Cancer Research Grants  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sibley, K.
Right arrow Articles by Morgan, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sibley, K.
Right arrow Articles by Morgan, G. J.
[Cancer Research 63, 4327-4330, August 1, 2003]
© 2003 American Association for Cancer Research


Advances in Brief

Functional FAS Promoter Polymorphisms Are Associated with Increased Risk of Acute Myeloid Leukemia1

Kathryn Sibley2, Sara Rollinson, James M. Allan, Alexandra G. Smith, Graham R. Law, Philippa L. Roddam, Christine F. Skibola3, Martyn T. Smith3 and Gareth J. Morgan

Leukaemia Research Fund, Epidemiology and Genetics Unit, School of Medicine, University of Leeds, Leeds LS2 9JT, United Kingdom


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The FAS (TNFRSF6/CD95/APO-1) gene is silenced in many tumor types, resulting in an inability to respond to proapoptotic signals. The FAS promoter is polymorphic, including a G to A substitution at -1377 bp and an A to G substitution at -670 bp, which occur within SP1 and signal transducers and activators of transcription 1 transcription factor binding sites, respectively. In a case-control study of adult acute myeloid leukemia (AML), we show a significantly increased risk of AML associated with heterozygotes (GA) and homozygote variants (AA) at position -1377 bp (32.3% in cases versus 22.0% in controls; odds ratio, 1.69; 95% confidence interval, 1.32–2.16). Extended haplotype analysis revealed that the -1377A/-670A haplotype was significantly associated with disease (3% versus 0.5%; odds ratio, 6.72; 95% confidence interval, 3.13–14.51). These data suggest that variation in the FAS gene promoter may affect FAS gene expression and modulate apoptotic signaling, contributing to an increased risk of AML.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
FAS (TNFSF6/CD95/APO-1) is a cell surface receptor involved in apoptotic signal transmission in many cell types, including cells of the immune system (1) . FAS belongs to the family of tumor necrosis factor receptors, and binding to the receptor by the FAS ligand (CD95L) triggers receptor trimerization and subsequent assembly of the death-inducing signaling complex (2) . This mechanism of FAS-mediated apoptosis is believed to be involved in the removal of autoreactive lymphocytes during normal development of the immune system, and perturbation of this pathway occurs in a number of autoimmune disorders including systemic lupus erythematosus (3) . The FAS-mediated apoptotic pathway is also dysregulated in several immune system malignancies, resulting in down-regulation of apoptosis and subsequent persistence of the malignant clone (2) . Germ-line mutations or deletions within FAS, resulting in a loss or a reduction in receptor function, have been shown to cause autoimmune lymphoproliferative syndrome, a condition associated with systemic autoimmunity and generalized lymphoproliferation, as well as an overall increased risk of hematological malignancies (4) . Aberrant apoptosis is known to be important in the pathogenesis of AML4 because up-regulation of the antiapoptotic protein BCL2 is a common feature of leukemic blasts and may be a critical event in myeloid transformation (5) . Down-regulation of apoptosis can prolong the normal cellular life span, allowing cells to acquire mutations and facilitating tumor progression. BCL2 transgenic mice with targeted expression in myeloid cells develop a myeloproliferative condition analogous to human chronic myelomonocytic leukemia; however, they rarely go on to develop acute leukemia. Interestingly, when mice constitutively expressing BCL2 are crossed onto a FAS-/- background, approximately 15% develop AML, implicating FAS-mediated apoptosis in the pathogenesis of AML (6) . Myeloblasts are known to express high levels of FAS, and functional deficiencies of FAS signaling have been shown to be important in several subtypes of AML, providing further evidence for FAS-mediated apoptosis in the etiology of AML (7) . FAS expression levels may be affected by mutations or polymorphisms in the promoter region of FAS, particularly when they affect transcription factor binding sites. We have developed a TaqMan-based assay and used an established RFLP assay (8) to determine the frequency of the polymorphisms at -1377 and -670 bp of the FAS promoter in a series of AML cases and controls. We have examined haplotype frequencies using maximum likelihood methods and log-linear modeling to determine the risk of AML. Our data indicate that haplotypes that include -1377A have a significantly increased risk of AML compared with the control population. An examination of the functional consequences of these polymorphisms revealed that both -1377 and -670 bp affect transcription factor binding sites within the FAS gene promoter.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Study Design.
All samples included in this study were derived from the Leukaemia Research Fund population-based case-control study of adult acute leukemia conducted in the United Kingdom from April 1991 to December 1996. Further details of study design are given elsewhere (9) . Participation rate, sample collection, and sample processing have been reported previously (10) .

TaqMan-based Allelic Discrimination.
A total of 471 of 479 AML cases and 931 of 952 controls were successfully genotyped for the -1377 bp FAS promoter polymorphism. An additional 21 control samples (2.2%) and 8 cases (1.6%) could not be amplified. Oligonucleotide primers and probes were designed using Primer Express software (Applied Biosystems, Warrington, United Kingdom). Allele-specific probes were labeled with either FAM (AAGACCCTGGGTGTGCCAGCCT) or VIC (CCCTGGGCGTGCCAGCCT). PCR oligonucleotide primers spanning the -1377 polymorphism were as follows: FAS-F, CTATTAGATGCTCAGAGTGTGTGCA; and FAS-R, GCTTGTCTCTGTTCCACCTTTCA. Standard TaqMan cycling conditions were used, incorporating 40 cycles with an annealing temperature of 61°C.

RFLP-based Genotyping.
A total of 454 of 479 cases and 934 of 952 controls were successfully genotyped for the -670 bp FAS promoter polymorphism as described elsewhere (8) . ScrFI-digested PCR products were separated on 2.5% agarose gels, stained with ethidium bromide, and visualized under UV light.

Genotype Verification.
TaqMan-based genotyping was verified in 10% of randomly chosen samples by allele-specific PCR. Oligonucleotide primers specific for the -1377G allele (ATGAGGAAGACCCTGGGC) or -1377A allele (ATGAGGAAGACCCTGGGT) were used with a common oligonucleotide primer (CTATTAGATGCTCAGAGTGTGTGCA) in an allele-specific PCR reaction (95°C for 10 min followed by 45 cycles of 95°C for 20 s, 58°C for 20 s) using Stoffel Gold enzyme (a kind gift from Roche Molecular Systems; Ref. 11 ). Final confirmation of both the -1377 and -670 bp genotyping assays was obtained in a random selection of 47 samples using DNA sequencing (Big Dye Terminator; Applied Biosystems Inc.) and analyzed using the Sequence Analysis program (Applied Biosystems Inc.).

Statistical Analysis.
ORs and 95% CIs were derived using unconditional logistic regression with all available controls adjusting for age, sex, and region of residence. Maximum likelihood regression of haplotype frequencies was conducted using the Hapipf function in Stata (12) , and ORs were derived using log-linear modeling (version 7; Stata Corp.).

EMSA.
Oligonucleotide probes representing the -1377A allele (GGCTGGCACACCCAGGGTCTTC), -1377G allele (GGCTGGCACGCCCAGGGTCTTC), -670G allele (TGTCCATTCCAGGAACGTCTG), or -670A allele (TGTCCATTCCAGAAACGTCTG) were end-labeled using [{gamma}-32P]ATP (ICN, Basingstoke, United Kingdom) and polynucleotide kinase (Promega, Southampton, United Kingdom). A consensus SP1 site (GGCACGCCCA) was contained within the -1377G oligonucleotide probe, whereas a consensus STAT1 binding site was contained within the -670G oligonucleotide probe (TTCCAGGAA). Oligonucleotides were annealed to their complementary sequence by heating to 95°C for 10 min followed by cooling overnight. For -1377 bp EMSAs, K562 cells were grown to 106 cells/ml in RPMI 1640 containing 2 mM L-glutamine and 10% fetal bovine serum. Nuclear protein extracts were made as described elsewhere (13) using 107 cells. Determination of protein concentration was carried out using the Bradford reagent according to the manufacturer’s instructions (Bio-Rad, Hemel Hempstead, United Kingdom). For -670 bp EMSAs, phorbol ester-treated HeLa nuclear extract was used (Autogen Bioclear, United Kingdom Ltd., Wiltshire, United Kingdom).

EMSAs were carried out using the Gel Shift Assay System (Promega). For each lane, 10 µg of nuclear lysate were incubated with 4 ng of labeled double-stranded oligonucleotide primers for 30 min at room temperature followed by the addition of 20 µl of 80% glycerol. Samples containing antibodies were preincubated for 30 min with anti-SP1 or anti-STAT1 antibody (Autogen Bioclear United Kingdom Ltd.) before the addition of labeled oligonucleotide. DNA-protein complexes were resolved on a 6% polyacrylamide gel (Sigma, Dorset, United Kingdom) and run at 140 V for 3 h in 0.5x Tris-borate EDTA (Invitrogen Ltd., Paisley, United Kingdom).


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
FAS Genotype at -1377 and -670 bp.
Allele and genotype frequencies for the -1377 and -670 bp polymorphisms are shown in Table 1Citation . Both alleles within either the case or control group are in Hardy-Weinberg equilibrium at -1377 bp and -670 bp; however, at -1377 bp, the allele frequencies are significantly different in cases compared with controls ({chi}2 = 17.1; P = 0.0002), suggesting a link with risk of AML. There was an increased risk of AML associated with heterozygotes at -1377 bp (28.9%) compared with controls (20.0%; OR, 1.66; 95% CI, 1.29–2.15). The risk associated with AA homozygotes at -1377 bp in the case population (3.4%) is also higher than that in the control population (2.0%; OR, 1.92; 95% CI, 0.97–3.78). The narrow CIs indicate that these results are both accurate and precise. These data suggest that an increased risk of developing AML is associated with inheritance of the -1377A allele in a dose-dependent manner. The associated risk of AML when carrying an adenine residue at -1377 bp was shown to be independent of age, sex, and region (data not shown). In contrast, no significant differences in genotype distribution between AML cases and controls were observed at -670 bp (Table 1)Citation . Previous studies have shown that GSTT1-null and GSTM1-null genotypes and tobacco smoking were each associated with risk of AML (9 , 10) . However, our findings remained unchanged when these additional factors were adjusted for (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 1 FAS -1377 bp and -670 bp genotype distributions of controls and AML cases, with ORs and 95% CIs

 
Haplotype Analysis.
The distribution of -1377 bp/-670 bp haplotypes (Table 2)Citation was significantly different in cases compared with controls for both the -1377A/670G haplotype (OR, 1.44; 95% CI, 1.11–1.87) and the -1377A/-670A haplotype (OR, 6.72; 95% CI, 3.12–14.51). Although the genotype at -670 bp is not independently associated with risk, haplotype analysis reveals that in the presence of -1377A, -670A increases the risk of AML much more than -670G.


View this table:
[in this window]
[in a new window]

 
Table 2 FAS -1377/-670 haplotype frequency distribution of controls and AML cases

 
DNA Binding at -1377 and -670 bp of the FAS Promoter.
Having demonstrated an association of the FAS promoter polymorphisms with risk of developing AML, we sought to define the functionality of the different alleles. Using EMSAs, we have shown that -1377A has a greatly reduced ability to bind the transcription factor SP1 compared with -1377G (Fig. 1A)Citation . The signal produced by -1377G can be supershifted by addition of anti-SP1 antibody (Lane 6). The -1377G signal can be completely eliminated when the extract is incubated with a 250-fold excess of unlabeled -1377G oligonucleotide (Lane 7) but is only reduced in the presence of a 250-fold excess of unlabeled -1377A oligonucleotide (Lane 8), providing further evidence that the A variant is less efficient at binding SP1.



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, DNA binding activity at -1377 of the FAS promoter. Extracts of K562 (20 µg/lane) were incubated with radioactively labeled oligonucleotide probes containing either the A (Lanes 1–4) or G variant (Lanes 5–8) at position 10. Lane 1, extract incubated with labeled A probe; Lane 2, extract incubated with labeled A probe and anti-SP1; Lane 3, extract incubated with labeled A probe and 250-fold excess of unlabeled A probe; Lane 4, extract incubated with 250-fold excess of unlabeled G probe; Lane 5, extract incubated with labeled G probe; Lane 6, extract incubated with labeled G probe and anti-SP1; Lane 7, extract incubated with labeled G probe and 250-fold excess of unlabeled G probe; Lane 8, extract incubated with labeled G probe and 250-fold excess of unlabeled A probe. Arrowhead shows bandshift when SP1 binds to the probe. Arrows indicate supershifted bands with anti-SP1. B, DNA binding activity at -670 of the FAS promoter. Extracts of phorbol ester-treated HeLa nuclear extract (20 µg/lane) were incubated with radioactively labeled oligonucleotide probes containing either the A (Lanes 1–4) or G variant (Lanes 5–8) at position 10. Lane 1, extract incubated with labeled A probe; Lane 2, extract incubated with labeled A probe and anti-STAT1; Lane 3, extract incubated with labeled A probe and 125-fold excess of unlabeled A probe; Lane 4, extract incubated with 125-fold excess of unlabeled G probe; Lane 5, extract incubated with labeled G probe; Lane 6, extract incubated with labeled G probe and anti-STAT1; Lane 7, extract incubated with labeled G probe and 125-fold excess of unlabeled G probe; Lane 8, extract incubated with labeled G probe and 125-fold excess of unlabeled A probe. Arrowhead shows bandshift when STAT1 binds to the probe.

 
The -670 bp polymorphism is located within a STAT1 binding site (Fig. 1B)Citation . Both -670A and -670G alleles can bind STAT1 (Lanes 1 and 5), producing similar intensity bands. This experiment was repeated several times with no detectable difference in band intensity between -670A and -670G. Competition using either a 125-fold excess of unlabeled -670A or a 125-fold excess of -670G completely eliminated the signal produced by -670A or -670G, suggesting that both variants can bind STAT1 equally well. Addition of anti-STAT1 antibody disrupts the signal and reduces the intensity of the band (Lanes 2 and 6).


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We have demonstrated that the risk of developing AML is associated with the -1377 bp polymorphism in the promoter region of the FAS gene, which affects a SP1 transcription factor binding site. Individuals homozygous for adenine at -1377 bp are almost twice as likely to develop AML (OR, 1.92; 95% CI, 0.97–3.78), with heterozygotes having an intermediate risk (OR, 1.66; 95% CI, 1.29–2.15) compared with individuals homozygous for guanine. However, there was no evidence of an increased risk of AML associated with the -670 bp polymorphism (Table 1)Citation . Work from other laboratories has shown that the genotype at -670 bp is associated with cervical squamous cell carcinoma (14) and Alzheimer’s disease (15) , whereas the -1377 bp genotype showed no association with disease (16 , 17) . Haplotype analysis (Table 2)Citation reveals that the risk of AML is driven by the presence of the -1377A allele, with the -1377A/670A haplotype conferring the highest risk (OR, 6.72; 95% CI, 3.12–14.51).

Previous studies have suggested that cytogenetics can be used to define distinct subgroups of AML with different prognoses and age distributions (18) . Using cytogenetic data from this study, we separated the data set into five cytogenetic subgroups: normal karyotype; translocation; trisomy 8; deletions of 5q/7q; or other. Comparison of the FAS -1377 bp and -670 bp genotypes across these groups revealed no significant associations of genotype with karyotype (data not shown), suggesting that the risk associated with polymorphisms in the FAS promoter is not restricted to a particular AML subtype and that the downstream effects of genetic variation in the promoter are likely to be exerted via mechanisms common to all subtypes.

The genotype frequencies in our control population at both -1377 bp and -670 bp are in good agreement with previous studies (16 , 19) . To our knowledge, haplotype frequencies have only been reported in one other study examining systemic lupus erythematosus cases in a Japanese population (17) , but, as would be expected, allele and genotype frequencies in the control population were different from those obtained in this study; hence direct comparisons cannot be made.

Detection bias, in which one allele is more efficiently amplified or detected than another, in large genotyping studies has been reported in the literature, as have false associations in small studies (20) . The large size of this study, combined with a rigorous verification of TaqMan and RFLP-based genotyping using allele-specific PCR and direct sequencing, has ensured that accurate genotype frequencies have been calculated. For studies claiming association of specific polymorphisms with a biological effect, it is also important to be able to demonstrate a potential mechanism of action. In this study, we have confirmed that the -1377 and -670 bp polymorphisms occur within transcription factor binding sites and bind SP1 and STAT1, respectively. Moreover, we have shown that the presence of an adenine residue at position -1377 bp of the FAS promoter significantly reduces SP1 binding compared with a guanine residue. The SP1 site at -1377 bp lies between two putative silencer regions, although the site itself is not within a known silencer consensus sequence (21) . SP1 binding is associated with transcriptional activation (22) , and we postulate that reduced SP1 binding at -1377 bp in the FAS promoter results in a decrease in FAS expression. Although the allele and genotype frequencies at -670 bp in the case and control populations are not significantly different, haplotype analysis reveals that the -1377A/-670A haplotype increases the risk of AML six times above those with -1377G/1377G. Hence the -670A allele appears to modulate risk of AML when associated with -1377A, but not when associated with -1377G. Previous work has suggested that STAT1 binding alone cannot be equated with a biological function and that concomitant SP1 binding may be required to achieve transcriptional activation (23) . This complex association at the protein level may explain why the -1377A/-670A haplotype shows such an increased risk of AML.

The importance of FAS in hematopoietic tissues is illustrated by the mouse lpr model. Mutations in FAS lead to lymphadenopathy, systemic lupus erythromatosus, and an increase in the incidence of B-cell lymphoma (2) . Autoimmunity and related conditions are believed to be due to a failure of T cells to undergo negative selection during development, where efficient apoptosis is crucial in the removal of autoreactive lymphocytes (3) . Loss of function mutations in FAS and components of the FAS apoptotic pathway have also been implicated in myeloid malignancies (24) . lpr mice that constitutively express the Bcl-2 proto-oncogene develop murine AML, whereas constitutive Bcl-2 expression alone does not result in malignancy (6) . These studies suggest that FAS is one of several genes critical to normal myeloid differentiation, potentially regulating myeloid expansion. Our study has shown that the -1377 bp FAS promoter polymorphism is associated with an increased risk of AML. Furthermore, we have shown that the presence of an adenine residue rather than a guanine residue at -1377 bp significantly attenuates transcription factor SP1 binding and may contribute to a reduction in FAS expression and ultimately to the enrichment of apoptosis-resistant clones in AML.


    ACKNOWLEDGMENTS
 
We thank all of the people who kindly participated in the Leukaemia Research Fund case-control study of acute leukemia in adults, along with Jan Parker and all of the consultants and staff.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Leukaemia Research Fund of Great Britain and Yorkshire Cancer Research. C. F. S. and M. T. S. were supported by NIH Grant P30ES01896 and the National Foundation for Cancer Research. Back

2 To whom requests for reprints should be addressed. Phone/fax: 44-113-3433372; E-mail: k.sibley{at}lrf.leeds.ac.uk Back

3 Present address: Division of Environmental Health Sciences, School of Public Health, University of California, Berkeley, CA 94720-7360. Back

4 The abbreviations used are: AML, acute myeloid leukemia; STAT, signal transducers and activators of transcription; OR, odds ratio; CI, confidence interval; EMSA, electrophoretic mobility shift assay. Back

Received 3/31/03. Accepted 6/17/03.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Krammer P. H., Behrmann I., Daniel P., Dhein J., Debatin K. M. Regulation of apoptosis in the immune system. Curr. Opin. Immunol., 6: 279-289, 1994.[Medline]
  2. Muschen M., Warskulat U., Beckmann M. W. Defining CD95 as a tumor suppressor gene. J. Mol. Med., 78: 312-325, 2000.[Medline]
  3. Watanabe-Fukunaga R., Brannan C. I., Copeland N. G., Jenkins N. A., Nagata S. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature (Lond.), 356: 314-317, 1992.[Medline]
  4. Rieux-Laucat F., Le Deist F., Hivroz C., Roberts I. A., Debatin K. M., Fischer A., de Villartay J. P. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science (Wash. DC), 268: 1347-1349, 1995.[Abstract/Free Full Text]
  5. Delia D., Aiello A., Soligo D., Fontanella E., Melani C., Pezzella F., Pierotti M. A., Della Porta G. bcl-2 proto-oncogene expression in normal and neoplastic human myeloid cells. Blood, 79: 1291-1298, 1992.[Abstract/Free Full Text]
  6. Traver D., Akashi K., Weissman I. L., Lagasse E. Mice defective in two apoptosis pathways in the myeloid lineage develop acute myeloblastic leukemia. Immunity, 9: 47-57, 1998.[Medline]
  7. Komada Y., Zhou Y. W., Zhang X. L., Xue H. L., Sakai H., Tanaka S., Sakatoku H., Sakurai M. Fas receptor (CD95)-mediated apoptosis is induced in leukemic cells entering G1B compartment of the cell cycle. Blood, 86: 3848-3860, 1995.[Abstract/Free Full Text]
  8. Huang Q. R., Morris D., Manolios N. Identification and characterization of polymorphisms in the promoter region of the human Apo-1/Fas (CD95) gene. Mol. Immunol., 34: 577-582, 1997.[Medline]
  9. Kane E. V., Roman E., Cartwright R., Parker J., Morgan G. Tobacco and the risk of acute leukaemia in adults. Br. J. Cancer, 81: 1228-1233, 1999.[Medline]
  10. Rollinson S., Roddam P., Kane E., Roman E., Cartwright R., Jack A., Morgan G. J. Polymorphic variation within the glutathione S-transferase genes and risk of adult acute leukaemia. Carcinogenesis (Lond.), 21: 43-47, 2000.[Abstract/Free Full Text]
  11. Germer S., Holland M. J., Higuchi R. High-throughput SNP allele-frequency determination in pooled DNA samples by kinetic PCR. Genome Res., 10: 258-266, 2000.[Abstract/Free Full Text]
  12. Mander A. Haplotype frequency estimation using an EM algorithm and log linear modeling. Stata Technical Bulletin, 57: 5-7, 2000.
  13. Andrews N. C., Faller D. V. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res., 19: 2499 1991.[Free Full Text]
  14. Lai H. C., Sytwu H. K., Sun C. A., Yu M. H., Yu C. P., Liu H. S., Chang C. C., Chu T. Y. Single nucleotide polymorphism at Fas promoter is associated with cervical carcinogenesis, Int. J. Cancer, 103: 221-225, 2003.
  15. Feuk L., Prince J. A., Blennow K., Brookes A. J. Further evidence for role of a promoter variant in the TNFRSF6 gene in Alzheimer disease. Hum. Mutat., 21: 53-60, 2003.[Medline]
  16. Huang Q. R., Manolios N. Investigation of the -1377 polymorphism on the Apo-1/Fas promoter in systemic lupus erythematosus patients using allele-specific amplification. Pathology, 32: 126-130, 2000.[Medline]
  17. Kanemitsu S., Ihara K., Saifddin A., Otsuka T., Takeuchi T., Nagayama J., Kuwano M., Hara T. A functional polymorphism in fas (CD95/APO-1) gene promoter associated with systemic lupus erythematosus. J. Rheumatol., 29: 1183-1188, 2002.[Abstract/Free Full Text]
  18. Moorman A. V., Roman E., Willett E. V., Dovey G. J., Cartwright R. A., Morgan G. J. Karyotype and age in acute myeloid leukemia. Are they linked?. Cancer Genet. Cytogenet., 126: 155-161, 2001.[Medline]
  19. Lee Y. H., Kim Y. R., Ji J. D., Sohn J., Song G. G. Fas promoter -670 polymorphism is associated with development of anti-RNP antibodies in systemic lupus erythematosus. J. Rheumatol., 28: 2008-2011, 2001.[Abstract/Free Full Text]
  20. Bonnici F., Keavney B., Collins R., Danesh J. Angiotensin converting enzyme insertion or deletion polymorphism and coronary restenosis: meta-analysis of 16 studies. Br. Med. J., 325: 517-519, 2002.[Abstract/Free Full Text]
  21. Rudert F., Visser E., Forbes L., Lindridge E., Wang Y., Watson J. Identification of a silencer, enhancer, and basal promoter region in the human CD95 (Fas/APO-1) gene. DNA Cell Biol., 14: 931-937, 1995.[Medline]
  22. Pugh B. F., Tjian R. Mechanism of transcriptional activation by Sp1: evidence for coactivators. Cell, 61: 1187-1197, 1990.[Medline]
  23. Look D. C., Pelletier M. R., Tidwell R. M., Roswit W. T., Holtzman M. J. Stat1 depends on transcriptional synergy with Sp1. J. Biol. Chem., 270: 30264-30267, 1995.[Abstract/Free Full Text]
  24. Robertson M. J., Manley T. J., Pichert G., Cameron C., Cochran K. J., Levine H., Ritz J. Functional consequences of APO-1/Fas (CD95) antigen expression by normal and neoplastic hematopoietic cells. Leuk. Lymphoma, 17: 51-61, 1995.[Medline]



This article has been cited by other articles:


Home page
Hum ReprodHome page
G. Ji, A. Gu, F. Hu, S. Wang, J. Liang, Y. Xia, C. Lu, L. Song, G. Fu, and X. Wang
Polymorphisms in cell death pathway genes are associated with altered sperm apoptosis and poor semen quality
Hum. Reprod., June 20, 2009; (2009) dep223v1.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Z. Zhang, H. Xue, W. Gong, M. Wang, L. Yuan, S. Han, and Z. Zhang
FAS promoter polymorphisms and cancer risk: a meta-analysis based on 34 case-control studies
Carcinogenesis, March 1, 2009; 30(3): 487 - 493.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Y. Park, W.-K. Lee, D.-K. Jung, J.-E. Choi, T.-I. Park, E.-B. Lee, S. Cho, J.-Y. Park, S.-I. Cha, C.-H. Kim, et al.
Polymorphisms in the FAS and FASL Genes and Survival of Early Stage Non-small Cell Lung Cancer
Clin. Cancer Res., March 1, 2009; 15(5): 1794 - 1800.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. A. Mehta, R. B. Gerbing, T. A. Alonzo, J. S. Elliott, T. A. Zamzow, M. Combs, E. Stover, J. A. Ross, J. P. Perentesis, S. Meschinchi, et al.
FAS Promoter Polymorphism: Outcome of Childhood Acute Myeloid Leukemia. A Children's Oncology Group Report
Clin. Cancer Res., December 1, 2008; 14(23): 7896 - 7899.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Ter-Minassian, R. Zhai, K. Asomaning, L. Su, W. Zhou, G. Liu, R. S. Heist, T. J. Lynch, J. C. Wain, X. Lin, et al.
Apoptosis gene polymorphisms, age, smoking and the risk of non-small cell lung cancer
Carcinogenesis, November 1, 2008; 29(11): 2147 - 2152.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Yang, T. Sun, L. Wang, D. Yu, X. Zhang, X. Miao, J. Liu, D. Zhao, H. Li, W. Tan, et al.
Functional Variants in Cell Death Pathway Genes and Risk of Pancreatic Cancer
Clin. Cancer Res., May 15, 2008; 14(10): 3230 - 3236.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. Farre, A. L. Bittencourt, G. Silva-Santos, A. Almeida, A. C. Silva, D. Decanine, G. M. Soares, L. C. Alcantara Jr., S. Van Dooren, B. Galvao-Castro, et al.
Fas-670 promoter polymorphism is associated to susceptibility, clinical presentation, and survival in adult T cell leukemia
J. Leukoc. Biol., January 1, 2008; 83(1): 220 - 222.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
K. D. Crew, M. D. Gammon, M. B. Terry, F. F. Zhang, M. Agrawal, S. M. Eng, S. K. Sagiv, S. L. Teitelbaum, A. I. Neugut, and R. M. Santella
Genetic polymorphisms in the apoptosis-associated genes FAS and FASL and breast cancer risk
Carcinogenesis, December 1, 2007; 28(12): 2548 - 2551.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
B. Zhang, T. Sun, L. Xue, X. Han, B. Zhang, N. Lu, Y. Shi, W. Tan, Y. Zhou, D. Zhao, et al.
Functional polymorphisms in FAS and FASL contribute to increased apoptosis of tumor infiltration lymphocytes and risk of breast cancer
Carcinogenesis, May 1, 2007; 28(5): 1067 - 1073.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Z. Zhang, L.-E Wang, E. M. Sturgis, A. K. El-Naggar, W. K. Hong, C. I. Amos, M. R. Spitz, and Q. Wei
Polymorphisms of FAS and FAS Ligand Genes Involved in the Death Pathway and Risk and Progression of Squamous Cell Carcinoma of the Head and Neck.
Clin. Cancer Res., September 15, 2006; 12(18): 5596 - 5602.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Wang, S. Ngoi, J. Wang, S. S. Chong, and C. G. L. Lee
The Promoter Region of the MDR1 Gene Is Largely Invariant, but Different Single Nucleotide Polymorphism Haplotypes Affect MDR1 Promoter Activity Differently in Different Cell Lines
Mol. Pharmacol., July 1, 2006; 70(1): 267 - 276.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Y. Park, J. M. Park, J. S. Jang, J. E. Choi, K. M. Kim, S. I. Cha, C. H. Kim, Y. M. Kang, W. K. Lee, S. Kam, et al.
Caspase 9 promoter polymorphisms and risk of primary lung cancer
Hum. Mol. Genet., June 15, 2006; 15(12): 1963 - 1971.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Sun, Y. Zhou, H. Li, X. Han, Y. Shi, L. Wang, X. Miao, W. Tan, D. Zhao, X. Zhang, et al.
FASL -844C polymorphism is associated with increased activation-induced T cell death and risk of cervical cancer
J. Exp. Med., October 3, 2005; 202(7): 967 - 974.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Wang and M. You
Five Loci, SLT1 to SLT5, Controlling the Susceptibility to Spontaneously Occurring Lung Cancer in Mice
Cancer Res., September 15, 2005; 65(18): 8158 - 8165.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
X Zhang, X Miao, T Sun, W Tan, S Qu, P Xiong, Y Zhou, and D Lin
Functional polymorphisms in cell death pathway genes FAS and FASL contribute to risk of lung cancer
J. Med. Genet., June 1, 2005; 42(6): 479 - 484.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
P. Krippl, U. Langsenlehner, W. Renner, H. Koppel, and H. Samonigg
Re: Polymorphisms of Death Pathway Genes FAS and FASL in Esophageal Squamous-Cell Carcinoma
J Natl Cancer Inst, October 6, 2004; 96(19): 1478 - 1479.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
T. Sun, X. Miao, X. Zhang, and D. Lin
RESPONSE: Re: Polymorphisms of Death Pathway Genes FAS and FASL in Esophageal Squamous-Cell Carcinoma
J Natl Cancer Inst, October 6, 2004; 96(19): 1479 - 1479.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
T. Sun, X. Miao, X. Zhang, W. Tan, P. Xiong, and D. Lin
Polymorphisms of Death Pathway Genes FAS and FASL in Esophageal Squamous-Cell Carcinoma
J Natl Cancer Inst, July 7, 2004; 96(13): 1030 - 1036.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. Rollinson, J. M. Allan, G. R. Law, P. L. Roddam, M. T. Smith, C. Skibola, A. G. Smith, M. S. Forrest, K. Sibley, R. Higuchi, et al.
High-Throughput Association Testing on DNA Pools to Identify Genetic Variants that Confer Susceptibility to Acute Myeloid Leukemia
Cancer Epidemiol. Biomarkers Prev., May 1, 2004; 13(5): 795 - 800.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sibley, K.
Right arrow Articles by Morgan, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sibley, K.
Right arrow Articles by Morgan, G. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online