
[Cancer Research 63, 4607-4613, August 1, 2003]
© 2003 American Association for Cancer Research
Molecular Biology and Genetics |
Cell Cycle-dependent Regulation of the Skp2 Promoter by GA-binding Protein1
Hiroyuki Imaki,
Keiko Nakayama,
Sophie Delehouzee,
Hiroshi Handa,
Masatoshi Kitagawa2,
Takumi Kamura and
Keiichi I. Nakayama3
Departments of Molecular and Cellular Biology [H. I., M. K., T. K., K. I. N.] and Molecular Genetics [K. N., K. I. N.], Medical Institute of Bioregulation, Kyushu University, Fukuoka, Fukuoka 812-8582; CREST, Japan Science and Technology Corporation, Kawaguchi, Saitama 332-0012 [H. I., K. N., M. K., T. K., K. I. N.]; and Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Kanagawa 226-8501 [S. D., H. H.], Japan
 |
ABSTRACT
|
|---|
Skp2 is the F-box protein component of an SCF-type ubiquitin ligase that interacts specifically with p27Kip1 and thereby promotes its ubiquitylation and degradation. The abundance of Skp2 mRNA oscillates in a cell cycle-dependent manner, being maximal in S and G2 phases. The regulation of Skp2 transcription was investigated by cloning the promoter region of the mouse gene and determination of its activity in a luciferase reporter assay. Deletion analysis identified a minimal
0.3-kb promoter region with marked transcriptional activity and a 105-bp essential sequence within this region. Electrophoretic mobility shift assays indicated the presence in nuclear extracts of proteins that bind to this sequence. Site-directed mutagenesis revealed that the core binding motif, CACTTCCG, which is similar to that of GA-binding protein (GABP), is essential for Skp2 transcription. "Supershift" analysis indicated that the protein-probe complexes detected by electrophoretic mobility shift assays contain GABP. Endogenous GABP bound to Skp2 promoter element in a cell cycle-dependent manner. Furthermore, overexpression of GABPß increased Skp2 promoter activity, and suppression of GABP
or GABPß by a small interfering RNA resulted in the reduction of Skp2 promoter activity. These data suggest that the cell cycle-dependent binding of GABP to the Skp2 promoter plays an important role in the regulation of Skp2 expression and cell cycle progression from G1 to S phase.
 |
INTRODUCTION
|
|---|
The ubiquitin-proteasome pathway of protein degradation plays an important role in control of the abundance of short-lived regulatory proteins (1
, 2)
. Protein ubiquitylation is mediated by several components that act in concert (3
, 4)
. A ubiquitin-activating enzyme (E1) with ATP as a substrate, catalyzes the formation of a thioester bond between itself and ubiquitin, and it then transfers the activated ubiquitin to a ubiquitin-conjugating enzyme (E2). Certain 17ß-estradiol enzymes transfer ubiquitin directly to the protein substrate, whereas others require the participation of a third component, termed a ubiquitin ligase (E3), to achieve this effect.
SCF complex, an E3 ligase, consists of the invariable components Skp1, Cul1, and Rbx1 (Roc1/Hrt1) as well as a variable component, known as an F-box protein, that binds to Skp1 through its F-box motif and is responsible for substrate recognition (5, 6, 7)
. Skp2, which contains an F-box domain followed by leucine-rich repeats, was originally identified as a protein that interacts with the cyclin A-CDK24
complex (8)
. More recently, however, Skp2 has been implicated in the ubiquitin-mediated degradation of p27Kip1 (9
, 10)
. We have generated Skp2-deficient mice and shown that they exhibit cellular accumulation of p27Kip1, a reduction in both body size and the size of individual organs, an increase in the mass of individual cells, polyploidy, and multiple centrosomes per cell (11)
. These observations suggest that SCFSkp2 is the principal ubiquitin ligase responsible for determination of the abundance of cell cycle regulatory proteins during progression of cells from G1 to S phase. The expression of Skp2 has been shown recently to correlate inversely with that of p27Kip1 and to define cells in S phase in human sarcomas and other cancers (12, 13, 14, 15, 16, 17)
. Mice transgenic for Skp2 in the T-lymphocyte lineage also exhibit an increased susceptibility to the development of lymphoma (14)
. Thus, the deregulation of Skp2 expression may lead to carcinogenesis.
Although the abundance of the SCFSkp2 components Skp1, Cul1, and Rbx1 does not change substantially during the cell cycle, the amount of Skp2 varies in a cell cycle-dependent manner. Skp2 is first detectable at the transition between G1 and S phases, accumulates during S and G2 phases, and then decreases in abundance as cells proceed through M phase. Both transcriptional and post-translational regulation are thought to underlie these changes. Thus, the abundance of Skp2 mRNA is periodic in HeLa cells (8)
and NIH 3T3 cells (this study), whereas the concentration of Skp2 is regulated mainly by ubiquitylation-mediated protein degradation (as well as by transcriptional control) in other cell types (18)
.
To explore the molecular basis for the cell cycle-dependent oscillation of Skp2 mRNA, we have now characterized the promoter region of Skp2. We have identified a minimal promoter region and a transcription factor, GABP (19, 20, 21)
, which binds to its core sequence. Our results suggest that the cell cycle-dependent binding of GABP regulates Skp2 expression and cell cycle progression from G1 to S phase.
 |
MATERIALS AND METHODS
|
|---|
Plasmids.
Mouse Skp2-pGL hybrids for luciferase assays were constructed from pGL2-basic (Promega). To generate pGL22275, we excised the DNA fragment corresponding to nts -2275 to +94 (numbered relative to the transcription initiation site) of the 5' flanking sequence of Skp2 from pBlue-2.4k (11)
with the use of ApaI. The fragment was purified by electrophoresis, rendered blunt-ended, and cloned into the SmaI site of pGL2-basic. The plasmid pGL2318 was constructed from pGL22275 by removing the fragment comprising nt -2275 to m319 of Skp2 with the use of HindIII. For the construction of pGL2 -207, pGL2 -102, and pGL2 + 6, the DNA fragments comprising nts -207 to +94, -102 to +94, and +6 to +94, respectively, of Skp2 were amplified by PCR with pBlue-2.4k as the template, sense primers that correspond to nts -207 to -184 (5'-AGTCAATCGGCTGACATTTCCCAG-3'), -102 to -79 (5'-GAGTTGTGGGTATCTGGAGGGTTG-3'), and +6 to +29 (5'-AAGGCGGCTGCTGGAGAGCGGGAT-3'), and an antisense primer corresponding to nts +71 to +94 (5'-GGGCCCCAGCAGTTGGACCCGCGA). A XhoI linker was incorporated at the 5' end of the sense primers and a HindIII linker at the 3' end of the antisense primer. The PCR products were digested with XhoI and HindIII, and then subcloned into the XhoI-HindIII site of pGL2-basic.
To generate pBlue -207/-103, we amplified the DNA fragment comprising nts -207 to -103 of Skp2 by PCR with pBlue-2.4k as the template, a sense primer corresponding to nts -207 to -188 (5'-AGTCAATCGGCTGACATTTC-3'), and an antisense primer corresponding to nts -122 to -103 (5'-CCTGCGGCGCCGGGCGGGAT-3'). An EcoRI linker was incorporated at the 5' end of the sense primer and a NotI linker at the 3' end of the antisense primer. The PCR product was digested with EcoRI and NotI, and then subcloned into the corresponding sites of pBluescriptII SK+ (Stratagene).
The mutated constructs pGL2 -207M1, pGL2 -207M2, and pGL2 -207M3 were generated with the use of a Quickchange mutagenesis kit (Stratagene) and the primers M1QC+ (5'-GAGCTCCACCCTCATCCGCCTGTCC-3'), M1QC- (5'-GGACAGGCGGATGAGGGTGGAGCTC-3'), M2QC+ (5'-GAGCTCCACCCATAACCGCCTGTCCTC-3'), M2QC- (5'-GAGGACAGGCGGTTATGGGTGGAGCTC-3'), M3QC+ (5'-CCACCCACTTCAGCCTGCCTGTCC-3'), and M3QC- (5'-GGACAGGCAGGCTGAAGTGGGTGG-3'). The sequences of the mutated constructs were verified by DNA sequence analysis (Amersham Pharmacia Biotech).
The expression vectors pCAGGS-GABP
and pCAGGS-GABPß were generated as described previously (22)
.
Northern Blot Analysis.
The Northern blot analysis was performed as described previously (23)
.
Cell Culture and Cell Cycle Analysis.
Mouse NIH 3T3 cells were maintained in DMEM supplemented with 10% calf serum (Life Technologies, Inc.). Human HeLa and T98G cells were maintained in DMEM supplemented with 10% fetal bovine serum (Life Technologies, Inc.). The growth of NIH 3T3 and T98G cells was arrested by incubation for
72 h in DMEM without serum; the cells were subsequently stimulated by the addition of calf serum or fetal bovine serum, respectively, to a final concentration of 10%.
For cell cycle analysis, single-cell suspensions of NIH 3T3 or T98G cells were fixed in 70% ethanol overnight at -20°C and then stained with propidium iodide (5 µg/ml). The cells were then analyzed with a FACSCalibur flow cytometer and with Cell Quest and Modifit LT software (Becton Dickinson).
Luciferase Reporter Assays.
HeLa cells or NIH 3T3 cells(1 x 105
/well of a six-well plate) were transiently transfected with 2 µg of luciferase construct and 0.1 µg of pRL-Tk or pRL-CMV plasmid DNA (Promega) with the use of the FUGENE6 transfection reagent (Roche). Transfection was performed with at least three different batches of each reporter plasmid. Where indicated, cells were transfected with pCAGGS-GABP
or pCAGGS-GABPß in addition to 1 µg of pGL2 -207 and 0.1 µg of pRL-Tk. After incubation for 48 h, the cells were harvested with Passive Lysis Buffer (Promega), and luciferase activities of cell extracts were measured with the use of the Dual luciferase assay system (Promega). Luciferase activity was expressed as the ratio of LucF activity:LucR activity.
Preparation of Nuclear Extracts, in Vitro Translation, and EMSA Analysis.
Nuclear extracts of HeLa and T98G cells were prepared as described previously (24)
, and portions were stored at -80°C. In vitro translated proteins were prepared by using 1 µg of pET3d plasmids containing each cDNA for GABP
, GABPß, or GABP
in the TNT T7-coupled reticulocyte lysate system (Promega). EMSA analysis was performed as described previously (25)
. For "supershift" analysis, 1 µg of antibodies to GABP
, to GABPß/
(20)
, or to Elk-1 (Santa Cruz Biotechnology) was added to the reaction mixture. For generation of the -207/-103, -207/-177, and -177/-103 probes, the corresponding DNA fragments were excised from pBlue -207/-103 by double digestion with EcoRI and NotI, with EcoRI and SacI, or with SacI and NotI, respectively, and were purified by electrophoresis on a 1.5% agarose gel. The oligonucleotides -175/-153+ (5'-GGAGCTCCACCCACTTCCGCCTG-3'), -175/-153- (5'-GGCAGGCGGAAGTGGGTGGAGCT-3'), -152/-126+ (5'-GGTGTCCTCCTCCTCCTCCTCCTCCTCCT-3'), -152/-126- (5'-GGAGGAGGAGGAGGAGGAGGAGG AGGACA-3'), -125/-103+ (5'-GGTCAATCCCGCCCGGCGCCGCAGG-3'), -125/-103- (5'-GGCCTGCGGCGCCGGGCGGGATTGA-3'), NF-Y+ (5'-GGAGACCGTACGTGATTGGTTAATCTCTT-3'), and NF-Y- (5'-GGAAGAGATTAACCAATCACGTACGGTCT-3'), were chemically synthesized; the corresponding (+) and (-) oligonucleotides were annealed and labeled by filling in of the guanine-containing 5' overhangs with the use of the Klenow fragment (New England Biolabs) in the presence of [
-32P]dCTP (Amersham Biosciences).
Small interfering RNA (siRNA) Transfections.
RNA interference was performed as described previously (26)
. GABP
was targeted with the sequence AAAGCAGAGTGCACAGAAGAA, GABPß was targeted with the sequence AAATGGAGCTCCCTTTACTAC, and the GFP was targeted with the sequence AAGCTGACCCTGAAGTTCATC. Searches of the human genome database (BLAST) were carried out to ensure the sequences would not target other gene transcripts.
ChIPs.
The ChIP was performed with ChIP assay kit (Upstate), and the primers 5'-hSKP2ChIP (5'-AAAATCCGTCTACAGTCCAG-3') and 3'-hSKP2ChIP (5'-CCTTCGAGATACCCACAACC-3'). The 127-bp PCR product was analyzed by electrophoresis on a 1.5% agarose gel.
 |
RESULTS
|
|---|
Identification of a Positive Regulatory Element in the 5' Flanking Region of Skp2.
We first confirmed the cell-cycle dependence of Skp2 mRNA abundance by Northern blot analysis of synchronized cell populations (Fig. 1A)
. NIH 3T3 cells were synchronized in G0 phase by serum deprivation and then released from growth arrest by reexposure to serum. Cell synchronicity was monitored by flow cytometry (Fig. 1B)
in parallel with Northern analysis. The abundance of Skp2 mRNA was low in G0 phase, increased as cells entered mid-G1 phase, and peaked during S phase. Similar results were obtained with HeLa cells and T98G cells, although, consistent with previous observations (18)
, the basal amount of Skp2 mRNA in G0 phase was greater in T98G cells than in the other cell types (data not shown).

View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Cell cycle dependence of the abundance of Skp2 mRNA in NIH 3T3 cells. A, total RNA was isolated either from cells in asynchronous culture (AS) or from cells that had been synchronized by serum deprivation and subsequently released from growth arrest by reexposure to serum for the indicated times. RNA samples (40 µg) were subjected to Northern analysis with an [ -32P]dCTP-labeled mouse Skp2 cDNA probe (top panel). Equal application of samples was verified by staining of 28S rRNA with ethidium bromide (bottom panel). B, NIH 3T3 cells synchronized as in A were stained with propidium iodide and analyzed by flow cytometry. The percentages of cells in G0-G1, S, and G2-M phases of the cell cycle are shown.
|
|
We sequenced the 5' flanking region of mouse Skp2 (Fig. 2)
. To identify the transcriptional initiation site of the gene, we performed 5'-RACE (data not shown). Although a TATA box-like sequence is not apparent in the transcriptional initiation region, three GC boxes (Sp1 binding sites) are present upstream of the start site. In addition, potential binding sites for GABP (also known as E4TF1 or NRF-2; Refs. 20
, 27
, 28
), Taf-1 (29)
, and PacC (30)
are located at nts -166 to -159, -10 to -1, and -188 to -172, respectively.

View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. nt sequence of the 5' flanking region of mouse Skp2. The translational initiation codon (ATG) is indicated with an *, and the transcriptional start site (designated +1) is indicated with an arrowhead. Predicted binding sites for Taf-1, Sp1, and PacC are underlined, and a predicted binding motif for GABP is boxed. The 5' ends of deletion constructs studied in Fig. 3
are indicated above the sequence.
|
|
To identify sequences responsible for the transcriptional regulation of Skp2, we transiently transfected HeLa cells with various luciferase reporter constructs containing progressively truncated portions of the 5' flanking region of Skp2 and then measured the luciferase activity of cell extracts (Fig. 3)
. Cells transfected with pGL22275, containing nts -2275 to +94 of Skp2, exhibited a high level of luciferase activity. Deletion of the 5' flanking sequence from nts -2275 to -208 did not result in a reduction in luciferase activity, whereas deletion of this region to nt -103 resulted in an
80% decrease in activity. These results suggest that a cis element located between nts -207 and -103 is required for transcription of Skp2.

View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Analysis of promoter activity of the 5' flanking region of mouse Skp2. HeLa cells were cotransfected with 2 µg of a luciferase reporter plasmid containing one of the indicated fragments of the Skp2 promoter (left panel) and with 0.1 µg of pRL-Tk. Firefly luciferase activity was normalized by that of Renilla luciferase and then expressed relative to the normalized activity observed with pGL22275 (right panel). Data are means of values from three independent experiments; bars, ±SE.
|
|
Specific Binding of Nuclear Proteins to the Skp2 Core Promoter Region.
To characterize the proteins that interact with the Skp2 regulatory element, we performed EMSA analysis with a probe comprising nts -207 to -103 of the Skp2 promoter. We detected two protein-probe complexes (bands I and II) with nuclear extracts of HeLa cells (Fig. 4A)
, NIH 3T3 cells, or T98G cells (data not shown). Shorter exposure of the gels revealed that band I actually comprises two distinct bands of similar mobility (data not shown). Specificity of complex formation was suggested by the observation that a 200-fold molar excess of the corresponding unlabeled oligonucleotide markedly reduced the intensity of bands I and II (Fig. 4A)
. Furthermore, whereas an unlabeled oligonucleotide comprising nts -177 to -103 of Skp2 also greatly reduced the intensity of bands I and II, one corresponding to nts -207 to -177 did not. We next synthesized unlabeled oligonucleotides corresponding to nts -175 to -153, -152 to -126, or -125 to -103. Whereas the -175/-153 oligonucleotide prevented the formation of bands I and II, the -152/-126 and -125/-103 oligonucleotides had no such effect (Fig. 4B)
. These results thus suggest that a DNA binding protein (or proteins) specifically interacts with the upstream region of Skp2 comprising nts -175 to -153, which contains binding sites for Sp1 (-174 to -165) and GABP (-164 to -157).

View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Specific binding of nuclear proteins to the cis element of the Skp2 promoter. A and B, EMSA analysis was performed with [ -32P]dCTP-labeled -207/-103 (A) or -177/-103 (B) Skp2 probes and a nuclear extract of HeLa cells. The effects of a 200-fold molar excess of the indicated unlabeled oligonucleotides on protein-probe complex formation were determined. Arrowheads indicate specific DNA-protein complexes (bands I and II). C, schematic representation of oligonucleotides used as probes or competitors in A and B, and of the binding motifs for transcription factors in the corresponding region of the Skp2 promoter.
|
|
We introduced clustered mutations (M1, M2, and M3) into the GABP consensus motif of oligonucleotide -175/-153 and plasmid pGL2 -207 (Fig. 5A)
. The unlabeled mutant oligonucleotides did not affect the formation of bands I and II by the 32P-labeled -175/-153 probe (Fig. 5B)
. Furthermore, the luciferase activity of cells transfected with pGL2 -207 containing the mutations was reduced by 4575% compared with that of cells transfected with wild-type pGL2 -207 (Fig. 5C)
. Then we measured the activity of the wild-type and mutant promoters in arrested versus growing cells (Fig. 5D)
. The response of luciferase activity to serum stimulation was partially repressed in the mutant construct. Thus, the GABP consensus motif in the Skp2 promoter appears to be required for optimal expression of Skp2 promoter-reporter constructs.

View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Functional role of the GABP binding motif in the Skp2 promoter. A, a series of mutations (M1 to M3) was introduced into the putative GABP binding site ( ) of the Skp2 oligonucleotide -175/-153. The RCO4 oligonucleotide contains the GABP binding site of the rat cytochrome c oxidase subunit IV gene promoter (+9/+41). B, EMSA analysis was performed with the 32P-labeled -175/-153 Skp2 probe and nuclear extract of HeLa cells. The effects of 20- or 200-fold molar excesses of the indicated unlabeled oligonucleotides on protein-probe complex formation were determined. C, the M1, M2, and M3 mutations were also introduced into the putative GABP binding motif of the Skp2 promoter construct pGL2 -207. HeLa cells were cotransfected both with wild-type (WT) pGL2 -207 or the mutant constructs and with pRL-Tk, and the luciferase activities of cell extracts were determined. D, NIH3T3 cells were transiently transfected with pGL2207 (WT, ) or mutant pGL2207 (M1, ). Cells were synchronized by serum deprivation and subsequently released from growth arrest by reexposure to serum, and harvested at the indicated times for luciferase assays. Results are expressed as the ratio of luciferase activity in each extract relative to that in the extract from WT transfected cells at time 0. Data are means of values from three independent experiments; bars, ±SE.
|
|
Given that the nt sequence of the GABP element in Skp2 is similar to that of the binding site for GABP (nts +22 to +29) in the promoter of the cytochrome oxidase subunit IV (RCO4) gene (Fig. 5A
; Refs. 31
, 32
), we tested the effect of an unlabeled oligonucleotide containing this sequence in the EMSA with the -175/-153 Skp2 probe. The RCO4 oligonucleotide markedly inhibited the formation of bands I and II (Fig. 5B)
. Thus, these data indicate that the DNA binding protein (or proteins) that recognizes the cis element of Skp2 shares DNA sequence specificity with GABP.
Binding of GABP to the Skp2 Core Promoter Region.
GABP is a heterodimer of GABP
and either GABPß or GABP
subunits (19
, 20)
. We examined the effects of antibodies specific for GABP
, or for GABPß or GABP
(GABPß/
) on complex formation by the -175/-153 Skp2 probe in EMSA analysis. Antibodies to GABP
markedly reduced the intensity of bands I and II and generated "supershifted" complexes (Fig. 6A)
. Antibodies to GABPß/
also induced a supershift, although the effect was less pronounced than was that of the antibodies to GABP
, possibly as a result of a lower affinity of the antibodies or of an allosteric effect. Antibodies to Elk-1 (33)
, used as a control, did not influence complex formation, suggesting that the effects of the antibodies to GABP were specific, and that bands I and II contain GABP. Furthermore, we performed ChIP in HeLa cells using antibodies to GABP
or Elk-1, and detected association between GABP
and Skp2 promoter (Fig. 6B)
.

View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. Binding of GABP to the Skp2 promoter. A, EMSA analysis was performed with the 32P-labeled -175/-153 Skp2 probe and HeLa cell nuclear extract in the absence or presence of antibodies to GABP , GABPß/ , or Elk-1 (control), as indicated. The positions of the supershifted bands are indicated. B, ChIP from HeLa cells was performed with antibodies to GABP or Elk-1 (control). Input corresponds to PCR reactions containing 0.5% of total amount of chromatin used in immunoprecipitation reactions. C, EMSA analysis was performed with the 32P-labeled -175/-153 Skp2 probe and either HeLa cell nuclear extract or the indicated combinations of in vitro-translated GABP , GABPß, GABP , and luciferase (control). The predominant bands formed by GABP -GABPß, GABP -GABP , and GABP alone are designated a, b, and c, respectively.
|
|
We next examined the abilities of in vitro-translated GABP
, GABPß, and GABP
to bind to the Skp2 core promoter region (Fig. 6C)
. Whereas GABP
alone formed a complex (band c) with the -175/-153 probe, neither GABPß nor GABP
alone bound the oligonucleotide. In contrast, a mixture of GABP
and either GABPß or GABP
yielded prominent complexes (bands a and b, respectively) of lower mobility than band c. The mobilities of bands a and b, and that of band c were identical or highly similar to those of bands I and II, respectively, formed by HeLa nuclear proteins. These data indicate that bands II and I formed by HeLa cell nuclear extract contain monomeric GABP
and a GABP
-GABPß or GABP
-GABP
heterodimer, respectively.
Cell Cycle-dependent Induction of GABP Binding to the Skp2 Promoter.
We next examined the effect of cell cycle progression on the binding of GABP to the core motif of the Skp2 promoter. Thus, we performed EMSA analysis with the -175/-153 Skp2 probe and with nuclear extracts prepared from T98G cells that were either synchronized at G0 by serum deprivation or released from growth arrest by subsequent reexposure for various times to serum (Fig. 7A)
. Serum addition resulted in a marked increase in the intensity of band I and a smaller (
3-fold) increase in that of band II during the subsequent 40 h, whereas NF-Y binding did not virtually vary in the cell cycle. The abundance of GABPß did not change, suggesting that its DNA binding is regulated (Fig. 7B)
. Cell synchronicity was monitored in parallel by flow cytometry (Fig. 7C)
. Binding of GABP to the Skp2 promoter continued in the cycling cells. These data suggested that the binding of the GABP heterodimer to the Skp2 promoter is induced during cell cycle progression after serum deprivation and may underlie the transactivation of Skp2 apparent at this time.

View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 7. Cell cycle-dependent binding of GABP to the Skp2 promoter. A, EMSA analysis was performed with the 32P-labeled -175/-153 Skp2 probe (top panel) or NF-Y probe (bottom panel) and nuclear extracts of T98G cells prepared at the indicated times after release from serum deprivation. B, nuclear extracts prepared in A were subjected to immunoblotting analysis with anti-GABPß and anti-HSP90 (control). C, T98G cells synchronized as in A were stained with propidium iodide and analyzed by flow cytometry.
|
|
Effects of Overexpression of GABP
and GABPß on Skp2 Promoter Activity.
Given that the core motif of the Skp2 promoter is recognized by GABP, we examined the effects of overexpression of GABP
and GABPß on Skp2 promoter activity. Transfection of HeLa cells with an expression vector for GABP
(0.010.4 µg) resulted in a dose-dependent inhibition of Skp2 promoter activity (Fig. 8A)
. In contrast, transfection of HeLa cells with various amounts of an expression vector for GABPß resulted in either slight inhibition of (0.01 or 0.1 µg) or a 2.6-fold increase in (0.4 µg) Skp2 promoter activity. Cotransfection of cells with the vectors for GABP
and GABPß resulted in a marked inhibition of promoter activity. These data suggest that overexpression of a GABP subunit may result in the sequestration of a factor (or factors) required for transactivation of Skp2. They are also consistent with the possibility that both GABP
and GABPß subunits contribute to the transcriptional activation of Skp2, as well as with the notion that the amount of GABPß is more limiting than that of GABP
in HeLa cells. Similar "squelching" effects of overexpression of Ets protein have also been observed with the human thrombopoietin gene promoter and insulin-mediated prolactin gene expression (34
, 35)
. We also examined the effect of transient transfection of HeLa cells with the expression vectors for GABP
or GABPß on the abundance of Skp2 mRNA by Northern blot analysis. Overexpression of GABPß resulted in a dose-dependent increase in the abundance of Skp2 mRNA (Fig. 8B)
, whereas that of GABP
had no such effect (data not shown).
Reduced Skp2 Promoter Activity Induced by siRNA Targeting of GABP.
We next investigated the functions of endogenous GABP with the use of RNA interference in HeLa cells. Transfection of HeLa cells with siRNA targeting either GABP
or GABPß partially reduced the abundance of GABP
or GABPß mRNA, respectively (Fig. 9A)
. We examined the effect of GABP depletion on the Skp2 transcription level by Northern blot analysis. In cells depleted of either GABP
or GABPß by specific siRNA, Skp2 mRNA was reduced significantly compared with that in cells transfected with control siRNA (Fig. 9A)
.

View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 9. Effect of GABP knockdown on Skp2 promoter activity. A, HeLa cells were transfected with 200 nM each duplex RNAs. Total RNA was isolated and subjected to Northern blot analysis with human GABP , GABPß, and Skp2 cDNA probe. Equal application of samples was verified by staining of 18S rRNA with ethidium bromide (bottom panel). B, HeLa cells were transfected with each duplex RNAs, and transfected with 2 µg of pGL2207 and 0.1 µg of pRL-Tk 36 h before harvest. The luciferase activities of cell extracts were then determined. Data are means of values from three independent experiments; bars, ±SE.
|
|
We also examined the effect of GABP
or GABPß knockdown on Skp2 promoter activity by luciferase reporter assay. Transfection of HeLa cells with siRNA targeting either GABP
or GABPß resulted in inhibition of Skp2 promoter activity (Fig. 9B)
. The percentage in G0/G1 population slightly but significantly increased in cells transfected with GABP
- (58.3 ± 0.4) or GABPß-siRNA (54.7 ± 0.9) compared with that with GFP-siRNA (52.6 ± 0.6). Collectively, these data suggest that GABP plays a pivotal role in the regulation of the Skp2 promoter.
 |
DISCUSSION
|
|---|
Skp2 is the F-box protein component of an SCF-type ubiquitin ligase complex. The substrates of SCFSkp2 are thought to include p27Kip1 (9
, 11
, 36)
, free cyclin E (11)
, E2F-1 (37)
, ORC1 (38)
, CDK9 (39)
, B-Myb (40)
, and p130 (41)
. Although p27Kip1, free cyclin E, CDK9, and p130 all accumulate in the cells of Skp2-deficient mice (11
, 39)
, the principal target of Skp2 may be p27Kip1, given that most of the abnormalities of Skp2-deficient animals are abolished in a p27Kip1-null background.5
In normal lymphocytes, p27Kip1 had almost completely disappeared 12 h (mid-G1 phase) after mitogenic stimulation, whereas the expression of Skp2 was first evident at 1824 h (S phase) after stimulation and was maximal at 3036 h (G2 phase; Ref. 42
). These data suggest that the early decrease in the abundance of p27Kip1 is mediated by a Skp2-independent mechanism. Consistent with this notion, the degradation of p27Kip1 occurs normally at mid-G1 phase but is impaired during S and G2 phases in the cells of Skp2-deficient mice (42)
. Furthermore, injection of antibodies to Skp2 inhibits the progression of cells into S phase (8)
, whereas overexpression of Skp2 promotes such progression (43)
. Thus, the main role of Skp2 appears to be to promote cell cycle progression from G1 to S phase by mediating the ubiquitylation-dependent proteolysis of p27Kip1. Thus, the regulation of Skp2 expression may be an important determinant of progression through the G1-S transition.
Skp2 was originally identified as a 45-kDa protein associated with the cyclin A-CDK2 complex, and the abundance of its mRNA was shown to increase as HeLa cells enter S phase (8)
. We observed a similar temporal profile of Skp2 mRNA abundance in NIH 3T3 cells in the present study. However, the amount of Skp2 mRNA in T98G cells was shown previously to increase by a factor of only
2 to 3 on progression from G0 to S phase, whereas the concentration of the encoded protein increased to a markedly greater extent (18)
. These observations suggest that the abundance of Skp2 is regulated by two independent mechanisms mediated at the transcriptional and post-translational levels, and that the predominant mechanism varies with cell type.
Extracellular mitogenic stimuli induce the exit of quiescent cells from G0 phase into G1 phase and subsequent progression to S phase. However, the molecular links between signaling pathways triggered by mitogenic stimulation and the cell cycle machinery during cycle progression have not been clear. Our data now demonstrate that transcriptional regulation of Skp2 by GABP might constitute an important target of mitogenic signal transduction. The regulation of cyclin D appears to occur at the G0-G1 transition, whereas that of Skp2 is implicated in the G1-S transition.
On re-entry of cells into the cell cycle and throughout G1 phase, mitogenic signals are integrated through the GTPase Ras. Activation of the Ras-Raf-MAPK signaling pathway has been shown to increase GABP-dependent promoter-enhancer activity (44
, 45)
. This conclusion is also supported by the phosphorylation of GABP both by extracellular signal-regulated kinase 2 in vitro as well as in response to c-Raf activation or to stimulation of cells with 12-O-tetradecanoylphorbol 13-acetate and serum in vivo (44)
. UV radiation and methylmethane sulfonate, both of which induce activation of the MAPKs c-Jun NH2-terminal kinase and p38 (46)
, also increase GABP-mediated transcriptional activity both alone and synergistically with 12-O-tetradecanoylphorbol 13-acetate (47)
. Thus, these observations suggest that the activity of GABP is modulated not only by the classical Ras-Raf-MAPK pathway but also by other signaling pathways. The Skp2 promoter activity in Ras-transformed cell lines was significantly elevated (data not shown), consistent with the notion that GABP is the critical regulator of Skp2 in response to mitogenic signaling.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Sumie Matsushita, Ryoko Yasukochi, Naoko Nishimura, and other laboratory members for technical assistance, as well as Chieko Sugita for help in preparation of the manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by a grant from the Ministry of Education, Science, Sports, and Culture of Japan, by Nissan Science Foundation, and by a research grant from the Human Frontier Science Program. 
2 Present address: Department of Biochemistry 1, Hamamatsu University School of Medicine, Hamamatsu 431-3192, Japan. 
3 To whom requests for reprints should be addressed, at Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8182, Japan. Phone: 81-92-642-6815; Fax: 81-92-642-6819; E-mail: nakayak1{at}bioreg.kyushu-u.ac.jp 
4 The abbreviations used are: CDK, cyclin-dependent kinase; GABP, GA-binding protein; nt, nucleotide; EMSA, electrophoretic mobility shift assay; GFP, green fluorescence protein; ChIP, chromatin immunoprecipitation; MAPK, mitogen-activated protein kinase. 
5 K. Nakayama, K. I. Nakayama, manuscript in preparation. 
Received 2/ 7/03.
Accepted 5/19/03.
 |
REFERENCES
|
|---|
- Weissman A. M. Regulating protein degradation by ubiquitination. Immunol. Today, 18: 189-198, 1997.[Medline]
- Hershko A., Ciechanover A. The ubiquitin system. Annu. Rev. Biochem., 67: 425-479, 1998.[Medline]
- Hershko A., Heller H., Elias S., Ciechanover A. Components of ubiquitin-protein ligase system. Resolution, affinity purification, and role in protein breakdown. J. Biol. Chem., 258: 8206-8214, 1983.[Abstract/Free Full Text]
- Scheffner M., Nuber U., Huibregtse J. M. Protein ubiquitination involving an E1E2-E3 enzyme ubiquitin thioester cascade. Nature (Lond.), 373: 81-83, 1995.[Medline]
- Bai C., Sen P., Hofmann K., Ma L., Goebl M., Harper J. W., Elledge S. J. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell, 86: 263-274, 1996.[Medline]
- Feldman R. M., Correll C. C., Kaplan K. B., Deshaies R. J. A complex of Cdc4p, Skp1p, and Cdc53p/cullin catalyzes ubiquitination of the phosphorylated CDK inhibitor Sic1p. Cell, 91: 221-230, 1997.[Medline]
- Skowyra D., Craig K. L., Tyers M., Elledge S. J., Harper J. W. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell, 91: 209-219, 1997.[Medline]
- Zhang H., Kobayashi R., Galaktionov K., Beach D. p19Skp1 and p45Skp2 are essential elements of the cyclin A-CDK2 S phase kinase. Cell, 82: 915-925, 1995.[Medline]
- Carrano A. C., Eytan E., Hershko A., Pagano M. SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat. Cell Biol., 1: 193-199, 1999.[Medline]
- Tsvetkov L. M., Yeh K. H., Lee S. J., Sun H., Zhang H. p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr. Biol., 9: 661-664, 1999.[Medline]
- Nakayama K., Nagahama H., Minamishima Y. A., Matsumoto M., Nakamichi I., Kitagawa K., Shirane M., Tsunematsu R., Tsukiyama T., Ishida N., Kitagawa M., Nakayama K. I., Hatakeyama S. Targeted disruption of Skp2 results in accumulation of cyclin E and p27(Kip1), polyploidy and centrosome overduplication. EMBO J., 19: 2069-2081, 2000.[Medline]
- Gstaiger M., Jordan R., Lim M., Catzavelos C., Mestan J., Slingerland J., Krek W. Skp2 is oncogenic and overexpressed in human cancers. Proc. Natl. Acad. Sci. USA, 98: 5043-5048, 2001.[Abstract/Free Full Text]
- Hershko D., Bornstein G., Ben-Izhak O., Carrano A., Pagano M., Krausz M. M., Hershko A. Inverse relation between levels of p27(Kip1) and of its ubiquitin ligase subunit Skp2 in colorectal carcinomas. Cancer (Phila.), 91: 1745-1751, 2001.[Medline]
- Latres E., Chiarle R., Schulman B. A., Pavletich N. P., Pellicer A., Inghirami G., Pagano M. Role of the F-box protein Skp2 in lymphomagenesis. Proc. Natl. Acad. Sci. USA, 98: 2515-2520, 2001.[Abstract/Free Full Text]
- Kudo Y., Kitajima S., Sato S., Miyauchi M., Ogawa I., Takata T. High expression of S-phase kinase-interacting protein 2, human F-box protein, correlates with poor prognosis in oral squamous cell carcinomas. Cancer Res., 61: 7044-7047, 2001.[Abstract/Free Full Text]
- Chiarle R., Fan Y., Piva R., Boggino H., Skolnik J., Novero D., Palestro G., De Wolf-Peeters C., Chilosi M., Pagano M., Inghirami G. S-phase kinase-associated protein 2 expression in non-Hodgkins lymphoma inversely correlates with p27 expression and defines cells in S phase. Am. J. Pathol., 160: 1457-1466, 2002.[Abstract/Free Full Text]
- Masuda T. A., Inoue H., Sonoda H., Mine S., Yoshikawa Y., Nakayama K., Nakayama K. I., Mori M. Clinical and biological significance of S-phase kinase-associated protein 2 (Skp2) gene expression in gastric carcinoma: modulation of malignant phenotype by Skp2 overexpression, possibly via p27 proteolysis. Cancer Res., 62: 3819-3825, 2002.[Abstract/Free Full Text]
- Wirbelauer C., Sutterluty H., Blondel M., Gstaiger M., Peter M., Reymond F., Krek W. The F-box protein Skp2 is a ubiquitylation target of a Cul1-based core ubiquitin ligase complex: evidence for a role of Cul1 in the suppression of Skp2 expression in quiescent fibroblasts. EMBO J., 19: 5362-5375, 2000.[Medline]
- Gugneja S., Virbasius J. V., Scarpulla R. C. Four structurally distinct, non-DNA-binding subunits of human nuclear respiratory factor 2 share a conserved transcriptional activation domain. Mol. Cell. Biol., 15: 102-111, 1995.[Abstract]
- Watanabe H., Sawada J., Yano K., Yamaguchi K., Goto M., Handa H. cDNA cloning of transcription factor E4TF1 subunits with Ets and notch motifs. Mol. Cell. Biol., 13: 1385-1391, 1993.[Abstract/Free Full Text]
- Thompson C. C., Brown T. A., McKnight S. L. Convergence of Ets- and notch-related structural motifs in a heteromeric DNA binding complex. Science (Wash. DC), 253: 762-768, 1991.[Abstract/Free Full Text]
- Rosmarin A. G., Caprio D. G., Kirsch D. G., Handa H., Simkevich C. P. GABP and PU. 1 compete for binding, yet cooperate to increase CD18 (ß 2 leukocyte integrin) transcription. J. Biol. Chem., 270: 23627-23633, 1995.[Abstract/Free Full Text]
- Hatakeyama S., Yada M., Matsumoto M., Ishida N., Nakayama K. I. U box proteins as a new family of ubiquitin-protein ligases. J. Biol. Chem., 276: 33111-33120, 2001.[Abstract/Free Full Text]
- Dignam J. D., Lebovitz R. M., Roeder R. G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res., 11: 1475-1489, 1983.[Abstract/Free Full Text]
- Sambrook J., Russel D. W. . Molecular Cloning: A Laboratory Mannual, 3rd Ed. 17.13-17, Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 2001.
- Shirane M., Nakayama K. I. Inherent calcineurin inhibitor FKBP38 targets Bcl-2 to mitochondria and inhibits apoptosis. Nat. Cell Biol., 5: 28-37, 2003.[Medline]
- LaMarco K., Thompson C. C., Byers B. P., Walton E. M., McKnight S. L. Identification of Ets- and notch-related subunits in GA binding protein. Science (Wash. DC), 253: 789-792, 1991.[Abstract/Free Full Text]
- Virbasius J. V., Virbasius C. A., Scarpulla R. C. Identity of GABP with NRF-2, a multisubunit activator of cytochrome oxidase expression, reveals a cellular role for an ETS domain activator of viral promoters. Genes Dev., 7: 380-392, 1993.[Abstract/Free Full Text]
- Oeda K., Salinas J., Chua N. H. A tobacco bZip transcription activator (TAF-1) binds to a G-box-like motif conserved in plant genes. EMBO J., 10: 1793-1802, 1991.[Medline]
- Tilburn J., Sarkar S., Widdick D. A., Espeso E. A., Orejas M., Mungroo J., Penalva M. A., Arst H. N., Jr. The Aspergillus PacC zinc finger transcription factor mediates regulation of both acid- and alkaline-expressed genes by ambient pH. EMBO J., 14: 779-790, 1995.[Medline]
- Wasylyk B., Hahn S. L., Giovane A. The Ets family of transcription factors. Eur. J. Biochem., 211: 7-18, 1993.[Medline]
- Virbasius J. V., Scarpulla R. C. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene. Mol. Cell. Biol., 11: 5631-5638, 1991.[Abstract/Free Full Text]
- Rao V. N., Huebner K., Isobe M., ar-Rushdi A., Croce C. M., Reddy E. S. elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints. Science (Wash. DC), 244: 66-70, 1989.[Abstract/Free Full Text]
- Ouyang L., Jacob K. K., Stanley F. M. GABP mediates insulin-increased prolactin gene transcription. J. Biol. Chem., 271: 10425-10428, 1996.[Abstract/Free Full Text]
- Kamura T., Handa H., Hamasaki N., Kitajima S. Characterization of the human thrombopoietin gene promoter. A possible role of an Ets transcription factor, E4TF1/GABP. J. Biol. Chem., 272: 11361-11368, 1997.[Abstract/Free Full Text]
- Sutterluty H., Chatelain E., Marti A., Wirbelauer C., Senften M., Muller U., Krek W. p45SKP2 promotes p27Kip1 degradation and induces S phase in quiescent cells. Nat. Cell Biol., 1: 207-214, 1999.[Medline]
- Marti A., Wirbelauer C., Scheffner M., Krek W. Interaction between ubiquitin-protein ligase SCFSKP2 and E2F-1 underlies the regulation of E2F-1 degradation. Nat. Cell. Biol., 1: 14-19, 1999.[Medline]
- Mendez J., Zou-Yang X. H., Kim S. Y., Hidaka M., Tansey W. P., Stillman B. Human origin recognition complex large subunit is degraded by ubiquitin-mediated proteolysis after initiation of DNA replication. Mol. Cell, 9: 481-491, 2002.[Medline]
- Kiernan R. E., Emiliani S., Nakayama K., Castro A., Labbe J. C., Lorca T., Nakayama K. I., Benkirane M. Interaction between cyclin T1 and SCF(SKP2) targets CDK9 for ubiquitination and degradation by the proteasome. Mol. Cell. Biol., 21: 7956-7970, 2001.[Abstract/Free Full Text]
- Charrasse S., Carena I., Brondani V., Klempnauer K. H., Ferrari S. Degradation of B-Myb by ubiquitin-mediated proteolysis: involvement of the Cdc34-SCF(p45Skp2) pathway. Oncogene, 19: 2986-2995, 2000.[Medline]
- Tedesco D., Lukas J., Reed S. I. The pRb-related protein p130 is regulated by phosphorylation-dependent proteolysis via the protein-ubiquitin ligase SCF(Skp2). Genes Dev., 16: 2946-2957, 2002.[Abstract/Free Full Text]
- Hara T., Kamura T., Nakayama K., Oshikawa K., Hatakeyama S., Nakayama K. I. Degradation of p27(Kip1) at the G(0)-G(1) transition mediated by a Skp2- independent ubiquitination pathway. J. Biol. Chem., 276: 48937-48943, 2001.[Abstract/Free Full Text]
- Nelsen C. J., Hansen L. K., Rickheim D. G., Chen C., Stanley M. W., Krek W., Albrecht J. H. Induction of hepatocyte proliferation and liver hyperplasia by the targeted expression of cyclin E and skp2. Oncogene, 20: 1825-1831, 2001.[Medline]
- Flory E., Hoffmeyer A., Smola U., Rapp U. R., Bruder J. T. Raf-1 kinase targets GA-binding protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter. J. Virol., 70: 2260-2268, 1996.[Abstract]
- Avots A., Hoffmeyer A., Flory E., Cimanis A., Rapp U. R., Serfling E. GABP factors bind to a distal interleukin 2 (IL-2) enhancer and contribute to c-Raf-mediated increase in IL-2 induction. Mol. Cell. Biol., 17: 4381-4389, 1997.[Abstract]
- Treisman R. Regulation of transcription by MAP kinase cascades. Curr. Opin. Cell Biol., 8: 205-215, 1996.[Medline]
- Hoffmeyer A., Avots A., Flory E., Weber C. K., Serfling E., Rapp U. R. The GABP-responsive element of the interleukin-2 enhancer is regulated by JNK/SAPK-activating pathways in T lymphocytes. J. Biol. Chem., 273: 10112-10119, 1998.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. E. Lucas, K. S. Crider, D. R. Powell, P. Kapoor-Vazirani, and P. M. Vertino
Methylation-sensitive Regulation of TMS1/ASC by the Ets Factor, GA-binding Protein-{alpha}
J. Biol. Chem.,
May 29, 2009;
284(22):
14698 - 14709.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fujita, W. Liu, H. Doihara, and Y. Wan
Regulation of Skp2-p27 Axis by the Cdh1/Anaphase-Promoting Complex Pathway in Colorectal Tumorigenesis
Am. J. Pathol.,
July 1, 2008;
173(1):
217 - 228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, M. Tuzova, Z.-X. J. Xiao, W. W. Cruikshank, and D. M. Center
Pro-IL-16 Recruits Histone Deacetylase 3 to the Skp2 Core Promoter through Interaction with Transcription Factor GABP
J. Immunol.,
January 1, 2008;
180(1):
402 - 408.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Crook, M. Olive, H.-H. Xue, T. H. Langenickel, M. Boehm, W. J. Leonard, and E. G. Nabel
GA-binding protein regulates KIS gene expression, cell migration, and cell cycle progression
FASEB J,
January 1, 2008;
22(1):
225 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hattori, T. Isobe, K. Abe, H. Kikuchi, K. Kitagawa, T. Oda, C. Uchida, and M. Kitagawa
Pirh2 Promotes Ubiquitin-Dependent Degradation of the Cyclin-Dependent Kinase Inhibitor p27Kip1
Cancer Res.,
November 15, 2007;
67(22):
10789 - 10795.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Egozi, M. Shapira, G. Paor, O. Ben-Izhak, K. Skorecki, and D. D. Hershko
Regulation of the cell cycle inhibitor p27 and its ubiquitin ligase Skp2 in differentiation of human embryonic stem cells
FASEB J,
September 1, 2007;
21(11):
2807 - 2817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yung, J. L. Walker, J. M. Roberts, and R. K. Assoian
A Skp2 autoinduction loop and restriction point control
J. Cell Biol.,
August 27, 2007;
178(5):
741 - 747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Fujimura, T. Vacik, O. Machon, C. Vlcek, S. Scalabrin, M. Speth, D. Diep, S. Krauss, and Z. Kozmik
Wnt-mediated Down-regulation of Sp1 Target Genes by a Transcriptional Repressor Sp5
J. Biol. Chem.,
January 12, 2007;
282(2):
1225 - 1237.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li, X. Jiao, C. Wang, X. Ju, Y. Lu, L. Yuan, M. P. Lisanti, S. Katiyar, and R. G. Pestell
Cyclin D1 Induction of Cellular Migration Requires p27KIP1.
Cancer Res.,
October 15, 2006;
66(20):
9986 - 9994.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hiramatsu, K. Kitagawa, T. Suzuki, C. Uchida, T. Hattori, H. Kikuchi, T. Oda, S. Hatakeyama, K. I. Nakayama, T. Yamamoto, et al.
Degradation of Tob1 Mediated by SCFSkp2-Dependent Ubiquitination.
Cancer Res.,
September 1, 2006;
66(17):
8477 - 8483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Bryant, Q. Zheng, and K. Pumiglia
Focal Adhesion Kinase Controls Cellular Levels of p27/Kip1 and p21/Cip1 through Skp2-Dependent and -Independent Mechanisms.
Mol. Cell. Biol.,
June 1, 2006;
26(11):
4201 - 4213.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Sugihara, M. Kanai, S. Saito, T. Nitta, H. Toyoshima, K. Nakayama, K. I. Nakayama, K. Fukasawa, M. Schwab, H. Saya, et al.
Suppression of Centrosome Amplification after DNA Damage Depends on p27 Accumulation.
Cancer Res.,
April 15, 2006;
66(8):
4020 - 4029.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tsuchimochi, N. Yagishita, S. Yamasaki, T. Amano, Y. Kato, K.-i. Kawahara, S. Aratani, H. Fujita, F. Ji, A. Sugiura, et al.
Identification of a Crucial Site for Synoviolin Expression
Mol. Cell. Biol.,
August 15, 2005;
25(16):
7344 - 7356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Rodier, C. Makris, P. Coulombe, A. Scime, K. Nakayama, K. I. Nakayama, and S. Meloche
p107 inhibits G1 to S phase progression by down-regulating expression of the F-box protein Skp2
J. Cell Biol.,
January 3, 2005;
168(1):
55 - 66.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Blaschke, O. Leppanen, Y. Takata, E. Caglayan, J. Liu, M. C. Fishbein, K. Kappert, K. I. Nakayama, A. R. Collins, E. Fleck, et al.
Liver X Receptor Agonists Suppress Vascular Smooth Muscle Cell Proliferation and Inhibit Neointima Formation in Balloon-Injured Rat Carotid Arteries
Circ. Res.,
December 10, 2004;
95(12):
e110 - e123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Osoegawa, I. Yoshino, S. Tanaka, K. Sugio, T. Kameyama, M. Yamaguchi, and Y. Maehara
Regulation of p27 by S-Phase Kinase-Associated Protein 2 Is Associated With Aggressiveness in Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
October 15, 2004;
22(20):
4165 - 4173.
[Abstract]
[Full Text]
[PDF]
|
 |
|