| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Department of Pathology, University of Pittsburgh, Pittsburgh, Pennsylvania 15261 [A. M., J-H. L., A. W.]; Pittsburgh VAMC, Pittsburgh, Pennsylvania 15261 [A. W.]; and Biological Engineering Division, Department of Biology and Center for Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 [D. A. L.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Cell motility is a highly orchestrated process that requires cell protrusion of leading lamellipodia with subsequent new adhesions, contraction through the cell body, and release from the substratum at the trailing edge (11)
. Each of these biophysical processes is controlled coordinately by biochemical signaling cascades (12)
. Such cascades can be initiated by adhesion receptors, notably integrins (13)
, or by growth factor receptors, although the specific elements in signaling chains may vary dependent on the initiating signal (12)
. The rear detachment step appears to be regulated by convergent signaling from growth factors and integrin (14
, 15)
. Calpains are required for deadhesion of the tail during both haptokinesis (16)
and chemokinesis (17
, 18)
, at least on moderately to highly adhesive surfaces (19)
. However, it appears that integrins activate the calpain-1 (µ-calpain) isoform, whereas growth factor receptors trigger calpain-2 (m-calpain). As these two ubiquitously coexpressed proteins are highly homologous and appear to cleave the same targets, this convergence is likely because of differential regulation of the calpain isoforms (14
, 20)
. Inhibition of calpain does block the motility of fibroblasts and myofibroblasts (16
, 17)
, as well as keratinocytes (21)
. In the one study to date examining calpain-dependency of motility in carcinoma cells, inhibition of calpain in bladder carcinoma cells limited both motility and transmigration of a Matrigel barrier in vitro (22)
. The effects of inhibiting calpain were similar to when other motility-related signals are blocked, such as peritoneal lymphocyte 
-mediated cytoskeleton reorganization (22, 23, 24)
. Thus, there is promise that calpain may be a target for limited tumor invasiveness. However, this has yet to be determined in animal models.
Calpains are a family of >12 known mammalian intracellular limited proteases that share a similar catalytic structure (25) . The two ubiquitous isoforms, calpain-1 and -2, are the best characterized and defined by their calcium requirements for in vitro activation. Whereas the biochemistry and structural biology of the ubiquitous calpains is highly advanced (25, 26, 27, 28) , the cell biology of these enzymes is lagging because of questions of mode of activation in vivo (14 , 15) . Calpains contribute not only to cell motility, as noted above, but also are likely involved in cell proliferation and apoptosis (15 , 20 , 29) . Still less is known about the role of calpains in carcinogenesis and tumor progression. There is a report in a subset of 21 clear cell renal carcinomas of calpain-1, being up-regulated at the mRNA level in metastatic tumors compared with node-negative tumors (30) . The gastric-specific calpain-9 is down-regulated in carcinomas from that tissue, although whether it is related to differentiation status or tumorigenesis is still open to question (31 , 32) . On the other hand, the decrease of muscle-specific calpain-3, and reciprocal increase in calpain-2 and ubiquitin-dependent proteolysis in muscles during cancer cachexia is almost assuredly a secondary organismal effect unrelated to tumor growth and progression (33) . However, because calpain is regulated in an epigenetic manner and detection of changes in calpains are not expected, either calpain activity has to be determined directly or challenged in experimental systems to substantiated potential roles in tumor biology.
To investigate the role of calpain in prostate cancer invasion, we used the androgen-independent cell line DU 145 (PA; Ref. 34 ) and its derivative, WT,3 which overexpresses the full length of EGFR and which has been shown to be more invasive (35 , 36) . Because the signature of activated calpain within cells is not known, we could not survey de novo tumors for activation status. Rather, we used an interventional strategy to establish proof of concept that calpains contribute to tumor invasion. Both ubiquitous calpains were inhibited pharmacologically by the calpain-specific inhibitor CI-I (ALLN) or the calpain-preferential but broad-spectrum cysteine-serine protease inhibitor, leupeptin. This latter agent was chosen because it has been used in mice and even, on the basis of compassionate release, in humans with little toxicity evident (37 , 38) . To confirm calpain targeting and identify the key isoform, AS down-regulation of calpain-2 was performed in these cells. Our findings indicate that calpain may represent a key molecular switch that regulates a rate-limiting step in tumor invasion.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Plasmids and DNA Constructs.
To generate a minigene complementary to human calpain-2, we chose a sequence that spanned the translation initiating ATG, as AS to this sequence was productive (17)
. Human cDNA coding for 80 pb (C2AS) minigene was generated by RT-PCR using the following primers: 5' oligo sequence 5'ACCGCAGCATGGCGGGCA; and 3' reverse oligo sequence 5'TGGCCCTCTCGTGGGAGC. The cDNA was cloned into pBluescript II KS vector, digested with XhoI and BamHI, and inserted into the XhoI and BamHI sites of the mammalian pCEP4 expression vector. cDNA was sequenced to verify correct orientation and sequence. Expression was obtained by electroporation into DU145 cells. Stable transfectant cells were selected by supplementing the medium with 100 µg/ml hygmomycin. These cells are referred to as C2AS WT or PA DU145, whereas the vector only controls are named V WT or PA DU145.
AS Oligonucleotides.
Phosphorothioate AS oligodeoxynucleotides were synthesized by DNA synthesis facility (University of Pittsburgh). The sequences of calpain-2 AS have been described previously, 5'CGCGATGCCCGCCCGCCATGCT (39)
. A scrambled (SCR: 5'TCGTACCGCCCGCCCGTAGCGC) phosphothiorated oligonucleotide was used as a control. These sequences and their complementary sequences presented no similarity with other target mRNA, as best we could determine using the BLASTN program.
Quiescent cells were transfected using the superfectin reagent according to the manufactured protocol. Briefly, cells plated in 12-well plates were incubated with 20 µM of oligonucleotide with 7.5 µl of superfect in a final volume 500 µl for 3 h, then washed twice with PBS and incubated with or without 1 nM EGF for 24 h. For invasion assay, cells were counted and transferred into the transwell chambers. Otherwise, cells were kept in the same plate and used for MAP2 assay or wounded (0 h) for the migration assay.
Migration Assay.
An in vitro "wound healing" assay was used to assess cell motility in two dimensions (40)
. Cells (105) were plated on a six-well plate and grown to confluence in their regular medium. To minimize the autocrine signaling, confluent cells were kept in 1% dialyzed FBS, then wounded using a rubber policeman (0 h). Cells were washed twice with PBS and treated with or without specific effectors for 24 h. Photographs were taken at 0 and 24 h, and the distance traveled was determined by subtracting the values obtained at 0 from 24 h. Mitomycin C (0.5 µg/ml) was used to limit proliferation (41)
.
Calpain Activity Assays.
Calpain activity was detected in living cells or in the whole cell lysates using BOC or MAP2 assays, respectively, as described previously (17)
. Briefly, for BOC, cells were plated on glass coverslips at between 50 and 70% confluence in their regular media. Quiescent cells were treated with or without 1 nM EGF, CI-I, or leupetin for 24 h. t-butoxycarbonyl-Leu-Met-chloromethylaminocoumarin (0.5 µM; Molecular Probes, Eugene, OR) is added to the cells for 20 min followed by 1 nM EGF for 10 min. The activity of calpain was detected by the increase of fluorescence noted on the cleavage of the substrate BOC using an Olympus fluorescent microscope (model BX40 with an Olympus M-NUA filter), and representative images were captured using a spot CDD camera. The exposure and time settings were fixed within each experimental series.
To determine calpain activity in cell lysates, MAP2 (Cytoskeleton, Denver, CO) was labeled with DTAF by incubation of MAP2 and dichlorotriazinylaminofluorescein in (pH 8.5) PIPES buffer for 30 min at 4°C. Labeled MAP2 was then isolated by size exclusion column chromatography and dialyzed against (pH 7.5) HEPES buffer overnight. Cells were grown to confluence in six-well plates, quiesced for 24 h, and treated or not with 1 nM EGF. Cells were washed twice with ice-cold PBS and lysed with cell lysis buffer [20 nM HEPES (pH 7.4), 10% glycerol, 0.1% Triton X-100, 500 mM sodium chloride, and 1 mM sodium vanadate]. After removing the cell debris by centrifugation, 0.9 µg of DTAF-labeled MAP2 was added to the samples with 20 µM free Ca2+ concentration. Fluorescence was immediately measured by an Aminco-Bowman Series II spectrofluorimeter (Spectronic Instruments Inc., Rochester, NY) at excitation and emission wavelength of 470 and 520 nm, respectively, for 3 min at room temperature
To detect the total potential calpain activity in a cell, we used casein zymography. Twenty µg of cell lysate were resolved under nonreducing conditions by PAGE in HEPES-imidazole buffer with 5 mM EDTA that separates calpain-1 and -2 isoforms. After washing, gels were incubated for 20 h in a calpain activation buffer (20 mM 4-morpholinepropanesulfonic acid 2 plus 5 mM beta-mercaptoethanol) containing 5 mM CaCl2 or in 4-morpholinepropanesulfonic acid buffer without CaCl2 and with EDTA as a control. The gels were stained for protein content with transparent bands identified by comparison to calpain standards. The density of the bands was measured using NIH image.
Immunoblotting.
Protein expression was determined as described previously (17)
. Briefly, cells were washed in PBS and lysed in SDS lysis buffer before analysis by reducing SDS-PAGE. Primary antibodies included anticalpain-2 (clone N-19 and C-19; Santa Cruz Biologics, Santa Cruz, CA), anticalpain-1 (Biomol), and antiactin (Sigma). Bands were visualized using alkaline-phosphatase-coupled secondary antibody (Promega, Madison, WI).
Cell Proliferation Assay.
Mitogenic stimulus was determined by direct cell counting. Cells were plated in 24-well plates and cultured for 24 or 48 h in their regular medium, with or without leupeptin or CI-I. The number of cells was determined using a Coulter Counter model Z2 (Miami, FL).
Invasion Assays.
Invasive potential was determined in vitro by transmigration of an ECM (5)
. Matrigel invasion chamber plates were obtained from Becton Dickinson/Biocoat (Bedford, MA). The upper surface of the matrix was challenged with 20,000 cells, a number derived from empirical experimentation (22
, 23
, 35)
. Cells were kept in serum-free medium containing 1% BSA for the first 24 h and then replaced with only serum-free medium for the remaining 24 h; the lower chamber contained medium containing 10% serum for the entire assay. Enumeration of the cells that invaded through the matrix over a 48-h period was accomplished by visually counting cells on the bottom of the filter, as per routine procedures, after any uninvaded cells were removed from the top of the filter with a cotton swab. In all of the cases, individual experiments were performed in duplicate chambers.
True invasiveness of the cells was determined in vivo using the diaphragm invasion model (5 , 24 , 36) . For the first experimental series, 14 male 6-week-old Balb/c nu/nu athymic mice (day 0) were inoculated i.p. with 2 x 106 PA or WT DU145 cells and randomly separated into two groups at day 10. After 10 days, the mice received daily i.p. injections of 12 mg/kg of leupeptin or diluent only for 30 days. In the second experimental series, mice were inoculated with either PA or WT DU145 expressing C2AS minigene or V alone to assess AS down-regulation of calpain-2 on tumor invasion after 60 days. In all of the cases, invasion was determined as follows. Mice were sacrificed, and the diaphragm and any tumors were removed, fixed in 10% paraformaldehyde, and stained with H&E. Invasiveness was scored semiquantitatively on a four point scale measuring the greatest extent of invasion into the diaphragm muscle, with 0 being no invasion and 4 being complete transmigration of the diaphragm. Mice without evident diaphragmatic tumors were not included in the invasion scoring. Each experiment was repeated and the data collated for the two experiments. The number of mice challenged was determined a priori for a 95% confidence level of determining a difference (P < 0.05) using the assumptions of 80% diaphragmatic tumors with a 30% difference in invasiveness between the comparison groups; this yielded a minimum mouse number of 12 mice per test set. These assumptions were based on prior experimentation of altered EGFR or peritoneal lymphocyte signaling (24 , 36) . All of the animal experiments were certified by the University of Pittsburgh and Pittsburgh VA Medical Center Institutional Animal Care and Use Committees.
Microarray Gene Expression Analysis.
We queried the gene expression profile of 53 prostate cancers and 23 normal donors using the Affymetrix (Santa Clara, CA) system. These human tumor queries were determined as exemption 4 under pre-existing data and excess pathological specimens by the University of Pittsburgh Institutional Review Board; specimens were provided by an "honest broker," and the investigators were blinded as to patient identity. Designation of invasive (aggressive; n = 29) and localized (organ-confined; n = 24) was per pathology report for clinical use. In addition, 23 normal human prostates from organ donors were run in parallel.
Samples of prostate tissues obtained from prostatectomy were dissected and trimmed to obtain pure tumor (completely free of normal prostate acinar cells) or normal prostate tissues. Sandwich-frozen sections were performed by board-certified genito-urinary pathologists to examine the purity of the tumors. These tissues were then homogenized. Total RNA was extracted and purified with Qiagen RNeasy kit (Qiagen, San Diego, CA). Five µg of total RNA were used in the first strand cDNA synthesis with T7-d(T)24 primer [GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(dT)24] by Superscript II (Life Technologies, Inc., Rockville, MD). The second-strand cDNA synthesis was performed at 16°C by adding Escherichia coli DNA ligase, E. coli DNA polymerase I, and RnaseH in the reaction. This was followed by the addition of T4 DNA polymerase to blunt the ends of newly synthesized cDNA. The cDNA was purified through phenol-chloroform and ethanol precipitation. The purified cDNA was then incubated at 37°C for 4 h in an in vitro transcription reaction to produce cRNA labeled with biotin using MEGAscript system (Ambion, Inc., Austin, TX).
Hybridization was as follows. Fifteen to 20 µg of cRNA were fragmented by incubating in a buffer containing 200 mM Tris-acetate (pH 8.1), 500 mM KOAc, and 150 mM MgOAc at 95°C for 35 min. The fragmented cRNA were then hybridized with a pre-equilibrated Affymetrix chip at 45°C for 14–16 h. After the hybridization mixtures were removed, the chips were then washed in a fluidic station with low-stringency buffer (6x saline-sodium phosphate-EDTA, 0.01% Tween 20, and 0.005% antifoam) for 10 cycles (2 mixes/cycle) and stringent buffer (100 mM 4-morpholinepropanesulfonic acid, 0.1 M NaCl and 0.01% Tween 20) for 4 cycles (15 mixes/cycle), and stained with strepto-avidin phycoerythrin. This was followed by incubation with biotinylated mouse antiavidin antibody, and restained with strepto-avidin phycoerythrin. The chips were scanned in a HP ChipScanner (Affymetrix Inc.) to detect hybridization signals.
Data were analyzed by importing the hybridization data from text files into an Microsoft excel spreadsheet. GeneSpring 4.2 along with Michael Eisen’s cluster and tree view software were the primary analysis tools. Principle component analysis and logistic regression were performed using S-Plus (Statistical Sciences, Inc.) statistical software.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. The data are normalized to the respective mock-treated controls; WT DU145 cells are 1.7 (35)
to 2.0 (data herein; P < 0.05) times more invasive than PA DU145 cells. EGFR-signaled cell motility was examined under conditions that minimize autocrine EGFR signaling (Fig. 1B)
. As shown in PA DU145 cells, EGF increased motility, which was abrogated by PD153035. These data support the previous literature (22
, 35
, 36)
and demonstrate that the invasiveness of these cells is driven by EGFR signaling.
|
). The number of cells that reached the lower chamber within 48 h was significantly decreased by both inhibitors in both cell lines; the absolute invasiveness of WT DU-145 cells was 2.0-fold that of PA DU-145 cells. This agent-related decrement in cells transmigrated was not secondary to decreased proliferation (15
, 20
, 29
, 39)
, as the concentrations of CI-1 and leupeptin used in this assay did not block cell proliferation (Fig. 2B)
.
|
. First, we ascertained calpain activity in vivo by visualizing the bright blue fluorescence after the proteolysis of BOC-LM-CMAC, a calpain-selective substrate (42)
. Induced calpain activity was inhibited by both CI-1 and leupeptin in both PA and WT cells lines (Fig. 3A)
. In addition, we quantitated calpain activation using cleavage of the prefluorescence substrate DTAF from MAP2; again, both inhibitors limited or eliminated EGF-induced activation of calpain (Fig. 3B)
. WT DU145 demonstrated a somewhat higher basal activity as expected because of increased autocrine EGFR signaling (35)
, as it was inhibited by the pharmacologic agent PD153035 (Fig. 3B)
. Induced calpain activity was inhibited by both CI-1 and leupeptin to a level similar to that seen in the presence of PD153035 (Fig. 3B)
. The higher basal activity observed in WT compared with PA cells is not attributable to a higher amount of calpain-1 or -2 expression (Fig. 2C)
. Thus, we had evidence for calpain inhibition limiting tumor cell invasion.
|
. A control scrambled oligonucleotide did not effect these parameters.
|
; such partial down-regulation was expected because calpain-2 is required for cell viability and growth (15
, 20
, 29
, 39)
; importantly, a similar level of calpain-2 down-regulation eliminates EGF-induced calpain activity and motility in fibroblasts (17)
. These cells were significantly less invasive than a PA DU145 derivative expressing the vector alone as a control. This decrement in invasiveness was not because of decreased cell numbers, whether reduced proliferation or survival, because the two derivative polyclonal lines grew at the same rate. In sum, these data strongly suggest that calpain-2 activation is required for increased tumor cell motility and subsequent invasiveness in vitro.
|
. Invasion into other soft organs was not scored because of difficulty in quantitation but qualitatively reflected this difference. The reduction of invasiveness seen with leupeptin was not attributable to decreased tumor growth, because tumors in the diaphragm with the same size from treated or not treated mice showed different level of invasiveness (Fig. 6)
. This is expected, because leupeptin did not affect cell proliferation (Fig. 2B)
.
|
|
. Mice inoculated with the calpain-2 AS showed 50% less invasiveness compared with the mice carrying the vector alone (Fig. 7)
. The PA DU145 cells exhibited high significance in themselves, whereas the WT DU145 were marginally inhibited; this affect is likely because of the few mice challenged in this second series, which was curtailed because of the outcome of the P DU145 cells. Again the tumor take rates and size of the diaphragm tumors were indistinguishable between the sublines expressing C2AS or V constructs. This degree of inhibition of invasiveness by slightly more than half was in line with the extent of inhibition shown by leupeptin.
|
|
. In addition, 23 normal prostates were queried on the same chip set. We also examined the expression of calpain-1 and calpastatin, because these might alter the calpain activity balance. Analysis of the expression levels of all five of the calpain-related hybridization spots using the Welch t test indicated minimum variation of gene expression across all of the samples. Calpain-2 and calpain-1 expression were characterized as being at moderate levels, whereas expression of calpastatin was minimum. No significant expression change was identified when aggressive prostate cancer was compared with normal donor or organ-confined prostate cancers.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Our data strongly implicate calpain-2 control of cell motility as the operative target. However, this assignment is compromised by the lack of selectivity of the pharmacological agents for the calpain-2 isoform; this is especially true for the broad spectrum inhibitor leupeptin. Despite this uncertainty of inhibition, leupeptin was chosen, because it has been used in both animals and humans with minimal reported toxicity (37 , 38) . Still, a strong case for calpain-2 being the critical element is made by the fact that AS approaches to calpain-2 mimic the findings with leupeptin and CI-I. Whereas leupeptin inhibits both intracellular and extracellular proteases, and ECM remodeling might be hindered (43) , the expression of the AS calpain-2 minigene should not alter the myriad of extracellular proteases. Thus, a confluence of data support targeting calpain-2.
A second point of contention may rest on which cell behavior is limited by calpain inhibition. In many settings calpain activity is required for cell proliferation or apoptosis in addition to motility (20)
. Our in vitro data suggest that in this setting our level of calpain inhibition does not affect cell proliferation (Fig. 2B
; Fig. 5C
). However, the in vivo experiments are not readily amenable to such analyses; although the fact that the tumor take rate (Tables 1
and 2)
and size of the tumors were indistinguishable between the calpain-inhibited and control tumors is reassuring that overall cell number is not the main target of calpain inhibition.
It is possible that the increased motility and invasion may be indirectly related to calpain activation because the broad spectrum of calpain targets may also involve regulation of secreted proteases. We feel that this is an unlikely mechanism, because our earlier works failed to demonstrate differences in protease production between PA and WT DU145 (35) . Furthermore, because motility over a two-dimensional surface is also affected, the need for extracellular proteases to modify a "barrier" matrix is limited, although others have suggested that matrix metalloprotease 9 is required for dispersion of cohesive keratinocytes even over a matrix surface (44) . However, in our earlier survey of cellular proteases produced by DU145 sublines, matrix metalloprotease 9 was secreted at equivalent levels by the three syngeneic lines (35) . Lastly, EGF only activates calpain-2 in the immediate subplasma membrane locale (45) , and, thus, protease maturation is not likely globally affected by such localized signaling. However, until the identification of the specific target of calpain during induced motility (14) , both indirect as well as direct molecular mechanisms must be considered.
Prostate cancer motility and invasion likely uses both ubiquitous calpain isoforms, calpain-2 and calpain-1, for cell movement. This is because prostate carcinoma cells present both integrins capable of promoting haptokinesis and EGFR-mediate autocrine signaling loops that induce chemokinesis (46) . Calpain-1 (µ-calpain) has a calcium-dependency that can be attained in living fibroblasts and epithelial cells (47) . The autocrine EGFR-mediated signaling would activate calpain-2 preferentially via an ERK mitogen-activated protein kinase pathway at the inner face of the plasma membrane (17 , 45) . Thus, there appears to be a convergent signaling through the two ubiquitous calpain isoforms to regulate cell deadhesion (14) . Whereas this might suggest that the best target for intervention is the end target, there are reasons to focus on calpains. First, the presumably common end target(s) might be individually sufficient, but none are actually required, making specific intervention ineffectual. Second, it is likely that the end target of calpain is a structural component and, thus, not readily "inhibitable," although the activation of the rho-GTPase may suggest sensitive points for intervention (48) . Third, the ability to inhibit only one isoform may limit toxicity, because homeostatic mechanisms that require low level motility, such as colonic or skin epithelial replacement, would use one of the isoforms and not the other in the absence of injury repair needs (49) . Unfortunately, the commonly available inhibitors such as leupeptin and CI-I do not distinguish between the isoforms, making molecular approaches the only viable option at present to determine whether inhibition of a single isoform can accomplish blockade of tumor invasiveness. Obviously, new, isoform-specific small molecule inhibitors would greatly advance our understanding of the physiology of calpain activation.
The question remains of whether these findings in model systems translate to the human clinical situation. We surveyed 53 specimens from human prostate tumors and normal prostate tissue. Segregated by tumor stage, invasiveness, and metastases, we found no significant differences in mRNA levels of these tissues. This is in contradistinction to a recent report in which calpain-2 mRNA was found to be mildly (1.4 times) up-regulated in prostate carcinomas in conjunction with cadherin cleavage (50)
. We did not note this increased transcript level in our series of tumors, although the reasons for this discrepancy are not evident at present. However, in a different tissue, calpain-2 levels were not increased over that in normal skin in either squamous or basal cell carcinomas (51)
. Another calpain isoform reported altered in tumors, calpain-9 (31)
is not reliably detectable in our prostate tissues: neither normal donor nor tumor (data not shown). According to accepted models of calpain activation (14
, 15
, 25)
, the lack of transcriptional change is not unexpected. Calpains appear to be activated at a post-translational level with calcium or other mechanisms, such as coactivators or phosphorylation (52, 53, 54)
,4
being the operative event. In fact, in studies that attempt to exogenously express calpains, one usually fails to attain even a doubling of calpain levels, as higher activity leads to apoptosis (55)
. Thus, to demonstrate increased calpain activation in invasive tumors would require a way to assess in situ activation. For live cells, this can be accomplished by fluorescent substrates (Fig. 2)
. However, in nonliving cells we need to develop reagents to detect either the post-translational modifications that mark activation or colocalization of the activator cofactors.
In summary, we found that targeting calpain can limit prostate cancer cell invasiveness both in vitro and in vivo. This was likely because of the inhibition of rear deadhesion during growth factor-induced motility. In fact, CI-I limits EGFR-mediated deadhesion of DU145 cells (data not shown) similar to the calpain-dependent detachment of fibroblasts (17) and epithelial keratinocytes (21) . Our operative model of calpain function during tumor invasion posits an epigenetic or post-translational activation of calpain-2 rather than significant changes in protein levels. A survey of mRNA profiles of human prostate carcinoma specimens supports this by failing to demonstrate calpain gene expression differences between invasive and noninvasive carcinomas. However, to fully demonstrate the validity of this model will require a knowledge of how calpain-2 is activated and development of tools to detect such changes in activation. Additionally, the targeting of calpain-2 as a rational therapeutic intervention strategy will also necessitate new reagents, isoform-specific inhibitors. Because of the high degree of homology at the amino acid and structure levels (25) molecular agents offer the greatest hope of discriminatory agents. Thus, the full exposition of this potential novel target to limit tumor progression will rely as much on technical developments as on biological insights.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by grants from the VA Merit Award program, the United States Army CMRP in Prostate Cancer, and National Cancer Institute. 
2 To whom requests for reprints should be addressed, at Department of Pathology, 713 Scaife, University of Pittsburgh, Pittsburgh, PA 15261. Phone: (412) 647-7813; Fax: (412) 647-8567; E-mail: wellsa{at}msx.upmc.edu
3 The abbreviations used are: WT, wild-type; EGFR, epidermal growth factor receptor; EGF, epidermal growth factor; CI, calpain inhibitor; AS, antisense; MAP, microtubule-associated protein; V, vector; ECM, extracellular matrix.
Received 10/23/02. Accepted 5/23/03.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
inducible protein-9 as a mediator of epidermal-dermal communication during wound repair. J. Investig. Dermatol., 120: 1110-1117, 2003.[Medline]
-mediated signaling in tumor cell invasion. Clin. Cancer Res., 5: 2251-2260, 1999. signaling abrogates DU-145 prostate tumor cell invasion. Clin. Cancer Res., 3: 2275-2282, 1997.
s. Science (Wash. DC), 263: 1278-1281, 1994.This article has been cited by other articles:
|
|
 |
|
  B. A. Babbin, S. Koch, M. Bachar, M.-A. Conti, C. A. Parkos, R. S. Adelstein, A. Nusrat, and A. I. Ivanov Non-Muscle Myosin IIA Differentially Regulates Intestinal Epithelial Cell Restitution and Matrix Invasion Am. J. Pathol., February 1, 2009; 174(2): 436 - 448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Guo, S. Ibaragi, T. Zhu, L.-Y. Luo, G.-F. Hu, P. S. Huppi, and C. Y. Chen Nicotine Promotes Mammary Tumor Migration via a Signaling Cascade Involving Protein Kinase C and cdc42 Cancer Res., October 15, 2008; 68(20): 8473 - 8481. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Cortesio, K. T. Chan, B. J. Perrin, N. O. Burton, S. Zhang, Z.-Y. Zhang, and A. Huttenlocher Calpain 2 and PTP1B function in a novel pathway with Src to regulate invadopodia dynamics and breast cancer cell invasion J. Cell Biol., March 5, 2008; 180(5): 957 - 971. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Xu and X. Deng Suppression of Cancer Cell Migration and Invasion by Protein Phosphatase 2A through Dephosphorylation of {micro}- and m-Calpains J. Biol. Chem., November 17, 2006; 281(46): 35567 - 35575. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-T. Su, M. A. Agapito, M. Li, W. T. N. Simonson, A. Huttenlocher, R. Habas, L. Yue, and L. W. Runnels TRPM7 Regulates Cell Adhesion by Controlling the Calcium-dependent Protease Calpain J. Biol. Chem., April 21, 2006; 281(16): 11260 - 11270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Helfer, B. C. Boswell, D. Finlay, A. Cipres, K. Vuori, T. Bong Kang, D. Wallach, A. Dorfleutner, J. M. Lahti, D. C. Flynn, et al. Caspase-8 Promotes Cell Motility and Calpain Activity under Nonapoptotic Conditions. Cancer Res., April 15, 2006; 66(8): 4273 - 4278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Sawhney, M. M. Cookson, Y. Omar, J. Hauser, and M. G. Brattain Integrin {alpha}2-mediated ERK and Calpain Activation Play a Critical Role in Cell Adhesion and Motility via Focal Adhesion Kinase Signaling: IDENTIFICATION OF A NOVEL SIGNALING PATHWAY J. Biol. Chem., March 31, 2006; 281(13): 8497 - 8510. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Xu and X. Deng Protein Kinase C{iota} Promotes Nicotine-induced Migration and Invasion of Cancer Cells via Phosphorylation of {micro}- and m-Calpains J. Biol. Chem., February 17, 2006; 281(7): 4457 - 4466. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. J. Perrin, K. J. Amann, and A. Huttenlocher Proteolysis of Cortactin by Calpain Regulates Membrane Protrusion during Cell Migration Mol. Biol. Cell, January 1, 2006; 17(1): 239 - 250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Libertini, B. S. Robinson, N. K. Dhillon, D. Glick, M. George, S. Dandekar, J. P. Gregg, E. Sawai, and M. Mudryj Cyclin E Both Regulates and Is Regulated by Calpain 2, a Protease Associated with Metastatic Breast Cancer Phenotype Cancer Res., December 1, 2005; 65(23): 10700 - 10708. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Franco and A. Huttenlocher Regulating cell migration: calpains make the cut J. Cell Sci., September 1, 2005; 118(17): 3829 - 3838. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Satish, H. C. Blair, A. Glading, and A. Wells Interferon-Inducible Protein 9 (CXCL11)-Induced Cell Motility in Keratinocytes Requires Calcium Flux-Dependent Activation of {micro}-Calpain Mol. Cell. Biol., March 1, 2005; 25(5): 1922 - 1941. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Xu and X. Deng Tobacco-specific Nitrosamine 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone Induces Phosphorylation of {micro}- and m-Calpain in Association with Increased Secretion, Cell Migration, and Invasion J. Biol. Chem., December 17, 2004; 279(51): 53683 - 53690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lakshmikuttyamma, P. Selvakumar, R. Kanthan, S. C. Kanthan, and R. K. Sharma Overexpression of m-Calpain in Human Colorectal Adenocarcinomas Cancer Epidemiol. Biomarkers Prev., October 1, 2004; 13(10): 1604 - 1609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Huber, D. Vlasny, S. Jeckel, F. Stubenrauch, and T. Iftner Gene Profiling of Cottontail Rabbit Papillomavirus-Induced Carcinomas Identifies Upregulated Genes Directly Involved in Stroma Invasion as Shown by Small Interfering RNA-Mediated Gene Silencing J. Virol., July 15, 2004; 78(14): 7478 - 7489. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
