| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Leukaemia Research Fund, Epidemiology and Genetics Unit, School of Medicine, University of Leeds, Leeds LS2 9JT, United Kingdom
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
TaqMan-based Allelic Discrimination.
A total of 471 of 479 AML cases and 931 of 952 controls were successfully genotyped for the -1377 bp FAS promoter polymorphism. An additional 21 control samples (2.2%) and 8 cases (1.6%) could not be amplified. Oligonucleotide primers and probes were designed using Primer Express software (Applied Biosystems, Warrington, United Kingdom). Allele-specific probes were labeled with either FAM (AAGACCCTGGGTGTGCCAGCCT) or VIC (CCCTGGGCGTGCCAGCCT). PCR oligonucleotide primers spanning the -1377 polymorphism were as follows: FAS-F, CTATTAGATGCTCAGAGTGTGTGCA; and FAS-R, GCTTGTCTCTGTTCCACCTTTCA. Standard TaqMan cycling conditions were used, incorporating 40 cycles with an annealing temperature of 61°C.
RFLP-based Genotyping.
A total of 454 of 479 cases and 934 of 952 controls were successfully genotyped for the -670 bp FAS promoter polymorphism as described elsewhere (8)
. ScrFI-digested PCR products were separated on 2.5% agarose gels, stained with ethidium bromide, and visualized under UV light.
Genotype Verification.
TaqMan-based genotyping was verified in 10% of randomly chosen samples by allele-specific PCR. Oligonucleotide primers specific for the -1377G allele (ATGAGGAAGACCCTGGGC) or -1377A allele (ATGAGGAAGACCCTGGGT) were used with a common oligonucleotide primer (CTATTAGATGCTCAGAGTGTGTGCA) in an allele-specific PCR reaction (95°C for 10 min followed by 45 cycles of 95°C for 20 s, 58°C for 20 s) using Stoffel Gold enzyme (a kind gift from Roche Molecular Systems; Ref. 11
). Final confirmation of both the -1377 and -670 bp genotyping assays was obtained in a random selection of 47 samples using DNA sequencing (Big Dye Terminator; Applied Biosystems Inc.) and analyzed using the Sequence Analysis program (Applied Biosystems Inc.).
Statistical Analysis.
ORs and 95% CIs were derived using unconditional logistic regression with all available controls adjusting for age, sex, and region of residence. Maximum likelihood regression of haplotype frequencies was conducted using the Hapipf function in Stata (12)
, and ORs were derived using log-linear modeling (version 7; Stata Corp.).
EMSA.
Oligonucleotide probes representing the -1377A allele (GGCTGGCACACCCAGGGTCTTC), -1377G allele (GGCTGGCACGCCCAGGGTCTTC), -670G allele (TGTCCATTCCAGGAACGTCTG), or -670A allele (TGTCCATTCCAGAAACGTCTG) were end-labeled using [
-32P]ATP (ICN, Basingstoke, United Kingdom) and polynucleotide kinase (Promega, Southampton, United Kingdom). A consensus SP1 site (GGCACGCCCA) was contained within the -1377G oligonucleotide probe, whereas a consensus STAT1 binding site was contained within the -670G oligonucleotide probe (TTCCAGGAA). Oligonucleotides were annealed to their complementary sequence by heating to 95°C for 10 min followed by cooling overnight. For -1377 bp EMSAs, K562 cells were grown to 106 cells/ml in RPMI 1640 containing 2 mM L-glutamine and 10% fetal bovine serum. Nuclear protein extracts were made as described elsewhere (13)
using 107 cells. Determination of protein concentration was carried out using the Bradford reagent according to the manufacturers instructions (Bio-Rad, Hemel Hempstead, United Kingdom). For -670 bp EMSAs, phorbol ester-treated HeLa nuclear extract was used (Autogen Bioclear, United Kingdom Ltd., Wiltshire, United Kingdom).
EMSAs were carried out using the Gel Shift Assay System (Promega). For each lane, 10 µg of nuclear lysate were incubated with 4 ng of labeled double-stranded oligonucleotide primers for 30 min at room temperature followed by the addition of 20 µl of 80% glycerol. Samples containing antibodies were preincubated for 30 min with anti-SP1 or anti-STAT1 antibody (Autogen Bioclear United Kingdom Ltd.) before the addition of labeled oligonucleotide. DNA-protein complexes were resolved on a 6% polyacrylamide gel (Sigma, Dorset, United Kingdom) and run at 140 V for 3 h in 0.5x Tris-borate EDTA (Invitrogen Ltd., Paisley, United Kingdom).
| Results |
|---|
|
|
|---|
2 = 17.1; P = 0.0002), suggesting a link with risk of AML. There was an increased risk of AML associated with heterozygotes at -1377 bp (28.9%) compared with controls (20.0%; OR, 1.66; 95% CI, 1.292.15). The risk associated with AA homozygotes at -1377 bp in the case population (3.4%) is also higher than that in the control population (2.0%; OR, 1.92; 95% CI, 0.973.78). The narrow CIs indicate that these results are both accurate and precise. These data suggest that an increased risk of developing AML is associated with inheritance of the -1377A allele in a dose-dependent manner. The associated risk of AML when carrying an adenine residue at -1377 bp was shown to be independent of age, sex, and region (data not shown). In contrast, no significant differences in genotype distribution between AML cases and controls were observed at -670 bp (Table 1)
|
|
|
| Discussion |
|---|
|
|
|---|
Previous studies have suggested that cytogenetics can be used to define distinct subgroups of AML with different prognoses and age distributions (18) . Using cytogenetic data from this study, we separated the data set into five cytogenetic subgroups: normal karyotype; translocation; trisomy 8; deletions of 5q/7q; or other. Comparison of the FAS -1377 bp and -670 bp genotypes across these groups revealed no significant associations of genotype with karyotype (data not shown), suggesting that the risk associated with polymorphisms in the FAS promoter is not restricted to a particular AML subtype and that the downstream effects of genetic variation in the promoter are likely to be exerted via mechanisms common to all subtypes.
The genotype frequencies in our control population at both -1377 bp and -670 bp are in good agreement with previous studies (16 , 19) . To our knowledge, haplotype frequencies have only been reported in one other study examining systemic lupus erythematosus cases in a Japanese population (17) , but, as would be expected, allele and genotype frequencies in the control population were different from those obtained in this study; hence direct comparisons cannot be made.
Detection bias, in which one allele is more efficiently amplified or detected than another, in large genotyping studies has been reported in the literature, as have false associations in small studies (20) . The large size of this study, combined with a rigorous verification of TaqMan and RFLP-based genotyping using allele-specific PCR and direct sequencing, has ensured that accurate genotype frequencies have been calculated. For studies claiming association of specific polymorphisms with a biological effect, it is also important to be able to demonstrate a potential mechanism of action. In this study, we have confirmed that the -1377 and -670 bp polymorphisms occur within transcription factor binding sites and bind SP1 and STAT1, respectively. Moreover, we have shown that the presence of an adenine residue at position -1377 bp of the FAS promoter significantly reduces SP1 binding compared with a guanine residue. The SP1 site at -1377 bp lies between two putative silencer regions, although the site itself is not within a known silencer consensus sequence (21) . SP1 binding is associated with transcriptional activation (22) , and we postulate that reduced SP1 binding at -1377 bp in the FAS promoter results in a decrease in FAS expression. Although the allele and genotype frequencies at -670 bp in the case and control populations are not significantly different, haplotype analysis reveals that the -1377A/-670A haplotype increases the risk of AML six times above those with -1377G/1377G. Hence the -670A allele appears to modulate risk of AML when associated with -1377A, but not when associated with -1377G. Previous work has suggested that STAT1 binding alone cannot be equated with a biological function and that concomitant SP1 binding may be required to achieve transcriptional activation (23) . This complex association at the protein level may explain why the -1377A/-670A haplotype shows such an increased risk of AML.
The importance of FAS in hematopoietic tissues is illustrated by the mouse lpr model. Mutations in FAS lead to lymphadenopathy, systemic lupus erythromatosus, and an increase in the incidence of B-cell lymphoma (2) . Autoimmunity and related conditions are believed to be due to a failure of T cells to undergo negative selection during development, where efficient apoptosis is crucial in the removal of autoreactive lymphocytes (3) . Loss of function mutations in FAS and components of the FAS apoptotic pathway have also been implicated in myeloid malignancies (24) . lpr mice that constitutively express the Bcl-2 proto-oncogene develop murine AML, whereas constitutive Bcl-2 expression alone does not result in malignancy (6) . These studies suggest that FAS is one of several genes critical to normal myeloid differentiation, potentially regulating myeloid expansion. Our study has shown that the -1377 bp FAS promoter polymorphism is associated with an increased risk of AML. Furthermore, we have shown that the presence of an adenine residue rather than a guanine residue at -1377 bp significantly attenuates transcription factor SP1 binding and may contribute to a reduction in FAS expression and ultimately to the enrichment of apoptosis-resistant clones in AML.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by grants from the Leukaemia Research Fund of Great Britain and Yorkshire Cancer Research. C. F. S. and M. T. S. were supported by NIH Grant P30ES01896 and the National Foundation for Cancer Research. ![]()
2 To whom requests for reprints should be addressed. Phone/fax: 44-113-3433372; E-mail: k.sibley{at}lrf.leeds.ac.uk ![]()
3 Present address: Division of Environmental Health Sciences, School of Public Health, University of California, Berkeley, CA 94720-7360. ![]()
4 The abbreviations used are: AML, acute myeloid leukemia; STAT, signal transducers and activators of transcription; OR, odds ratio; CI, confidence interval; EMSA, electrophoretic mobility shift assay. ![]()
Received 3/31/03. Accepted 6/17/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. Ji, A. Gu, F. Hu, S. Wang, J. Liang, Y. Xia, C. Lu, L. Song, G. Fu, and X. Wang Polymorphisms in cell death pathway genes are associated with altered sperm apoptosis and poor semen quality Hum. Reprod., October 1, 2009; 24(10): 2439 - 2446. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, H. Xue, W. Gong, M. Wang, L. Yuan, S. Han, and Z. Zhang FAS promoter polymorphisms and cancer risk: a meta-analysis based on 34 case-control studies Carcinogenesis, March 1, 2009; 30(3): 487 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Park, W.-K. Lee, D.-K. Jung, J.-E. Choi, T.-I. Park, E.-B. Lee, S. Cho, J.-Y. Park, S.-I. Cha, C.-H. Kim, et al. Polymorphisms in the FAS and FASL Genes and Survival of Early Stage Non-small Cell Lung Cancer Clin. Cancer Res., March 1, 2009; 15(5): 1794 - 1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Mehta, R. B. Gerbing, T. A. Alonzo, J. S. Elliott, T. A. Zamzow, M. Combs, E. Stover, J. A. Ross, J. P. Perentesis, S. Meschinchi, et al. FAS Promoter Polymorphism: Outcome of Childhood Acute Myeloid Leukemia. A Children's Oncology Group Report Clin. Cancer Res., December 1, 2008; 14(23): 7896 - 7899. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ter-Minassian, R. Zhai, K. Asomaning, L. Su, W. Zhou, G. Liu, R. S. Heist, T. J. Lynch, J. C. Wain, X. Lin, et al. Apoptosis gene polymorphisms, age, smoking and the risk of non-small cell lung cancer Carcinogenesis, November 1, 2008; 29(11): 2147 - 2152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yang, T. Sun, L. Wang, D. Yu, X. Zhang, X. Miao, J. Liu, D. Zhao, H. Li, W. Tan, et al. Functional Variants in Cell Death Pathway Genes and Risk of Pancreatic Cancer Clin. Cancer Res., May 15, 2008; 14(10): 3230 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Farre, A. L. Bittencourt, G. Silva-Santos, A. Almeida, A. C. Silva, D. Decanine, G. M. Soares, L. C. Alcantara Jr., S. Van Dooren, B. Galvao-Castro, et al. Fas-670 promoter polymorphism is associated to susceptibility, clinical presentation, and survival in adult T cell leukemia J. Leukoc. Biol., January 1, 2008; 83(1): 220 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Crew, M. D. Gammon, M. B. Terry, F. F. Zhang, M. Agrawal, S. M. Eng, S. K. Sagiv, S. L. Teitelbaum, A. I. Neugut, and R. M. Santella Genetic polymorphisms in the apoptosis-associated genes FAS and FASL and breast cancer risk Carcinogenesis, December 1, 2007; 28(12): 2548 - 2551. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zhang, T. Sun, L. Xue, X. Han, B. Zhang, N. Lu, Y. Shi, W. Tan, Y. Zhou, D. Zhao, et al. Functional polymorphisms in FAS and FASL contribute to increased apoptosis of tumor infiltration lymphocytes and risk of breast cancer Carcinogenesis, May 1, 2007; 28(5): 1067 - 1073. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, L.-E Wang, E. M. Sturgis, A. K. El-Naggar, W. K. Hong, C. I. Amos, M. R. Spitz, and Q. Wei Polymorphisms of FAS and FAS Ligand Genes Involved in the Death Pathway and Risk and Progression of Squamous Cell Carcinoma of the Head and Neck. Clin. Cancer Res., September 15, 2006; 12(18): 5596 - 5602. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wang, S. Ngoi, J. Wang, S. S. Chong, and C. G. L. Lee The Promoter Region of the MDR1 Gene Is Largely Invariant, but Different Single Nucleotide Polymorphism Haplotypes Affect MDR1 Promoter Activity Differently in Different Cell Lines Mol. Pharmacol., July 1, 2006; 70(1): 267 - 276. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Park, J. M. Park, J. S. Jang, J. E. Choi, K. M. Kim, S. I. Cha, C. H. Kim, Y. M. Kang, W. K. Lee, S. Kam, et al. Caspase 9 promoter polymorphisms and risk of primary lung cancer Hum. Mol. Genet., June 15, 2006; 15(12): 1963 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sun, Y. Zhou, H. Li, X. Han, Y. Shi, L. Wang, X. Miao, W. Tan, D. Zhao, X. Zhang, et al. FASL -844C polymorphism is associated with increased activation-induced T cell death and risk of cervical cancer J. Exp. Med., October 3, 2005; 202(7): 967 - 974. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wang and M. You Five Loci, SLT1 to SLT5, Controlling the Susceptibility to Spontaneously Occurring Lung Cancer in Mice Cancer Res., September 15, 2005; 65(18): 8158 - 8165. [Abstract] [Full Text] [PDF] |
||||
![]() |
X Zhang, X Miao, T Sun, W Tan, S Qu, P Xiong, Y Zhou, and D Lin Functional polymorphisms in cell death pathway genes FAS and FASL contribute to risk of lung cancer J. Med. Genet., June 1, 2005; 42(6): 479 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Krippl, U. Langsenlehner, W. Renner, H. Koppel, and H. Samonigg Re: Polymorphisms of Death Pathway Genes FAS and FASL in Esophageal Squamous-Cell Carcinoma J Natl Cancer Inst, October 6, 2004; 96(19): 1478 - 1479. [Full Text] [PDF] |
||||
![]() |
T. Sun, X. Miao, X. Zhang, and D. Lin RESPONSE: Re: Polymorphisms of Death Pathway Genes FAS and FASL in Esophageal Squamous-Cell Carcinoma J Natl Cancer Inst, October 6, 2004; 96(19): 1479 - 1479. [Full Text] [PDF] |
||||
![]() |
T. Sun, X. Miao, X. Zhang, W. Tan, P. Xiong, and D. Lin Polymorphisms of Death Pathway Genes FAS and FASL in Esophageal Squamous-Cell Carcinoma J Natl Cancer Inst, July 7, 2004; 96(13): 1030 - 1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rollinson, J. M. Allan, G. R. Law, P. L. Roddam, M. T. Smith, C. Skibola, A. G. Smith, M. S. Forrest, K. Sibley, R. Higuchi, et al. High-Throughput Association Testing on DNA Pools to Identify Genetic Variants that Confer Susceptibility to Acute Myeloid Leukemia Cancer Epidemiol. Biomarkers Prev., May 1, 2004; 13(5): 795 - 800. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |