| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Departments of Molecular and Cellular Biology [H. I., M. K., T. K., K. I. N.] and Molecular Genetics [K. N., K. I. N.], Medical Institute of Bioregulation, Kyushu University, Fukuoka, Fukuoka 812-8582; CREST, Japan Science and Technology Corporation, Kawaguchi, Saitama 332-0012 [H. I., K. N., M. K., T. K., K. I. N.]; and Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Kanagawa 226-8501 [S. D., H. H.], Japan
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
0.3-kb promoter region with marked transcriptional activity and a 105-bp essential sequence within this region. Electrophoretic mobility shift assays indicated the presence in nuclear extracts of proteins that bind to this sequence. Site-directed mutagenesis revealed that the core binding motif, CACTTCCG, which is similar to that of GA-binding protein (GABP), is essential for Skp2 transcription. "Supershift" analysis indicated that the protein-probe complexes detected by electrophoretic mobility shift assays contain GABP. Endogenous GABP bound to Skp2 promoter element in a cell cycle-dependent manner. Furthermore, overexpression of GABPß increased Skp2 promoter activity, and suppression of GABP
or GABPß by a small interfering RNA resulted in the reduction of Skp2 promoter activity. These data suggest that the cell cycle-dependent binding of GABP to the Skp2 promoter plays an important role in the regulation of Skp2 expression and cell cycle progression from G1 to S phase. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
SCF complex, an E3 ligase, consists of the invariable components Skp1, Cul1, and Rbx1 (Roc1/Hrt1) as well as a variable component, known as an F-box protein, that binds to Skp1 through its F-box motif and is responsible for substrate recognition (5, 6, 7) . Skp2, which contains an F-box domain followed by leucine-rich repeats, was originally identified as a protein that interacts with the cyclin A-CDK24 complex (8) . More recently, however, Skp2 has been implicated in the ubiquitin-mediated degradation of p27Kip1 (9 , 10) . We have generated Skp2-deficient mice and shown that they exhibit cellular accumulation of p27Kip1, a reduction in both body size and the size of individual organs, an increase in the mass of individual cells, polyploidy, and multiple centrosomes per cell (11) . These observations suggest that SCFSkp2 is the principal ubiquitin ligase responsible for determination of the abundance of cell cycle regulatory proteins during progression of cells from G1 to S phase. The expression of Skp2 has been shown recently to correlate inversely with that of p27Kip1 and to define cells in S phase in human sarcomas and other cancers (12, 13, 14, 15, 16, 17) . Mice transgenic for Skp2 in the T-lymphocyte lineage also exhibit an increased susceptibility to the development of lymphoma (14) . Thus, the deregulation of Skp2 expression may lead to carcinogenesis.
Although the abundance of the SCFSkp2 components Skp1, Cul1, and Rbx1 does not change substantially during the cell cycle, the amount of Skp2 varies in a cell cycle-dependent manner. Skp2 is first detectable at the transition between G1 and S phases, accumulates during S and G2 phases, and then decreases in abundance as cells proceed through M phase. Both transcriptional and post-translational regulation are thought to underlie these changes. Thus, the abundance of Skp2 mRNA is periodic in HeLa cells (8) and NIH 3T3 cells (this study), whereas the concentration of Skp2 is regulated mainly by ubiquitylation-mediated protein degradation (as well as by transcriptional control) in other cell types (18) .
To explore the molecular basis for the cell cycle-dependent oscillation of Skp2 mRNA, we have now characterized the promoter region of Skp2. We have identified a minimal promoter region and a transcription factor, GABP (19, 20, 21) , which binds to its core sequence. Our results suggest that the cell cycle-dependent binding of GABP regulates Skp2 expression and cell cycle progression from G1 to S phase.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
To generate pBlue -207/-103, we amplified the DNA fragment comprising nts -207 to -103 of Skp2 by PCR with pBlue-2.4k as the template, a sense primer corresponding to nts -207 to -188 (5'-AGTCAATCGGCTGACATTTC-3'), and an antisense primer corresponding to nts -122 to -103 (5'-CCTGCGGCGCCGGGCGGGAT-3'). An EcoRI linker was incorporated at the 5' end of the sense primer and a NotI linker at the 3' end of the antisense primer. The PCR product was digested with EcoRI and NotI, and then subcloned into the corresponding sites of pBluescriptII SK+ (Stratagene).
The mutated constructs pGL2 -207M1, pGL2 -207M2, and pGL2 -207M3 were generated with the use of a Quickchange mutagenesis kit (Stratagene) and the primers M1QC+ (5'-GAGCTCCACCCTCATCCGCCTGTCC-3'), M1QC- (5'-GGACAGGCGGATGAGGGTGGAGCTC-3'), M2QC+ (5'-GAGCTCCACCCATAACCGCCTGTCCTC-3'), M2QC- (5'-GAGGACAGGCGGTTATGGGTGGAGCTC-3'), M3QC+ (5'-CCACCCACTTCAGCCTGCCTGTCC-3'), and M3QC- (5'-GGACAGGCAGGCTGAAGTGGGTGG-3'). The sequences of the mutated constructs were verified by DNA sequence analysis (Amersham Pharmacia Biotech).
The expression vectors pCAGGS-GABP and pCAGGS-GABPß were generated as described previously (22)
.
Northern Blot Analysis.
The Northern blot analysis was performed as described previously (23)
.
Cell Culture and Cell Cycle Analysis.
Mouse NIH 3T3 cells were maintained in DMEM supplemented with 10% calf serum (Life Technologies, Inc.). Human HeLa and T98G cells were maintained in DMEM supplemented with 10% fetal bovine serum (Life Technologies, Inc.). The growth of NIH 3T3 and T98G cells was arrested by incubation for 72 h in DMEM without serum; the cells were subsequently stimulated by the addition of calf serum or fetal bovine serum, respectively, to a final concentration of 10%.
For cell cycle analysis, single-cell suspensions of NIH 3T3 or T98G cells were fixed in 70% ethanol overnight at -20°C and then stained with propidium iodide (5 µg/ml). The cells were then analyzed with a FACSCalibur flow cytometer and with Cell Quest and Modifit LT software (Becton Dickinson).
Luciferase Reporter Assays.
HeLa cells or NIH 3T3 cells(1 x 105
/well of a six-well plate) were transiently transfected with 2 µg of luciferase construct and 0.1 µg of pRL-Tk or pRL-CMV plasmid DNA (Promega) with the use of the FUGENE6 transfection reagent (Roche). Transfection was performed with at least three different batches of each reporter plasmid. Where indicated, cells were transfected with pCAGGS-GABP or pCAGGS-GABPß in addition to 1 µg of pGL2 -207 and 0.1 µg of pRL-Tk. After incubation for 48 h, the cells were harvested with Passive Lysis Buffer (Promega), and luciferase activities of cell extracts were measured with the use of the Dual luciferase assay system (Promega). Luciferase activity was expressed as the ratio of LucF activity:LucR activity.
Preparation of Nuclear Extracts, in Vitro Translation, and EMSA Analysis.
Nuclear extracts of HeLa and T98G cells were prepared as described previously (24)
, and portions were stored at -80°C. In vitro translated proteins were prepared by using 1 µg of pET3d plasmids containing each cDNA for GABP, GABPß, or GABP
in the TNT T7-coupled reticulocyte lysate system (Promega). EMSA analysis was performed as described previously (25)
. For "supershift" analysis, 1 µg of antibodies to GABP, to GABPß/ (20)
, or to Elk-1 (Santa Cruz Biotechnology) was added to the reaction mixture. For generation of the -207/-103, -207/-177, and -177/-103 probes, the corresponding DNA fragments were excised from pBlue -207/-103 by double digestion with EcoRI and NotI, with EcoRI and SacI, or with SacI and NotI, respectively, and were purified by electrophoresis on a 1.5% agarose gel. The oligonucleotides -175/-153+ (5'-GGAGCTCCACCCACTTCCGCCTG-3'), -175/-153- (5'-GGCAGGCGGAAGTGGGTGGAGCT-3'), -152/-126+ (5'-GGTGTCCTCCTCCTCCTCCTCCTCCTCCT-3'), -152/-126- (5'-GGAGGAGGAGGAGGAGGAGGAGG AGGACA-3'), -125/-103+ (5'-GGTCAATCCCGCCCGGCGCCGCAGG-3'), -125/-103- (5'-GGCCTGCGGCGCCGGGCGGGATTGA-3'), NF-Y+ (5'-GGAGACCGTACGTGATTGGTTAATCTCTT-3'), and NF-Y- (5'-GGAAGAGATTAACCAATCACGTACGGTCT-3'), were chemically synthesized; the corresponding (+) and (-) oligonucleotides were annealed and labeled by filling in of the guanine-containing 5' overhangs with the use of the Klenow fragment (New England Biolabs) in the presence of [-32P]dCTP (Amersham Biosciences).
Small interfering RNA (siRNA) Transfections.
RNA interference was performed as described previously (26)
. GABP was targeted with the sequence AAAGCAGAGTGCACAGAAGAA, GABPß was targeted with the sequence AAATGGAGCTCCCTTTACTAC, and the GFP was targeted with the sequence AAGCTGACCCTGAAGTTCATC. Searches of the human genome database (BLAST) were carried out to ensure the sequences would not target other gene transcripts.
ChIPs.
The ChIP was performed with ChIP assay kit (Upstate), and the primers 5'-hSKP2ChIP (5'-AAAATCCGTCTACAGTCCAG-3') and 3'-hSKP2ChIP (5'-CCTTCGAGATACCCACAACC-3'). The 127-bp PCR product was analyzed by electrophoresis on a 1.5% agarose gel.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. NIH 3T3 cells were synchronized in G0 phase by serum deprivation and then released from growth arrest by reexposure to serum. Cell synchronicity was monitored by flow cytometry (Fig. 1B)
in parallel with Northern analysis. The abundance of Skp2 mRNA was low in G0 phase, increased as cells entered mid-G1 phase, and peaked during S phase. Similar results were obtained with HeLa cells and T98G cells, although, consistent with previous observations (18)
, the basal amount of Skp2 mRNA in G0 phase was greater in T98G cells than in the other cell types (data not shown).
|
. To identify the transcriptional initiation site of the gene, we performed 5'-RACE (data not shown). Although a TATA box-like sequence is not apparent in the transcriptional initiation region, three GC boxes (Sp1 binding sites) are present upstream of the start site. In addition, potential binding sites for GABP (also known as E4TF1 or NRF-2; Refs. 20
, 27
, 28
), Taf-1 (29)
, and PacC (30)
are located at nts -166 to -159, -10 to -1, and -188 to -172, respectively.
|
. Cells transfected with pGL2–2275, containing nts -2275 to +94 of Skp2, exhibited a high level of luciferase activity. Deletion of the 5' flanking sequence from nts -2275 to -208 did not result in a reduction in luciferase activity, whereas deletion of this region to nt -103 resulted in an 80% decrease in activity. These results suggest that a cis element located between nts -207 and -103 is required for transcription of Skp2.
|
, NIH 3T3 cells, or T98G cells (data not shown). Shorter exposure of the gels revealed that band I actually comprises two distinct bands of similar mobility (data not shown). Specificity of complex formation was suggested by the observation that a 200-fold molar excess of the corresponding unlabeled oligonucleotide markedly reduced the intensity of bands I and II (Fig. 4A)
. Furthermore, whereas an unlabeled oligonucleotide comprising nts -177 to -103 of Skp2 also greatly reduced the intensity of bands I and II, one corresponding to nts -207 to -177 did not. We next synthesized unlabeled oligonucleotides corresponding to nts -175 to -153, -152 to -126, or -125 to -103. Whereas the -175/-153 oligonucleotide prevented the formation of bands I and II, the -152/-126 and -125/-103 oligonucleotides had no such effect (Fig. 4B)
. These results thus suggest that a DNA binding protein (or proteins) specifically interacts with the upstream region of Skp2 comprising nts -175 to -153, which contains binding sites for Sp1 (-174 to -165) and GABP (-164 to -157).
|
. The unlabeled mutant oligonucleotides did not affect the formation of bands I and II by the 32P-labeled -175/-153 probe (Fig. 5B)
. Furthermore, the luciferase activity of cells transfected with pGL2 -207 containing the mutations was reduced by 45–75% compared with that of cells transfected with wild-type pGL2 -207 (Fig. 5C)
. Then we measured the activity of the wild-type and mutant promoters in arrested versus growing cells (Fig. 5D)
. The response of luciferase activity to serum stimulation was partially repressed in the mutant construct. Thus, the GABP consensus motif in the Skp2 promoter appears to be required for optimal expression of Skp2 promoter-reporter constructs.
|
; Refs. 31
, 32
), we tested the effect of an unlabeled oligonucleotide containing this sequence in the EMSA with the -175/-153 Skp2 probe. The RCO4 oligonucleotide markedly inhibited the formation of bands I and II (Fig. 5B)
. Thus, these data indicate that the DNA binding protein (or proteins) that recognizes the cis element of Skp2 shares DNA sequence specificity with GABP.
Binding of GABP to the Skp2 Core Promoter Region.
GABP is a heterodimer of GABP and either GABPß or GABP subunits (19
, 20)
. We examined the effects of antibodies specific for GABP, or for GABPß or GABP (GABPß/) on complex formation by the -175/-153 Skp2 probe in EMSA analysis. Antibodies to GABP markedly reduced the intensity of bands I and II and generated "supershifted" complexes (Fig. 6A)
. Antibodies to GABPß/ also induced a supershift, although the effect was less pronounced than was that of the antibodies to GABP, possibly as a result of a lower affinity of the antibodies or of an allosteric effect. Antibodies to Elk-1 (33)
, used as a control, did not influence complex formation, suggesting that the effects of the antibodies to GABP were specific, and that bands I and II contain GABP. Furthermore, we performed ChIP in HeLa cells using antibodies to GABP or Elk-1, and detected association between GABP and Skp2 promoter (Fig. 6B)
.
|
, GABPß, and GABP to bind to the Skp2 core promoter region (Fig. 6C)
. Whereas GABP alone formed a complex (band c) with the -175/-153 probe, neither GABPß nor GABP alone bound the oligonucleotide. In contrast, a mixture of GABP and either GABPß or GABP yielded prominent complexes (bands a and b, respectively) of lower mobility than band c. The mobilities of bands a and b, and that of band c were identical or highly similar to those of bands I and II, respectively, formed by HeLa nuclear proteins. These data indicate that bands II and I formed by HeLa cell nuclear extract contain monomeric GABP and a GABP-GABPß or GABP-GABP heterodimer, respectively.
Cell Cycle-dependent Induction of GABP Binding to the Skp2 Promoter.
We next examined the effect of cell cycle progression on the binding of GABP to the core motif of the Skp2 promoter. Thus, we performed EMSA analysis with the -175/-153 Skp2 probe and with nuclear extracts prepared from T98G cells that were either synchronized at G0 by serum deprivation or released from growth arrest by subsequent reexposure for various times to serum (Fig. 7A)
. Serum addition resulted in a marked increase in the intensity of band I and a smaller (3-fold) increase in that of band II during the subsequent 40 h, whereas NF-Y binding did not virtually vary in the cell cycle. The abundance of GABPß did not change, suggesting that its DNA binding is regulated (Fig. 7B)
. Cell synchronicity was monitored in parallel by flow cytometry (Fig. 7C)
. Binding of GABP to the Skp2 promoter continued in the cycling cells. These data suggested that the binding of the GABP heterodimer to the Skp2 promoter is induced during cell cycle progression after serum deprivation and may underlie the transactivation of Skp2 apparent at this time.
|
and GABPß on Skp2 Promoter Activity. and GABPß on Skp2 promoter activity. Transfection of HeLa cells with an expression vector for GABP (0.01–0.4 µg) resulted in a dose-dependent inhibition of Skp2 promoter activity (Fig. 8A)
. In contrast, transfection of HeLa cells with various amounts of an expression vector for GABPß resulted in either slight inhibition of (0.01 or 0.1 µg) or a 2.6-fold increase in (0.4 µg) Skp2 promoter activity. Cotransfection of cells with the vectors for GABP and GABPß resulted in a marked inhibition of promoter activity. These data suggest that overexpression of a GABP subunit may result in the sequestration of a factor (or factors) required for transactivation of Skp2. They are also consistent with the possibility that both GABP and GABPß subunits contribute to the transcriptional activation of Skp2, as well as with the notion that the amount of GABPß is more limiting than that of GABP in HeLa cells. Similar "squelching" effects of overexpression of Ets protein have also been observed with the human thrombopoietin gene promoter and insulin-mediated prolactin gene expression (34
, 35)
. We also examined the effect of transient transfection of HeLa cells with the expression vectors for GABP or GABPß on the abundance of Skp2 mRNA by Northern blot analysis. Overexpression of GABPß resulted in a dose-dependent increase in the abundance of Skp2 mRNA (Fig. 8B)
, whereas that of GABP had no such effect (data not shown).
|
or GABPß partially reduced the abundance of GABP or GABPß mRNA, respectively (Fig. 9A)
. We examined the effect of GABP depletion on the Skp2 transcription level by Northern blot analysis. In cells depleted of either GABP or GABPß by specific siRNA, Skp2 mRNA was reduced significantly compared with that in cells transfected with control siRNA (Fig. 9A)
.
|
or GABPß knockdown on Skp2 promoter activity by luciferase reporter assay. Transfection of HeLa cells with siRNA targeting either GABP or GABPß resulted in inhibition of Skp2 promoter activity (Fig. 9B)
. The percentage in G0/G1 population slightly but significantly increased in cells transfected with GABP- (58.3 ± 0.4) or GABPß-siRNA (54.7 ± 0.9) compared with that with GFP-siRNA (52.6 ± 0.6). Collectively, these data suggest that GABP plays a pivotal role in the regulation of the Skp2 promoter. |
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Skp2 was originally identified as a 45-kDa protein associated with the cyclin A-CDK2 complex, and the abundance of its mRNA was shown to increase as HeLa cells enter S phase (8)
. We observed a similar temporal profile of Skp2 mRNA abundance in NIH 3T3 cells in the present study. However, the amount of Skp2 mRNA in T98G cells was shown previously to increase by a factor of only 2 to 3 on progression from G0 to S phase, whereas the concentration of the encoded protein increased to a markedly greater extent (18)
. These observations suggest that the abundance of Skp2 is regulated by two independent mechanisms mediated at the transcriptional and post-translational levels, and that the predominant mechanism varies with cell type.
Extracellular mitogenic stimuli induce the exit of quiescent cells from G0 phase into G1 phase and subsequent progression to S phase. However, the molecular links between signaling pathways triggered by mitogenic stimulation and the cell cycle machinery during cycle progression have not been clear. Our data now demonstrate that transcriptional regulation of Skp2 by GABP might constitute an important target of mitogenic signal transduction. The regulation of cyclin D appears to occur at the G0-G1 transition, whereas that of Skp2 is implicated in the G1-S transition.
On re-entry of cells into the cell cycle and throughout G1 phase, mitogenic signals are integrated through the GTPase Ras. Activation of the Ras-Raf-MAPK signaling pathway has been shown to increase GABP-dependent promoter-enhancer activity (44 , 45) . This conclusion is also supported by the phosphorylation of GABP both by extracellular signal-regulated kinase 2 in vitro as well as in response to c-Raf activation or to stimulation of cells with 12-O-tetradecanoylphorbol 13-acetate and serum in vivo (44) . UV radiation and methylmethane sulfonate, both of which induce activation of the MAPKs c-Jun NH2-terminal kinase and p38 (46) , also increase GABP-mediated transcriptional activity both alone and synergistically with 12-O-tetradecanoylphorbol 13-acetate (47) . Thus, these observations suggest that the activity of GABP is modulated not only by the classical Ras-Raf-MAPK pathway but also by other signaling pathways. The Skp2 promoter activity in Ras-transformed cell lines was significantly elevated (data not shown), consistent with the notion that GABP is the critical regulator of Skp2 in response to mitogenic signaling.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by a grant from the Ministry of Education, Science, Sports, and Culture of Japan, by Nissan Science Foundation, and by a research grant from the Human Frontier Science Program. 
2 Present address: Department of Biochemistry 1, Hamamatsu University School of Medicine, Hamamatsu 431-3192, Japan.
3 To whom requests for reprints should be addressed, at Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8182, Japan. Phone: 81-92-642-6815; Fax: 81-92-642-6819; E-mail: nakayak1{at}bioreg.kyushu-u.ac.jp
4 The abbreviations used are: CDK, cyclin-dependent kinase; GABP, GA-binding protein; nt, nucleotide; EMSA, electrophoretic mobility shift assay; GFP, green fluorescence protein; ChIP, chromatin immunoprecipitation; MAPK, mitogen-activated protein kinase.
5 K. Nakayama, K. I. Nakayama, manuscript in preparation.
Received 2/ 7/03. Accepted 5/19/03.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  M. E. Lucas, K. S. Crider, D. R. Powell, P. Kapoor-Vazirani, and P. M. Vertino Methylation-sensitive Regulation of TMS1/ASC by the Ets Factor, GA-binding Protein-{alpha} J. Biol. Chem., May 29, 2009; 284(22): 14698 - 14709. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Fujita, W. Liu, H. Doihara, and Y. Wan Regulation of Skp2-p27 Axis by the Cdh1/Anaphase-Promoting Complex Pathway in Colorectal Tumorigenesis Am. J. Pathol., July 1, 2008; 173(1): 217 - 228. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhang, M. Tuzova, Z.-X. J. Xiao, W. W. Cruikshank, and D. M. Center Pro-IL-16 Recruits Histone Deacetylase 3 to the Skp2 Core Promoter through Interaction with Transcription Factor GABP J. Immunol., January 1, 2008; 180(1): 402 - 408. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. F. Crook, M. Olive, H.-H. Xue, T. H. Langenickel, M. Boehm, W. J. Leonard, and E. G. Nabel GA-binding protein regulates KIS gene expression, cell migration, and cell cycle progression FASEB J, January 1, 2008; 22(1): 225 - 235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Hattori, T. Isobe, K. Abe, H. Kikuchi, K. Kitagawa, T. Oda, C. Uchida, and M. Kitagawa Pirh2 Promotes Ubiquitin-Dependent Degradation of the Cyclin-Dependent Kinase Inhibitor p27Kip1 Cancer Res., November 15, 2007; 67(22): 10789 - 10795. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Egozi, M. Shapira, G. Paor, O. Ben-Izhak, K. Skorecki, and D. D. Hershko Regulation of the cell cycle inhibitor p27 and its ubiquitin ligase Skp2 in differentiation of human embryonic stem cells FASEB J, September 1, 2007; 21(11): 2807 - 2817. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yung, J. L. Walker, J. M. Roberts, and R. K. Assoian A Skp2 autoinduction loop and restriction point control J. Cell Biol., August 27, 2007; 178(5): 741 - 747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Fujimura, T. Vacik, O. Machon, C. Vlcek, S. Scalabrin, M. Speth, D. Diep, S. Krauss, and Z. Kozmik Wnt-mediated Down-regulation of Sp1 Target Genes by a Transcriptional Repressor Sp5 J. Biol. Chem., January 12, 2007; 282(2): 1225 - 1237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Li, X. Jiao, C. Wang, X. Ju, Y. Lu, L. Yuan, M. P. Lisanti, S. Katiyar, and R. G. Pestell Cyclin D1 Induction of Cellular Migration Requires p27KIP1. Cancer Res., October 15, 2006; 66(20): 9986 - 9994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hiramatsu, K. Kitagawa, T. Suzuki, C. Uchida, T. Hattori, H. Kikuchi, T. Oda, S. Hatakeyama, K. I. Nakayama, T. Yamamoto, et al. Degradation of Tob1 Mediated by SCFSkp2-Dependent Ubiquitination. Cancer Res., September 1, 2006; 66(17): 8477 - 8483. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Bryant, Q. Zheng, and K. Pumiglia Focal Adhesion Kinase Controls Cellular Levels of p27/Kip1 and p21/Cip1 through Skp2-Dependent and -Independent Mechanisms. Mol. Cell. Biol., June 1, 2006; 26(11): 4201 - 4213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Sugihara, M. Kanai, S. Saito, T. Nitta, H. Toyoshima, K. Nakayama, K. I. Nakayama, K. Fukasawa, M. Schwab, H. Saya, et al. Suppression of Centrosome Amplification after DNA Damage Depends on p27 Accumulation. Cancer Res., April 15, 2006; 66(8): 4020 - 4029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tsuchimochi, N. Yagishita, S. Yamasaki, T. Amano, Y. Kato, K.-i. Kawahara, S. Aratani, H. Fujita, F. Ji, A. Sugiura, et al. Identification of a Crucial Site for Synoviolin Expression Mol. Cell. Biol., August 15, 2005; 25(16): 7344 - 7356. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Rodier, C. Makris, P. Coulombe, A. Scime, K. Nakayama, K. I. Nakayama, and S. Meloche p107 inhibits G1 to S phase progression by down-regulating expression of the F-box protein Skp2 J. Cell Biol., January 3, 2005; 168(1): 55 - 66. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Blaschke, O. Leppanen, Y. Takata, E. Caglayan, J. Liu, M. C. Fishbein, K. Kappert, K. I. Nakayama, A. R. Collins, E. Fleck, et al. Liver X Receptor Agonists Suppress Vascular Smooth Muscle Cell Proliferation and Inhibit Neointima Formation in Balloon-Injured Rat Carotid Arteries Circ. Res., December 10, 2004; 95(12): e110 - e123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Osoegawa, I. Yoshino, S. Tanaka, K. Sugio, T. Kameyama, M. Yamaguchi, and Y. Maehara Regulation of p27 by S-Phase Kinase-Associated Protein 2 Is Associated With Aggressiveness in Non-Small-Cell Lung Cancer J. Clin. Oncol., October 15, 2004; 22(20): 4165 - 4173. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
) of the Skp2 oligonucleotide -175/-153. The RCO4 oligonucleotide contains the GABP binding site of the rat cytochrome c oxidase subunit IV gene promoter (+9/+41). B, EMSA analysis was performed with the 32P-labeled -175/-153 Skp2 probe and nuclear extract of HeLa cells. The effects of 20- or 200-fold molar excesses of the indicated unlabeled oligonucleotides on protein-probe complex formation were determined. C, the M1, M2, and M3 mutations were also introduced into the putative GABP binding motif of the Skp2 promoter construct pGL2 -207. HeLa cells were cotransfected both with wild-type (WT) pGL2 -207 or the mutant constructs and with pRL-Tk, and the luciferase activities of cell extracts were determined. D, NIH3T3 cells were transiently transfected with pGL2–207 (WT, 
) or mutant pGL2–207 (M1, 
