first genome-wide analysis of spontaneously arising tetraploid cells in a premalignant tissue.

DNA content flow cytometry can purify cells from different stages of the cell cycle without the need for synchronization. However, it cannot distinguish between tetraploid G1 cells and diploid G2 cells in a mixed 4N cell population. Therefore, we used FISH analysis with chromosome 11 and 17-specific centromeric probes to quantify the tetraploid (four spots/probe) and G2 (two spots/probe) cell content in each of the re-sorted 4N populations (Table 2)Citation . There was a wide variation in the tetraploid content present in the re-sorted 4N cell populations. However, the mean expression level of the 124 gene 4N TP53mut cluster was similar in TP53mut cells with low (CP-B, 23.5% and CP-BhTERT, 35%) or high (CP-C, 75% and CP-ChTERT, 81.5%) proportions of tetraploid cells (paired t test).

Previous studies using synchronized normal human fibroblast cell cultures and the same oligonucleotide array platform identified 387 genes with periodic expression during distinct phases of the cell cycle (30) . These included 47 of 124 genes that we observe in the 4N TP53mut cluster. Most of these 47 cell cycle-regulated transcripts in the 4N TP53mut cluster (36 of 47: 77%) are up-regulated during normal entry and transition through mitosis. These include mediators of G2-M transition (CDK1, CCNB, and CCNA) and the major events of mitosis such as chromosome condensation (TOP2A and CHC1), centrosome separation and activation (NEK2 and PLK), spindle assembly (HKSP, KNSL5, and KNSL6), and chromosome segregation (p55CDC20, CENPF, CENPE, and UBE2C; Refs. 25, 26, 27 , 31, 32, 33 ).

The order of events in cell cycle is essential for genomic stability and is ensured by checkpoint dependency. For example, segregation of chromosomes during mitosis relies on the proper regulation of chromosomal DNA replication and centrosome duplication in the preceding S phase (32 , 34) . Furthermore, both of these processes are dependent on the phosphorylation of the Rb gene product and subsequent levels of free E2F gene family members (34, 35, 36) . The largest functional category present in the 4N TP53mut cluster contained regulators of progression through G2 and entry into mitosis. These included a series of kinases, including CDK1, PLK1, NEK2, and TTK, that regulate cell division and associated checkpoints (31) . In addition, the cluster also contained activators (CCNB, CDC25C, and p55CDC20) and targets (LMNB1 and CENPA) of these cell cycle-regulatory kinases. The up-regulation of these genes and the overabundance of transcripts with a mitosis-specific temporal pattern among the cell cycle-regulated genes suggest that 4N TP53mut BE cells are activating a mitotic transcriptional program. However, despite these expression patterns, there was an absence of mitotic cells in these populations.

The cells and the biopsies from which they were derived contain regions of LOH, and this reflects DNA damage during neoplastic progression (18) . In addition, CDKN2A abnormalities (9pLOH, with mutation or promoter hypermethylation in the remaining allele) were present in each culture. The cells with methylated alleles did not express any CDKN2A transcript as determined in our array studies, whereas the mutated allele encodes a missense mutation that is known to inhibit normal function of CDKN2A (37) . Several of the genes in the 4N TP53mut cluster, including regulators of G2-M (PLK, TTK, CENPE, NEK2, CDK1, and TOPO2A), are transcriptionally repressed by E2F4 binding and its interactions with Rb pocket proteins and histone deacetylases in noncycling cells (36 , 38) . Furthermore, several genes in the 4N TP53mut cluster (e.g., CKS1, SMC, TOP2A, YWHAH, and BARD1) are activated in response to DNA damage and mediate various cell cycle checkpoints (39) .

Studies with immortalized tumor cells have shown that in the presence of drug-induced double-strand DNA breaks cycling cells may activate a reversible G2 arrest (28) . This arrest is associated with a prolonged induction of G2-M-associated genes. In addition to enriching for spontaneously arising tetraploid populations, we used flow cytometry to obtain G2 cell fractions without the need for extensive synchronization. Within the 4N TP53mut cluster, the expression profile of the 4N TP53mut populations (Fig. 2b)Citation was similar to the G2 TP53wt cells, suggesting that the former phenotype arose from a G2 delay. The CDKN2A-null background of BE cells likely disrupts CDK4 regulation, creating a condition permissive for TP53mut cells with genomic lesions to transit through G1-S, overcome E2F4 repression and activate a G2-M transcriptional program. Consequently, 4N TP53mut cells either delay in early G2-M (CP-B, CP-BhTERT) with low tetraploid fractions or transit from G2-M to the tetraploid G1 by adaptation (CP-C, CP-ChTERT) in the absence of condensed chromosomes (40, 41, 42) .

The 4N TP53wt cells, although primarily tetraploid (73%), retain the expression profile of the diploid cells from which they arose (Fig. 2Citation , Table 2Citation ). Furthermore, both of these TP53wt cell populations were distinct from the isogenic G2 populations. Previous in vitro studies have shown that disruption of the mitotic spindle results in the activation of a tetraploid G1 checkpoint in diploid human cells (11) . Activation of this checkpoint is dependent on exit from mitosis, reentry into G1, and TP53-induced CDKN1A expression. The 42 gene TP53wt set included CDKN1A and was present in both diploid and tetraploid cell populations, suggesting that this checkpoint was activated. Furthermore, the absence of CDKN1A in TP53wt G2 cells is consistent with the G1-specific activation of the tetraploid checkpoint. In contrast, the TP53mut 4N cells enter G2 inappropriately and subsequently activate a G2-M transcriptional program, which can persist even if the cells progress to a tetraploid G1 by accommodation. The TP53mut 4N cluster identifies pathways that contribute to mitotic and chromosomal instability, perhaps accounting for the increased cancer risk associated with the presence of elevated 4N fractions in BE.


    ACKNOWLEDGMENTS
 
We thank Jeff Delrow, Cassie Neal, Ryan Bosom, and Dan Hare for assistance with microarray experiments.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grants PO1 CA91955, R01 CA78855, T32 AG00057 and R01 CA61202. Back

2 Present address: Agilent Laboratories, 3500 Deer Creek Road, Palo Alto, CA 94304. Back

3 To whom requests for reprints should be addressed, at University of Washington, Department of Pathology, Box 357705, K081 Health Sciences Building, Seattle, WA 98195. Back

4 The abbreviations used are: BE, Barrett’s esophagus; Rb, retinoblastoma; FISH, fluorescent in situ hybridization; RT-PCR, reverse transcription-PCR; LOH, loss of heterozygosity. Back

5 Internet address: http://www.fhcrc.org/phs/barretts/cancer-research/. Back

6 Internet address: http://www.microarrays.org/software. Back

Received 11/26/02. Accepted 5/ 7/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Shackney S. E., Smith C. A., Miller B. W., Burholt D. R., Murtha K., Giles H. R., Ketterer D. M., Pollice A. A. Model for the genetic evolution of human solid tumors. Cancer Res., 49: 3344-3354, 1989.[Abstract/Free Full Text]
  2. Hollstein M., Sidransky D., Vogelstein B., Harris C. C. p53 mutations in human cancers. Science (Wash. DC), 253: 49-53, 1991.[Abstract/Free Full Text]
  3. Galipeau P. C., Cowan D. S., Sanchez C. A., Barrett M. T., Emond M. J., Levine D. S., Rabinovitch P. S., Reid B. J. 17p (p53) allelic losses, 4N (G2/tetraploid) populations, and progression to aneuploidy in Barrett’s esophagus. Proc. Natl. Acad. Sci. USA, 93: 7081-7084, 1996.[Abstract/Free Full Text]
  4. Blount P. L., Galipeau P. C., Sanchez C. A., Neshat K., Levine D. S., Yin Y., Suzuki H., Abraham J. M., Meltzer S. J., Reid B. J. 17p allelic losses in diploid cells of patients with Barrett’s esophagus who develop aneuploidy. Cancer Res., 54: 2292-2295, 1994.[Abstract/Free Full Text]
  5. Barrett M. T., Sanchez C. A., Prevo L. J., Wong D. J., Galipeau P. C., Paulson T. G., Rabinovitch P. S., Reid B. J. Evolution of neoplastic cell lineages in Barrett oesophagus. Nat. Genet., 22: 106-109, 1999.[Medline]
  6. Rabinovitch P. S., Longton G., Blount P. L., Levine D. S., Reid B. J. Predictors of progression in Barrett’s esophagus III: baseline flow cytometric variables. Am. J. Gastroenterol., 96: 3071-3083, 2001.[Medline]
  7. Reid B. J., Levine D. S., Longton G., Blount P. L., Rabinovitch P. S. Predictors of progression to cancer in Barrett’s esophagus: baseline histology and flow cytometry identify low- and high-risk patient subsets. Am. J. Gastroenterol., 95: 1669-1676, 2000.[Medline]
  8. Cross S. M., Sanchez C. A., Morgan C. A., Schimke M. K., Ramel S., Idzerda R. L., Raskind W. H., Reid B. J. A p53-dependent mouse spindle checkpoint. Science (Wash. DC), 267: 1353-1356, 1995.[Abstract/Free Full Text]
  9. Fukasawa K., Choi T., Kuriyama R., Rulong S., Vande Woude G. F. Abnormal centrosome amplification in the absence of p53. Science (Wash. DC), 271: 1744-1747, 1996.[Abstract]
  10. DiLeonardo A., Khan S. H., Linke S. P., Greco V., Seidita G., Wahl G. M. DNA rereplication in the presence of mitotic spindle inhibitors in human and mouse fibroblasts lacking either p53 or pRb function. Cancer Res., 57: 1013-1019, 1997.[Abstract/Free Full Text]
  11. Khan S. H., Wahl G. M. p53 and pRb prevent rereplication in response to microtubule inhibitors by mediating a reversible G1 arrest. Cancer Res., 58: 396-401, 1998.[Abstract/Free Full Text]
  12. Andreassen P. R., Lohez O. D., Lacroix F. B., Margolis R. L. Tetraploid state induces p53-dependent arrest of nontransformed mammalian cells in G1. Mol. Biol. Cell, 12: 1315-1328, 2001.[Abstract/Free Full Text]
  13. Neshat K., Sanchez C. A., Galipeau P. C., Cowan D. S., Ramel S., Levine D. S., Reid B. J. Barrett’s esophagus: A model of human neoplastic progression. Cold Spring Harbor Symp. on Quant. Biol., 59: 577-583, 1994.
  14. Levine D. S., Blount P. L., Rudolph R. E., Reid B. J. Safety of a systematic endoscopic biopsy protocol in patients with Barrett’s esophagus. Am. J. Gastroenterol., 95: 1152-1157, 2000.[Medline]
  15. Wong D. J., Paulson T. G., Prevo L. J., Galipeau P. C., Longton G., Blount P. L., Reid B. J. p16(INK4a) lesions are common, early abnormalities that undergo clonal expansion in Barrett’s metaplastic epithelium. Cancer Res., 61: 8284-8289, 2001.[Abstract/Free Full Text]
  16. Prevo L. J., Sanchez C. A., Galipeau P. C., Reid B. J. p53-mutant clones and field effects in Barrett’s esophagus. Cancer Res., 59: 4784-4787, 1999.[Abstract/Free Full Text]
  17. Galipeau P. C., Prevo L. J., Sanchez C. A., Longton G. M., Reid B. J. Clonal expansion and loss of heterozygosity at chromosomes 9p and 17p in premalignant esophageal (Barrett’s) tissue. J. Natl. Cancer Inst. (Bethesda), 91: 2087-2095, 1999.[Abstract/Free Full Text]
  18. Palanca-Wessels M. C., Barrett M. T., Galipeau P. C., Rohrer K. L., Reid B. J., Rabinovitch P. S. Genetic analysis of long-term Barrett’s esophagus epithelial cultures exhibiting cytogenetic and ploidy abnormalities. Gastroenterology, 114: 295-304, 1998.[Medline]
  19. Liu W. M., Mei R., Bartell D. M., Di X., Webster T. A., Ryder T. Rank-based algorithms for analysis of microarrays. Proc. SPIE, 4266: 56-67, 2001.
  20. Rabinovitch P. S., Dziadon S., Brentnall T. A., Emond M. J., Crispin D. A., Haggitt R. C., Bronner M. P. Pancolonic chromosomal instability precedes dysplasia and cancer in ulcerative colitis. Cancer Res., 59: 5148-5153, 1999.[Abstract/Free Full Text]
  21. Pines J., Rieder C. L. Re-staging mitosis: a contemporary view of mitotic progression. Nat. Cell Biol., 3: E3-E6, 2001.[Medline]
  22. Taylor W. R., Stark G. R. Regulation of the G2-M transition by p53. Oncogene, 20: 1803-1815, 2001.[Medline]
  23. Karsenti E., Vernos I. Cell cycle—the mitotic spindle: a self-made machine. Science (Wash. DC), 294: 543-547, 2001.[Abstract/Free Full Text]
  24. Nasmyth K., Peters J. M., Uhlmann F. Splitting the chromosome: cutting the ties that bind sister chromatids. Science (Wash. DC), 288: 1379-1384, 2000.[Abstract/Free Full Text]
  25. Zachariae W., Nasmyth K. Whose end is destruction: cell division and the anaphase-promoting complex. Genes Dev., 13: 2039-2058, 1999.[Free Full Text]
  26. Page A. M., Hieter P. The anaphase-promoting complex: new subunits and regulators. Annu. Rev. Biochem., 68: 583-609, 1999.[Medline]
  27. Morgan D. O. Regulation of the APC and the exit from mitosis. Nat. Cell Biol., 1: E47-E53, 1999.[Medline]
  28. Zhou Y., Gwadry F. G., Reinhold W. C., Miller L. D., Smith L. H., Scherf U., Liu E. T., Kohn K. W., Pommier Y., Weinstein J. N. Transcriptional regulation of mitotic genes by camptothecin-induced DNA damage: microarray analysis of dose- and time-dependent effects. Cancer Res., 62: 1688-1695, 2002.[Abstract/Free Full Text]
  29. Andreassen P. R., Lacroix F. B., Lohez O. D., Margolis R. L. Neither p21WAF1 nor 14-3-3 prevents G2 progression to mitotic catastrophe in human colon carcinoma cells after DNA damage, but p21WAF1 induces stable G1 arrest in resulting tetraploid cells. Cancer Res., 61: 7660-7668, 2001.[Abstract/Free Full Text]
  30. Cho R. J., Huang M. X., Campbell M. J., Dong H. L., Steinmetz L., Sapinoso L., Hampton G., Elledge S. J., Davis R. W., Lockhart D. J. Transcriptional regulation and function during the human cell cycle. Nat. Genet., 27: 48-54, 2001.[Medline]
  31. Nigg E. A. Mitotic kinases as regulators of cell division and its checkpoints. Nat. Rev. Mol. Cell. Biol., 2: 21-32, 2001.[Medline]
  32. Hinchcliffe E. H., Sluder G. "It takes two to tango": understanding how centrosome duplication is regulated throughout the cell cycle. Genes Dev., 15: 1167-1181, 2001.[Free Full Text]
  33. Glover D. M., Hagan I. M., Tavares A. A. M. Polo-like kinases: a team that plays throughout mitosis. Genes Dev., 12: 3777-3787, 1998.[Free Full Text]
  34. Meraldi P., Lukas J., Fry A. M., Bartek J., Nigg E. A. Centrosome duplication in mammalian somatic cells requires E2F and Cdk2-cyclin A. Nat. Cell Biol., 1: 88-93, 1999.[Medline]
  35. Lukas C., Sorensen C. S., Kramer E., Santoni-Rugiu E., Lindeneg C., Peters J. M., Bartek J., Lukas J. Accumulation of cyclin B1 requires E2F and cyclin-A-dependent rearrangement of the anaphase-promoting complex. Nature (Lond.), 401: 815-818, 1999.[Medline]
  36. Ren B., Cam H., Takahashi Y., Volkert T., Terragni J., Young R. A., Dynlacht B. D. E2F integrates cell cycle progression with DNA repair, replication, and G2-M checkpoints. Genes Dev., 16: 245-256, 2002.[Abstract/Free Full Text]
  37. Ranade K., Hussussian C. J., Sikorski R. S., Varmus H. E., Goldstein A. M., Tucker M. A., Serrano M., Hannon G. J., Beach D., Dracopoli N. C. Mutations associated with familial melanoma impair p16INK4 function. Nat. Genet., 10: 114-116, 1995.[Medline]
  38. Rayman J. B., Takahashi Y., Indjeian V. B., Dannenberg J. H., Catchpole S., Watson R. J., Riele H., Dynlacht B. D. E2F mediates cell cycle-dependent transcriptional repression in vivo by recruitment of an HDAC1/mSin3B corepressor complex. Genes Dev., 16: 933-947, 2002.[Abstract/Free Full Text]
  39. Zhou B. B. S., Elledge S. J. The DNA damage response: putting checkpoints in perspective. Nature (Lond.), 408: 433-439, 2000.[Medline]
  40. Pellicioli A., Lee S. B., Lucca C., Foiani M., Haber J. E. Regulation of Saccharomyces Rad53 checkpoint kinase during adaptation from DNA damage-induced G2-M arrest. Mol. Cell, 7: 293-300, 2001.[Medline]
  41. Paulovich A. G., Toczyski D. P., Hartwell L. H. When checkpoints fail. Cell, 88: 315-321, 1997.[Medline]
  42. Galgoczy D. J., Toczyski D. P. Checkpoint adaptation precedes spontaneous and damage-induced genomic instability in yeast. Mol. Cell. Biol., 21: 1710-1718, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
Z. Storchova and C. Kuffer
The consequences of tetraploidy and aneuploidy
J. Cell Sci., December 1, 2008; 121(23): 3859 - 3866.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. L. Chao, C. A. Sanchez, P. C. Galipeau, P. L. Blount, T. G. Paulson, D. S. Cowan, K. Ayub, R. D. Odze, P. S. Rabinovitch, and B. J. Reid
Cell Proliferation, Cell Cycle Abnormalities, and Cancer Outcome in Patients with Barrett's Esophagus: A Long-term Prospective Study
Clin. Cancer Res., November 1, 2008; 14(21): 6988 - 6995.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Milyavsky, Y. Tabach, I. Shats, N. Erez, Y. Cohen, X. Tang, M. Kalis, I. Kogan, Y. Buganim, N. Goldfinger, et al.
Transcriptional Programs following Genetic Alterations in p53, INK4A, and H-Ras Genes along Defined Stages of Malignant Transformation
Cancer Res., June 1, 2005; 65(11): 4530 - 4543.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Helm, S. A. Enkemann, D. Coppola, J. S. Barthel, S. T. Kelley, and T. J. Yeatman
Dedifferentiation Precedes Invasion in the Progression from Barrett's Metaplasia to Esophageal Adenocarcinoma
Clin. Cancer Res., April 1, 2005; 11(7): 2478 - 2485.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
E. Pohler, A. L. Craig, J. Cotton, L. Lawrie, J. F. Dillon, P. Ross, N. Kernohan, and T. R. Hupp
The Barrett's Antigen Anterior Gradient-2 Silences the p53 Transcriptional Response to DNA Damage
Mol. Cell. Proteomics, June 1, 2004; 3(6): 534 - 547.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. L. Sabichi, M.-F. Demierre, E. T. Hawk, C. E. Lerman, and S. M. Lippman
Frontiers in Cancer Prevention Research
Cancer Res., September 15, 2003; 63(18): 5649 - 5655.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barrett, M. T.
Right arrow Articles by Rabinovitch, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barrett, M. T.
Right arrow Articles by Rabinovitch, P. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online