
[Cancer Research 63, 4684-4691, August 1, 2003]
© 2003 American Association for Cancer Research
Overexpression of Vascular Endothelial Growth Factor by MCF-7 Breast Cancer Cells Promotes Estrogen-independent Tumor Growth in Vivo1
Ping Guo,
Quan Fang,
Huo-Quan Tao,
Christopher A. Schafer,
Bruce M. Fenton,
Ivan Ding,
Bo Hu2 and
Shi-Yuan Cheng2
University of Pittsburgh Cancer Institute and Department of Pathology [P. G., Q. F., H-Q. T., C. A. S., S-Y. C.] and Medicine [B. H.], Research Pavilion at Hillman Cancer Center, Pittsburgh, Pennsylvania 15213-1863, and University of Rochester Cancer Center and Department of Radiation Oncology, Rochester, New York 14642 [B. M. F., I. D.]
 |
ABSTRACT
|
|---|
Alteration of the phenotype of breast cancers from estrogen-dependent to estrogen-independent growth often leads to the failure of antiestrogenic tumor therapies. We report that overexpression of vascular endothelial growth factor (VEGF) by estrogen-dependent MCF-7 breast cancer cells could abolish estrogen-dependent tumor growth in ovariectomized mice. In the absence of estrogen, MCF-7 VEGF-expressing tumors with increased vessel density showed growth kinetics similar to, or even greater than, that of parental MCF-7 tumors with estrogen supplementation. Overexpression of VEGF by MCF-7 cells or treatment on parental MCF-7 cells with recombinant VEGF also stimulated cell proliferation in culture. Our data suggest that VEGF stimulation of MCF-7 tumor angiogenesis and growth is mediated by both autocrine and paracrine mechanisms.
 |
INTRODUCTION
|
|---|
Progressive growth of human breast cancers is dependent on estrogen or other estrogenic hormones (1)
. A considerable number of estrogen-dependent breast tumors often evolve to demonstrate more aggressive and estrogen-independent growth patterns, which are responsible for frequent failures of antiestrogenic breast cancer therapies (2)
. Although the molecular events of breast tumorigenesis have been illustrated in great detail, the mechanisms that enable breast cancer cells to acquire the estrogen-independent growth phenotype remains largely unknown. Studies show that estrogen promotes breast cancer progression by interacting with its nuclear receptors, thus regulating a set of genes important for breast cancer growth. Accumulating evidence suggests that acquisition of estrogen-independent breast tumor growth is accompanied by constitutively increased expression of a similar set of the genes that are up-regulated by estrogen during estrogen-dependent breast tumor progression (3)
.
VEGF,3
a major angiogenic factor involved in breast cancer progression, is one of the genes that is stimulated by estrogen (4
, 5)
. Functional estrogen-responsive elements in the gene of VEGF have been identified through which estrogen directly regulates VEGF transcription in breast cancer cells (6, 7, 8)
. VEGF produced by breast carcinoma cells stimulates angiogenesis through a paracrine mechanism in tumor ECs (9)
and promotes cell growth by an autocrine pathway in tumor cells (10, 11, 12)
. In humans, VEGF exists as six alternatively spliced isoforms, of which VEGF121 and VEGF165 are the predominant isoforms (9)
. VEGF exerts its cellular functions by interacting with VEGF receptors, VEGFR-1, VEGFR-2, as well as a VEGF165 receptor, NRP-1. In addition to ECs, VEGF receptors are also found in breast cancer cells (10
, 13)
. Recent studies have shown that both estrogen and VEGF regulate a similar subset of genes in promoting breast cancer progression (5)
. Therefore, we hypothesized that overexpression of VEGF by estrogen-dependent breast cancer cells could produce an effect on breast cancer progression (acquisition of estrogen-independent growth) similar to the growth stimulation induced by estrogen.
In this report, we show that overexpression of VEGF isoforms, VEGF121 or VEGF165, by estrogen-dependent MCF-7 breast cells stimulated breast tumor formation in an estrogen-independent fashion in ovariectomized mice, in the absence of E2 treatment. In addition, VEGF strongly stimulated neovascularization in MCF-7 tumors formed either in E2-treated or non-E2-treated mice, as well as enhanced estrogen-dependent tumor growth in E2-treated mice. Our findings suggest that up-regulation of VEGF in estrogen-dependent breast cancers contributes to the acquisition of estrogen-independent cancer growth by stimulating tumor angiogenesis and progression through both autocrine and paracrine mechanisms.
 |
MATERIALS AND METHODS
|
|---|
Cell Lines and Reagents.
MCF-7 cells were obtained from American Type Culture Collection (Rockville, MD). MCF-7 cells were cultured using DMEM (Invitrogen/Life Technologies, Inc., Grand Island, NY) supplemented with 10% FBS (Hyclone, Salt Lake City, UT), 10 µg/ml of insulin (Sigma, St. Louis, MO), and 1% penicillin-streptomycin. All of the other chemicals and reagents were from Sigma, Fisher Scientific (Hanover Park, IL), or Invitrogen (Rockville, MD).
Generation of MCF-7 Cell Lines That Stably Express VEGF or LacZ Proteins.
Transfected MCF-7 cell clones that stably express VEGF or LacZ were generated by transfecting MCF-7 cells with cDNA inserts of VEGF121, VEGF165, or LacZ in a pCEP4 vector. Forty-eight h after the transfection, the cells were harvested and seeded as 500 cells/10-cm culture dish with DMEM containing 10% FBS, 10 µg/ml insulin, and hygromycin. Hygromycin-resistant clones that overexpressed VEGF121 or VEGF165 were expanded and characterized with Western Blotting analysis followed by VEGF ELISA as described previously (14)
. To obtain MCF-7 LacZ-overexpressing cell clones, a pool of LacZ-transfected MCF-7 cells was harvested and sorted using a fluorescence-activated cell sorter into 96-well flat-bottomed plates with 200 µl DMEM supplemented with 15% FBS. The clones that expressed exogenous ß-galactosidase were expanded and identified by LacZ staining (14)
.
RNA Isolation and RT-PCR Analyses.
Total RNA was isolated as described previously (14)
. Two µg of total RNA from each cell line was used for reverse transcription reactions with or without reverse transcriptase. Synthesized first-strand cDNAs were used for PCR reactions. The conditions for PCR reactions were 95°C, 3 min; 35 cycles of 95°C, 30 s; 61°C (VEGFR-1) or 51°C (VEGFR-2), 30 s; and 72°C, 1 min. An additional 10-min at 72°C was followed after the 35 cycles. The PCR products were analyzed on a 4% agarose gel. Primers for VEGFR-1 were 5'GCACCTTGGTTGTGGCTGAC3' (forward primer) and 5'GGTTTCGCAGGAGGTATGGTG3' (reverse primer). Primers for VEGFR-2 were 5'TATGTCTATGTTCAAGATTAC3' (forward primer) and 5'AAGTTTCTTATGCTGATGCTT3' (reverse primer). The lengths of PCR products were 441 bp for VEGFR-1 and 473 bp for VEGFR-2, respectively.
Tumorigenicity and Tissue Processing.
Human MCF-7 breast tumors were established in the mammary fat pads of ovariectomized female nude mice as described previously (15)
. Briefly, 1 x 107 of various types of MCF-7 cells were inoculated into the mammary fat pads of 78-week old ovariectomized female nude mice that were or were not implanted with E2 60-day slow release pellets (Innovative Research of America, Sarasota, FL). The volumes of the tumors were measured using a caliper every fifth day. At the indicated times, the mice were sacrificed, and the tumors were removed and processed (16)
.
IHC Analyses of the MCF-7 Cell-derived Tumors.
IHC analyses were performed on 5-µm cryostat tissue sections of various types of MCF-7 tumors as described previously (16)
. The following reagents were used for this study: rat antimouse CD31 antibody, its isotype control IgG2a.
(1:1000 dilution for each antibody; BD-PharMingen, San Diego, CA), goat antihuman VN antibody (C-20; 1:200), goat antihuman FN antibody (C-20; 1:200; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), mouse monoclonal anti-VEGFR-1 antibody (P3H8A9; 1:100), rabbit polyclonal anti-VEGFR-2 antibody (T014; 1:200), and rabbit polyclonal anti-NRP-1 antibody, NP1ECD1A (1:1000; Ref. 16
). The secondary and tertiary antibodies were from Vector Laboratories (Burlingame, CA) or Jackson ImmunoResaerch laboratories (West Grove, PA). A 3,3'-diaminobenzidine elite kit was from Dako Co. (Carpinteria, CA). Aqua block was from East Coast Biologics, Inc. (North Berwick, ME).
Quantitative analyses of blood vessel were performed on serial-cut tumor sections that were stained with the anti-CD31 antibody. Five to seven serial-cut tumor sections from each mouse were analyzed. Images (1015 random fields per section) were acquired using a SPOT digital camera (x100 magnification) on an Olympus BX51 microscope using Image Pro Plus software (Version 4.1; Media Cybernetics, L.P., Silver Spring, MD). Blood vessel densities were calculated as the positively stained areas to the total tissue area of the field (17)
. The mean values of the calculated densities from the serial sections of the separate tumors (48 individual mice) in each group were used for the quantitative analysis.
Cell Proliferation Assay.
Evaluation of MCF-7 cell proliferation was performed using the Biotrak cell proliferation ELISA system (Amersham Pharmacia Biotech, Piscataway, NJ). Various types of MCF-7 cells were seeded in 96-well plates at 60% confluence and maintained at 37°C in phenol red-free DMEM containing 10% charcoal-treated FBS. Twenty-four h later, the medium was changed to serum-free/phenol red-free DMEM with or without addition of stimuli for 48 h. To evaluate the cell-proliferative index of VEGF-overexpressing MCF-7 cells, nothing was added into the medium. To determine the effect of exogenous VEGF on parental MCF-7 cells or whether E2 potentiates VEGF-stimulated cell proliferation of parental MCF-7 cells, 100 ng/ml of recombinant VEGF121 or VEGF165 proteins (R&D Systems, Minneapolis, MN) was included in the presence or absence of 1.0 nM of E2 (18)
. Then, BrdUrd was added into the wells for an additional 2 h. The cells were fixed and incubated with a peroxidase-conjugated anti-BrdUrd antibody according to the manufacturers instructions. The developed color was measured at 450 nm in a microtiter plate spectrophotometer. To assess the effects of ECM components on enhancing the VEGF-stimulated BrdUrd incorporation, 96-well plates were precoated with VN (400 ng/ml), FN (5.0 µg/ml), or Matrigel (1.0 µg/ml; Becton Dickinson Biosciences, Bedford, MA). The plates were kept at 4°C overnight. The coating solution was then aspirated, and the coated plates were allowed to dry. In blocking experiments, a neutralizing anti-VEGF antibody (10 µg/ml; R&D Systems) was included in the assays.
 |
RESULTS
|
|---|
Stable Expression of VEGF121, VEGF165, or LacZ Proteins in MCF-7 Cells.
MCF-7 cells were stably transfected with pCEP4 vectors that have a cDNA insert of VEGF121, VEGF165, or LacZ. Hygromycin-resistant clones were characterized either by Western blotting using an anti-VEGF antibody or by fluorescence sorting with a fluorescence-activated cell sorter followed by LacZ cell staining (14)
. Seventeen MCF-7 cell clones that express VEGF121 (referred to as V121), 19 MCF-7 cell clones that express VEGF165 (referred to as V165), and 6 MCF-7 cell clones that express LacZ (referred to as LacZ) were identified. Each clone of V121 or V165 cells expressed exogenous VEGF proteins at high levels (only 4 representative clones of each type are shown in Fig. 1A
), whereas no VEGF was detected in either MCF-7 or LacZ cells by VEGF Western blotting. Similarly, the amounts of VEGF secreted by V121 or V165 clones into CM ranged from 288 to 421 ng/ml/106 cells after 48-hs of cell culture (Fig. 1B)
. In contrast, parental MCF-7 or LacZ cells only secreted 36 ng/ml/106 cells into the CM. Among the VEGF-expressing cell clones, clones 10 and 53 of V121 cells, and clones 35 and 37 of V165 cells were chosen for subsequent studies.

View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Overexpression of VEGF121 or VEGF165 by MCF-7 breast cancer cells. A, Western blot analyses. Thirty µg of total protein from the lysates of the various types of MCF-7 cells was analyzed by immunoblotting. VEGF121 or VEGF165 ran at 18 kDa or 22 kDa with nonglycosylated (bottom band) and glycosylated forms (top band). B, VEGF ELISA analysis. The CM was collected from various types of MCF-7 cells after 48 h of cell culture and analyzed with a VEGF ELISA kit. Each bar represents the mean of three triplicates; bars, ±SE. Both experiments were performed at least two additional times with similar results.
|
|
Expression of VEGF121 or VEGF165 by MCF-7 Cells Enhanced E2-dependent Breast Tumor Growth.
To determine whether expression of VEGF121 or VEGF165 by MCF-7 cells would enhance MCF-7 breast tumor growth in vivo, MCF-7, LacZ, V12110, V12153, V16535, or V16537 cells were implanted orthotopically in ovariectomized nude mice with E2-supplementation (Fig. 2, A and B)
. At 45 days after implantation, 53% or 40% of E2-treated mice that received MCF-7 or LacZ cells developed tumors, with volumes of 307 ± 42.4 mm3 (n = 6; MCF-7 tumors) or 242 ± 50.6 mm3 (n = 6; LacZ tumors), respectively (Table 1)
. There were no significant differences in tumor volume or tumor formation between these two groups (P = 0.98). In contrast, with E2 treatment, expression of VEGF121 or VEGF165 not only increased the frequency of MCF-7 tumor formation to 90% (V121 tumors) or 86% (V165 tumors), but also dramatically enhanced tumor growth (1263 ± 214.3 mm3 for V121 tumors; n = 8; P < 0.001 or 1638 ± 189.5 mm3 for V165 tumors; n = 8; P < 0.001). In the presence of E2, VEGF165 seemed to have a stronger effect on promoting MCF-7 tumor growth than VEGF121 did (Fig. 2
; Table 1
; P < 0.05). Thus, with E2 treatment, expression of either VEGF121 or VEGF165 by MCF-7 cells facilitated MCF-7 cancer tumorigenesis.

View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Overexpression of VEGF121 or VEGF165 by MCF-7 breast cancers promoted tumorigenicity in both E2-treated and non-E2-treated mice. One x 107 of the MCF-7, LacZ, V121, or V165 cells were inoculated into the mammary fat pads of mice implanted with or without 60 D-releasing 17-ß estradiol pellets. A, photographs of individual mice inoculated with various types of MCF-7 cells. Breast tumors formed by MCF-7 (a), Lac Z (b), V121 (c and e), or V165 (d and f) cells. Panels ad, tumors established in E2-treated mice. Panels e and f, tumors formed in non-E2-treated mice. Arrows indicate the established MCF-7 tumors. Because no tumors were formed in the non-E2-treated mice inoculated with MCF-7 or Lac Z cells, photographs were not taken for those mice. B, the growth kinetics of the various MCF-7 tumors. Tumor volumes were measured at the indicated times after implantation. Data are shown as the mean (16)
; bars, ±SE. Two separate clones from each type of LacZ, V121, or V165 cells were individually inoculated. The experiments included 610 mice in each group and were preformed three separate times each at two different institutions with similar results.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1 Tumor growth of MCF-7 VEGF isoform transfectants in nude mice with or without estrogen supplements
Numbers in parentheses are the frequency of the formation of various MCF-7 tumors in mice.
|
|
Expression of VEGF121 or VEGF165 in MCF-7 Cells Rendered E2-independent Breast Tumor Growth.
In parallel experiments, MCF-7, LacZ, V12110, V12153, V16535, and V16537 cells were inoculated separately into the mammary fat pads of ovariectomized mice without E2-supplementation (Fig. 2, A and B
; Table 1
). Without E2-treatment, neither MCF-7 nor LacZ cells formed tumors in ovariectomized mice (n = 6 in each group). In sharp contrast, 81% of the mice that received V12110 or V12153 cells developed tumors at 45 days after inoculation, with a volume of 830.6 ± 261 mm3 (n = 8; P < 0.002). Also, 90% of the mice that received V16535 or V16537 cells formed tumors, with a volume of 391.4 ± 113.6 mm3 (n = 10; P < 0.0001). The tumorigenicity experiments (either with or without E2 treatment) were independently performed a total of six times at two different institutions (the laboratory of S-Y. C., and the laboratories of I. D. and B. M. F.), with similar results. Therefore, expression of VEGF121 or VEGF165 by MCF-7 breast cancer cells rendered E2-independent MCF-7 tumor formation in ovariectomized animals.
VEGF121 or VEGF165 Enhanced Neovascularization in MCF-7 Breast Tumors in Either E2-treated or Non-E2-treated Mice.
VEGF is a potent stimulator of breast tumor angiogenesis (9)
. Therefore, we examined whether enhanced tumorigenicity by expression of VEGF121 or VEGF165 in MCF-7 cells elicited angiogenesis in the various types of MCF-7 tumors. The fractional area of blood vessels for E2-dependent tumors derived from MCF-7 cells was similar to that of LacZ tumors. (Fig. 3A
, panels a and b, and Fig. 3B
; P = 0.99). In comparison with the MCF-7 tumors in mice with E2 treatment, the vascular fractional areas in V121 or V165 tumors with E2 treatment increased by 3.29-fold or 3.45-fold compared with controls (Fig. 3A
, compare panels c and d with a and b; Fig. 3B
; P < 0.001). To a similar extent, the vascular fractional area of V121 or V165 tumors in mice without E2 treatment increased by 3.25-fold and 3.77-fold, respectively (Fig. 3A
, compare panels e and f with a and b; Fig. 3B
; P < 0.001). Thus, overexpression of VEGF121 or VEGF165 by the MCF-7 tumors stimulated neovascularization in both E2-treated and non-E2-treated mice.

View larger version (86K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. VEGF121 or VEGF165 stimulated angiogenesis in MCF-7 breast cancers in both E2-treated and non-E2-treated mice. A, IHC stains of tumor vessels with a monoclonal anti-CD31 antibody. Breast tumors formed by MCF-7 (a), Lac Z (b), V121 (c and e), or V165 (d and f) cells. Panels ad, tumors established in E2-treated mice. Panels e and f, tumors developed in non-E2-treated mice. Because no tumors were formed in the mice that received MCF-7 or LacZ cells without E2 supplementation, no analysis was done. Arrows indicate blood vessels. Four to 8 individual tumor samples of each class from each in vivo experiment were analyzed, and the experiments were repeated at least two additional times with similar results. Original magnification: x200. B, quantitative analysis of the increased fractional vascular area in VEGF-expressing MCF-7 tumors (17)
. Representative IHC stains from the various MCF-7 tumors are shown in A. Data are means; bars, ±SD. Numbers above each bar indicate the numbers of mice analyzed in each group. Numbers in the parentheses under the X-axis are the differences (in folds) of the VEGF expressing tumors in comparison with parental MCF-7 tumors.
|
|
VEGF Receptors Were Expressed in MCF-7 Breast Tumor Cells as well as in ECs.
VEGF exerts its biological functions through interaction with its functional receptors, VEGFR-1 (Flt-1), VEGFR-2 (Flk-1/KDR), as well as a VEGF165 receptor, NRP-1 (9)
. As shown in Figs. 2
and 3
, and Table 1
, expression of VEGF121 or VEGF165 enhanced MCF-7 tumor growth and angiogenesis. However, the effect of VEGF-stimulated angiogenesis alone was unlikely to be potent enough to enable E2-dependent MCF-7 tumor cells to establish E2-independent tumors in non-E2-treated mice. We hypothesized that the VEGF produced by V121 or V165 tumor cells might have autocrine effects on MCF-7 tumor cells themselves. These autocrine effects might be similar to the effect of VEGF on cell proliferation of E2-dependent T47D breast tumor cells (10)
or of E2-independent MDA-MB-231 breast tumor cells (11
, 12)
. Therefore, we examined the expression of VEGFRs in MCF-7 cells and various MCF-7 tumors. In cultured cells, the expressions of VEGFR-1, VEGFR-2, and NRP-1 (data not shown) were detected in MCF-7 cells by RT-PCR analyses, although the expression levels of VEGFR-2 was low (Fig. 4A)
. There were no significant differences in expression levels of VEGFR-1, VEGFR-2, or NRP-1 among MCF-7, LacZ, V121, and V165 cells (data not shown). In the various types of MCF-7 tumors established in either E2-treated or non-E2-treated mice, expression of VEGFR-1 and -2 were detected in most of the tumor vessels (Fig. 4B
, arrowheads; data for VEGR-2 is not shown). The expression of VEGFR-1 and -2 on the vessels correlated with the CD31 staining of the vessels in the various tumors (Fig. 3A
; Fig. 4B
). In corroboration of the expression of mRNAs of VEGFR-1 or NRP-1 in MCF-7 tumor cells (Fig. 4A
; data not shown), immunoactivities of an anti-VEGFR-1 antibody (Fig. 4B
, arrows) or an anti-NRP-1 antibody (data not shown), but not an anti-VEGFR-2 antibody (data not shown), were found in MCF-7 tumor cells in the various types of MCF-7 tumors. Because VEGF121 does not bind to NRP-1 (13)
, it is plausible that with or without E2-treatment, VEGF121 or VEGF165 could promote MCF-7 tumor growth by an autocrine mechanism through interaction with VEGFR-1.

View larger version (106K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. VEGFR-1 is expressed in MCF-7 breast cancer cells in vitro and in vivo. A, RT-PCR analysis on the expression of VEGFRs in human dermal ECs, MCF-7 cells, and human U87MG glioma cells with (+) or without (-) reverse transcriptase. The length of the PCR product of VEGF-1 or VEGFR-2 was 441 bp or 473 bp, respectively. The arrow indicates a weak VEGFR-2 cDNA fragment detected in MCF-7 cells. N, negative control. The experiments were done three times with identical results. B, expression of VEGFR-1 in various MCF-7 tumors. Panels ah, IHC analysis of various types of established MCF-7 tumors using a mouse monoclonal anti-VEGFR-1 antibody. Breast tumors formed by MCF-7 (a), Lac Z (b), V121 (c and e), and V165 (d and f) cells. Panels ad, tumors established in E2-treated mice. Panels e and f, tumors formed in non-E2-treated mice. Arrowheads indicate blood vessels that were positively stained by the anti-VEGFR-1 antibody. Arrows show tumor cells that expressed VEGFR-1. Six to 8 individual tumor samples of each group from each in vivo experiment were analyzed each time and the experiments were repeated at least two additional times with similar staining patterns. Original magnification: x400.
|
|
VEGF121- or VEGF165-promoted MCF-7 Cell Proliferation Was Potentiated by the Treatment of E2 and ECM Components.
To demonstrate whether VEGF stimulated MCF-7 cell growth through an autocrine pathway, we evaluated the proliferation of various types of MCF-7 cells by assessing the incorporation of BrdUrd into the DNA of these cells. As shown in Fig. 5A
, after 48-h of serum and E2 deprivation, quiescent MCF-7 or LacZ cells had comparable levels of DNA synthesis. The percentage of BrdUrd incorporation was defined as 100% for parental MCF-7 cells. In comparison to those of MCF-7 or LacZ cells, the rates of BrdUrd incorporation of the V121 or V165 cells increased significantly to 143% ± 3.1% and 157% ± 5.4%, respectively. This stimulation was most likely because of the stimulation by VEGF on V121 or V165 cells, because VEGF-enhanced cell proliferation was inhibited when a neutralizing anti-VEGF antibody (10 µg/ml) was included in the assays (Fig. 5A)
.

View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. E2 and VN potentiate MCF-7 cell proliferation stimulated by VEGF. A and B, cell proliferation assay of MCF-7, LacZ, V121, or V165 cells using a BrdUrd cell proliferation ELISA system. In some samples, a neutralizing anti-VEGF antibody was included. A, mitogenic activities of the various MCF-7 cells in noncoated 96-well plates. B, mitogenic activities of the various MCF-7 cells in 96-well plates coated with 400 ng/ml of VN. The increased proliferation was calculated as the percentage of that of parental MCF-7 cells. C, mitogenic activities of the parental MCF-7 cells that were stimulated with recombinant VEGF121 or VEGF165 (100 ng/ml each) in the absence or presence of 1.0 nM of E2 in noncoated 96-well plates. D, mitogenic activities of the parental MCF-7 cells that were stimulated with recombinant VEGF121 or VEGF165 (100 ng/ml each) in the absence or presence of 1 nM of E2 in 96-well plates coated with 400 ng/ml of VN. The increased proliferation was calculated as the percentage of that of parental MCF-7 cells. * denotes statistically significant (P < 0.002). The assays were performed three times using different cell clones of various cell passages with similar results. E, expression of VN in various types of established MCF-7 breast tumors. Breast tumors formed by MCF-7 (a), Lac Z (b), V121 (c and e), and V165 (d and f) cells. Panels ad, tumors established in E2-treated mice. Panels e and f, tumors formed in non-E2-treated mice. Arrows indicate tumor cells that were positively stained by the anti-VN antibody. Six to 8 tumor samples of each group of each in vivo experiment were analyzed, and the experiments were repeated at least two additional times with similar results. Original magnification: x400.
|
|
We have shown previously that VN, an ECM ligand that binds to integrins
vß3 or
vß5, potentiates VEGF121 or VEGF165-stimulated glioma angiogenesis in vivo and EC migration in vitro (16)
. To assess whether the ECM ligands, VN or FN, or ECM components (Matrigel) could potentiate VEGF-stimulated MCF-7 tumor cell proliferation under the condition of serum and E2 deprivation, we performed mitogenic analyses in the presence of VN (Fig. 5B)
, FN, or Matrigel (data not shown). No enhancements in cell proliferation of the MCF-7 or LacZ cells were seen when the cells were grown in VN (Fig. 5B)
, FN, or Matrigel (data not shown) coated plates, compared with noncoated controls. In contrast, treatment with VN (Fig. 5B)
, FN, or Matrigel (data not shown) on V121 or V165 cells greatly potentiated the mitogenic activities of these cells (increasing from 143% ± 3.1% to 175% ± 7.2% for V121 cells and from 157% ± 5.4% to 200% ± 6.8% for V165 cells as compared with that of control cells).
In our in vivo experiments, treatment of E2 strongly enhanced tumorigenicity of V121 or V165 cells in mice when compared with that in non-E2-treated mice (Fig. 2)
. To determine whether exogenous VEGF stimulates parental MCF-7 cell growth and whether E2 potentiates VEGF-promoted proliferation of parental MCF-7 cells in vitro, we assessed the effects of exogenous VEGF on parental MCF-7 cell proliferation in the presence or absence of E2. As shown in Fig. 5C
, treatment on the parental MCF-7 cells with 100 ng/ml of recombinant VEGF121 or VEGF165 proteins caused a moderate increase of BrdUrd incorporation of the treated MCF-7 cells as compared with untreated cells (128% ± 6.1% and 150% ±18.3%, respectively). Moreover, when the cells were treated with 1.0 nM of E2 (18)
in the absence of exogenous VEGF, an increase of 230% ± 13.8% in cell growth was observed in the parental MCF-7 cells. When both VEGF and E2 are present, additional increases of the BrdUrd incorporation were seen (Fig. 5C
; 269% ± 7.5% for the treatment of VEGF121 plus E2 or 275% ± 15.2% for the treatment of VEGF165 plus E2). The stimulation of cell proliferation in the presence or absence of E2 in these two sets of experiments was likely caused by the exogenous VEGF, because the neutralizing anti-VEGF antibody (10 µg/ml) inhibited the BrdUrd incorporation in both cases. Similar to the effects demonstrated in Fig. 5B
, treatment with VN (Fig. 5D)
, FN, or Matrigel (data not shown) on the parental MCF-7 cells that were stimulated by the exogenous VEGF proteins in the absence or presence of E2 additionally potentiated the enhancements of cell proliferation. In the absence of E2, the rates of cell growth were increased from 128% ± 6.1% to 150% ± 17.6% for VEGF121-treated cells and from 150% ±18.3% to 178% ± 10.1% for VEGF165-treated cells. In the presence of E2, the rates of BrdUrd incorporation were elevated from 269% ± 17.5% to 290% ± 21.6% for VEGF121-treated cells and from 275% ±15.2% to 305% ± 30.2% for VEGF165-treated cells. However, there were no differences between the rates of cell growth of the E2-stimulated MCF-7 cells in the absence (230% ± 13.8%) or presence (228% ± 14.2) of VN (Fig. 5D)
.
Finally, we determined whether VN or FN was expressed in the various types of MCF-7 tumors. High levels of expression of VN (Fig. 5E)
or FN (data not shown) were detected in all of the types of MCF-7 tumors that were established in either E2-treated or non-E2-treated mice. Taken together, these data suggest that in the absence of E2, VEGF stimulates mitogenesis of MCF-7 tumor cells by an autocrine mechanism, and ECM components promote VEGF-stimulated MCF-7 tumor cell proliferation. Furthermore, treatment on the parental MCF-7 cells with E2 additionally potentiates the VEGF-promoted cell proliferation, and ECM components also augment VEGF-stimulated cell growth under this condition.
 |
DISCUSSION
|
|---|
During the past 3 decades, several model systems have been established for studying the process whereby initially estrogen-dependent breast cancer cells acquire estrogen resistance or estrogen-independent growth. Overexpression of FGF-1 (15)
, FGF-4 (19)
, or c-Jun (20)
by MCF-7 cells enabled E2-independent MCF-7 tumor growth, and stimulated tumor invasion and metastases in ovariectomized mice. However, in vivo, estrogen treatments of mice had no effects on tumor growth (FGF-1 or c-Jun expressing MCF-7 cells; Refs. 15
, 20
) and suppressed tumor formation (FGF-4 expressing MCF-7 cells; Ref. 19
). On the other hand, E2-independent, but E2-responsive MCF-7 sublines were also isolated by selecting adriamycin-resistant cell clones (21)
or from established MCF-7 tumors in ovariectomized mice (3)
. Although these two MCF-7 cell sublines formed E2-independent breast tumors in mice, little was known about the mechanisms that conferred E2 independence in these two model systems. In the present study, we examined the consequences of overexpression of VEGF by MCF-7 tumors in ovariectomized nude mice with or without E2 treatment. Expression of VEGF121 or VEGF165 by MCF-7 cells rendered E2-independent tumor formation. The growth rates of V121 or V165 tumors were similar to those of tumors derived from estrogen-independent MCF-7 sublines (3)
or of the parental, estrogen-dependent MCF-7 tumors in E2-treated mice (Fig. 2
; Table 1
). The V121 and V165 tumors remained responsive to estrogen stimulation in vivo, which was also consistent with the response of breast tumors derived from the estrogen-independent MCF-7 sublines (3)
. In addition, VEGF stimulation (either by overexpression of VEGF in MCF-7 tumor cells or by treatments on parental MCF-7 cells with exogenous VEGF proteins) increased mitogenesis of MCF-7 cells in vitro. The enhancements of MCF-7 cell proliferation by VEGF were additionally potentiated by E2 as well as by ECM components. Thus, the estrogen-independent but estrogen-responsive phenotype may exemplify a natural progression of development of estrogen-independent growth in breast cancers.
VEGF is a major angiogenic factor in breast tumor progression. This factor is expressed at high levels in breast cancer specimens compared with normal breast tissue, and suppression of VEGF function inhibits breast tumor formation (22)
. Our results show that expression of VEGF isoforms, VEGF121 or VEGF165, by MCF-7 cells at high levels stimulated both E2-independent and E2-dependent breast tumor growth in mice. Moreover, we also obtained several V121 or V165 cell clones that secreted VEGF at lower levels. These low VEGF-expressing cell clones did not show enhancement of tumor growth in E2-treated mice nor formed tumors in non-E2-treated mice (data not shown). This observation is in agreement with two separate studies reported previously (23
, 24)
. With lower expression levels of the VEGF isoforms by MCF-7 cells, moderate augmentation on E2-dependent breast tumor growth in ovariectomized mice was seen (23)
. In another study, although MCF-7 VEGF165-expressing tumors responded vigorously to estrogen stimulation in promoting tumorigenesis, the V165 cells could only form E2-independent tumors in ovariectomized mice when implanted with Matrigel (24)
. Thus, threshold levels of VEGF expression in breast cancer cells may be critical for the acquisition of the estrogen-independent phenotype in human breast cancers. This hypothesis is clinically relevant because high levels of VEGF proteins could be detected in primary breast cancer specimens, especially in hypoxic region (22)
.
It has been established that estrogen stimulates the expression of VEGF in breast cancers. In vivo, E2 treatment augments VEGF expression in E2-induced rat mammary cancer (25)
. In vitro, E2 directly regulates VEGF transcription by acting on the estrogen-responsive elements in the VEGF gene in breast cancer cells (6, 7, 8)
. On the other hand, E2 and VEGF appear to regulate several common genes that are critical for breast cancer progression. Both E2 and VEGF up-regulate the expression of cyclin D1, nuclear factor
B, and Bcl-2 in breast cancer cells (E2) and ECs (VEGF; Refs. 26, 27, 28, 29, 30, 31
). Furthermore, earlier studies have shown that factors induced by E2 in E2-dependent MCF-7 cells could partially replace E2 to promote breast tumor growth (32)
. Our data corroborate these observations. Both in vivo and in vitro, VEGF promoted E2-independent MCF-7 tumor cell growth, and treatment of E2 additionally potentiated the VEGF-stimulated MCF-7 cell proliferation. The enhancement of MCF-7 cell growth by E2 was at least partially through the up-regulation of VEGF. We observed that E2 slightly increased VEGF secretion from the MCF-7 cells (data not shown; Ref. 8
), and the neutralizing anti-VEGF antibody partially inhibited E2-stimulated cell proliferation in the absence of exogenous VEGF (Fig. 5, C and D)
. The effects on the VEGF-stimulated MCF-7 tumor cell growth potentiated by E2 in vitro was not as strong as that in mice probably because in vivo, in addition to stimulation of MCF-7 tumor cells, VEGF expressed at high levels strongly promoted vessel growth in tumors. Increased neovascularization (Fig. 3)
in VEGF expressing MCF-7 tumors additionally stimulated E2-promoted tumor growth. Together, our results demonstrate that during the progression of E2-dependent breast cancers, up-regulation or constitutive expression of growth factors, such as VEGF, could result in the acquisition of an E2-independent phenotype. However, because VEGF only regulates a subset of tumor-promoting genes, similar to E2, up-regulation of VEGF alone without E2 treatment is not strong enough to completely replace the stimulatory effects of E2 in combination with VEGF on tumorigenicity of MCF-7 breast tumors in vivo and on MCF-7 cell proliferation in vitro.
In addition to stimulating breast tumor angiogenesis by a paracrine mechanism, VEGF also promotes breast cancer cell growth, survival, and invasion by an autocrine pathway. Studies have shown that a VEGF165 receptor, NRP-1, mediates both VEGF-stimulated survival and invasion for E2-independent breast cancer cells (10, 11, 12)
. In E2-dependent T47D breast cancer cells, VEGFR-1 and VEGFR-2 are responsible for VEGF-stimulated mitogenic and migratory responses (10)
. In our studies, MCF-7 cells express VEGFR-1 and NRP-1 at high levels, both in vitro and in vivo, whereas the expression of VEGFR-2 was only detected in tumor ECs, but not in the carcinoma cells of the MCF-7 tumors. Because both VEGF121 and VEGF165 stimulated E2-dependent and E2-independent MCF-7 breast tumor growth, and VEGF121 does not bind to NRP-1 (13)
, we propose that augmentation of E2-dependent MCF-7 tumor growth and acquisition of E2-independence are likely to be mediated by VEGFR-1, at least in V121 tumors.
In summary, we have shown that overexpression of VEGF by human MCF-7 breast cancers not only enhances E2-dependent tumor growth, but also enables E2-independent tumor formation in vivo. The stimulation by VEGF of MCF-7 tumor growth is through both a paracrine effect on tumor angiogenesis and an autocrine effect on tumor cell proliferation. Our data suggest that if VEGF is expressed at high levels in breast cancer cells, it could partially replace E2 stimulation of breast cancer growth. Our results of VEGF-stimulated E2-dependent or E2-independent breast cancer growth provide an excellent system to investigate the mechanisms of acquisition of estrogen-independent growth by estrogen-dependent breast cancers. Our findings also indicate the need for targeting the VEGF/VEGFR pathway and other signaling pathways as well as estrogen-ablation in the treatment of human breast cancers.
 |
ACKNOWLEDGMENTS
|
|---|
This work was initiated in the laboratory of Dr. Webster K. Cavenee at Ludwig Institute for Cancer Research and University of California, San Diego. We thank Dr. Webster K. Cavenee for continuous support. We also thank Michael Jarzynka, Frank Cackowski, and Sammy Grimaldo for reading this manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by grants from Department of Defense, DAMD17-01-1-0375 and DAMD-17-02-1-0584; a developmental fund of University of Pittsburgh Cancer Institute (to S-Y. C.); and NIH Grant CA52586 and Department of Defense, DAMD17-00-1-0420 (to B. M. F.). 
2 To whom requests for reprints should be addressed, at University of Pittsburgh Cancer Institute and Department of Pathology (to S-Y. C.) or Medicine (to B. H.), Research Pavilion at Hillman Cancer Center, Suite 2.26, 5117 Centre Avenue, Pittsburgh, PA 15213-1863. Phone: (412) 623-3261; Fax: (412) 623-4840; E-mail: chengs{at}msx.upmc.edu (to S-Y. C.) or hub{at}msx.upmc.edu (to B. H.). 
3 The abbreviations used are: VEGF, vascular endothelial growth factor; VEGFR, vascular endothelial growth factor receptor; NRP, neuropilin; FGF, fibroblast growth factor; ECM, extracellular matrix; EC, endothelial cell; CM, conditioned medium; IHC, immunohistochemistry; RT-PCR, reverse transcription-PCR; E2, 17 ß-estradiol; VN, vitronectin; FN, fibronectin; FBS, fetal bovine serum; BrdUrd, bromodeoxyuridine. 
Received 1/15/03.
Accepted 5/19/03.
 |
REFERENCES
|
|---|
- Dickson R. B., Johnson M. D., el-Ashry D., Shi Y. E., Bano M., Zugmaier G., Ziff B., Lippman M. E., Chrysogelos S. Breast cancer: influence of endocrine hormones, growth factors and genetic alterations. Adv. Exp. Med. Biol., 330: 119-141, 1993.[Medline]
- Clarke R., Thompson E. W., Leonessa F., Lippman J., McGarvey M., Frandsen T. L., Brunner N. Hormone resistance, invasiveness, and metastatic potential in breast cancer. Breast Cancer Res. Treat., 24: 227-239, 1993.[Medline]
- Brunner N., Boulay V., Fojo A., Freter C. E., Lippman M. E., Clarke R. Acquisition of hormone-independent growth in MCF-7 cells is accompanied by increased expression of estrogen-regulated genes but without detectable DNA amplifications. Cancer Res., 53: 283-290, 1993.[Abstract/Free Full Text]
- Hyder S. M., Stancel G. M. Regulation of angiogenic growth factors in the female reproductive tract by estrogens and progestins. Mol. Endocrinol., 13: 806-811, 1999.[Free Full Text]
- Losordo D. W., Isner J. M. Estrogen and angiogenesis: a review. Arterioscler. Thromb. Vasc. Biol., 21: 6-12, 2001.[Abstract/Free Full Text]
- Hyder S. M., Nawaz Z., Chiappetta C., Stancel G. M. Identification of functional estrogen response elements in the gene coding for the potent angiogenic factor vascular endothelial growth factor. Cancer Res., 60: 3183-3190, 2000.[Abstract/Free Full Text]
- Mueller M. D., Vigne J. L., Minchenko A., Lebovic D. I., Leitman D. C., Taylor R. N. Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors
and ß. Proc. Natl. Acad. Sci. USA, 97: 10972-7, 2000.[Abstract/Free Full Text]
- Buteau-Lozano H., Ancelin M., Lardeux B., Milanini J., Perrot-Applanat M. Transcriptional regulation of vascular endothelial growth factor by estradiol and tamoxifen in breast cancer cells: a complex interplay between estrogen receptors
and ß. Cancer Res., 62: 4977-4984, 2002.[Abstract/Free Full Text]
- Ferrara N. Vascular endothelial growth factor: molecular and biological aspects. Curr. Top. Microbiol. Immunol., 237: 1-30, 1999.[Medline]
- Miralem T., Steinberg R., Price D., Avraham H. VEGF(165) requires extracellular matrix components to induce mitogenic effects and migratory response in breast cancer cells. Oncogene, 20: 5511-5524, 2001.[Medline]
- Bachelder R. E., Crago A., Chung J., Wendt M. A., Shaw L. M., Robinson G., Mercurio A. M. Vascular endothelial growth factor is an autocrine survival factor for neuropilin-expressing breast carcinoma cells. Cancer Res., 61: 5736-5740, 2001.[Abstract/Free Full Text]
- Bachelder R. E., Wendt M. A., Mercurio A. M. Vascular endothelial growth factor promotes breast carcinoma invasion in an autocrine manner by regulating the chemokine receptor CXCR4. Cancer Res., 62: 7203-7206, 2002.[Abstract/Free Full Text]
- Soker S., Takashima S., Miao H. Q., Neufeld G., Klagsbrun M. Neuropilin-1 is expressed by endothelial and tumor cells as an isoform- specific receptor for vascular endothelial growth factor. Cell, 92: 735-745, 1998.[Medline]
- Cheng S-Y., Nagane M., Su Huang H-J., Cavenee W. K. Intracerebral tumor-associated hemorrhage caused by overexpression of vascular endothelial growth factor (VEGF) isoforms, VEGF121 and VEGF 165 but not VEGF189. Proc. Natl. Acad. Sci. USA, 94: 12081-12087, 1997.[Abstract/Free Full Text]
- Zhang L., Kharbanda S., Chen D., Bullocks J., Miller D. L., Ding I. Y., Hanfelt J., McLeskey S. W., Kern F. G. MCF-7 breast carcinoma cells overexpressing FGF-1 form vascularized, metastatic tumors in ovariectomized or tamoxifen-treated nude mice. Oncogene, 15: 2093-108, 1997.[Medline]
- Guo P., Xu L., Pan S., Brekken R. A., Yang S. T., Whitaker G. B., Nagane M., Thorpe P. E., Rosenbaum J. S., Su Huang H. J., Cavenee W. K., Cheng S. Y. Vascular endothelial growth factor isoforms display distinct activities in promoting tumor angiogenesis at different anatomic sites. Cancer Res., 61: 8569-8577, 2001.[Abstract/Free Full Text]
- Guo P., Hu B., Gu W., Xu L., Wang D., Huang H. J., Cavenee W. K., Cheng S. Y. Platelet-derived growth factor-B enhances glioma angiogenesis by stimulating vascular endothelial growth factor expression in tumor endothelia and by promoting pericyte recruitment. Am. J. Pathol., 162: 1083-1093, 2003.[Abstract/Free Full Text]
- Katzenellenbogen B. S., Kendra K. L., Norman M. J., Berthois Y. Proliferation, hormonal responsiveness, and estrogen receptor content of MCF-7 human breast cancer cells grown in the short-term and long-term absence of estrogens. Cancer Res., 47: 4355-4360, 1987.[Abstract/Free Full Text]
- McLeskey S. W., Kurebayashi J., Honig S. F., Zwiebel J., Lippman M. E., Dickson R. B., Kern F. G. Fibroblast growth factor 4 transfection of MCF-7 cells produces cell lines that are tumorigenic and metastatic in ovariectomized or tamoxifen-treated athymic nude mice. Cancer Res., 53: 2168-2177, 1993.[Abstract/Free Full Text]
- Smith L. M., Wise S. C., Hendricks D. T., Sabichi A. L., Bos T., Reddy P., Brown P. H., Birrer M. J. cJun overexpression in MCF-7 breast cancer cells produces a tumorigenic, invasive and hormone resistant phenotype. Oncogene, 18: 6063-6070, 1999.[Medline]
- Vickers P. J., Dickson R. B., Shoemaker R., Cowan K. H. A multidrug-resistant MCF-7 human breast cancer cell line which exhibits cross-resistance to antiestrogens and hormone-independent tumor growth in vivo. Mol. Endocrinol., 2: 886-892, 1988.[Abstract/Free Full Text]
- Sledge G. W., Jr. Vascular endothelial growth factor in breast cancer: biologic and therapeutic aspects. Semin. Oncol., 29: 104-110, 2002.[Medline]
- Zhang H. T., Scott P. A., Morbidelli L., Peak S., Moore J., Turley H., Harris A. L., Ziche M., Bicknell R. The 121 amino acid isoform of vascular endothelial growth factor is more strongly tumorigenic than other splice variants in vivo. Br. J. Cancer, 83: 63-68, 2000.[Medline]
- McLeskey S. W., Tobias C. A., Vezza P. R., Filie A. C., Kern F. G., Hanfelt J. Tumor growth of FGF or VEGF transfected MCF-7 breast carcinoma cells correlates with density of specific microvessels independent of the transfected angiogenic factor. Am. J. Pathol., 153: 1993-2006, 1998.[Abstract/Free Full Text]
- Xie B., Tam N. N., Tsao S. W., Wong Y. C. Co-expression of vascular endothelial growth factor (VEGF) and its receptors (flk-1 and flt-1) in hormone-induced mammary cancer in the Noble rat. Br. J. Cancer, 81: 1335-1343, 1999.[Medline]
- Pedram A., Razandi M., Levin E. R. Extracellular signal-regulated protein kinase/Jun kinase cross-talk underlies vascular endothelial cell growth factor-induced endothelial cell proliferation. J. Biol. Chem., 273: 26722-26728, 1998.[Abstract/Free Full Text]
- Kim I., Moon S. O., Kim S. H., Kim H. J., Koh Y. S., Koh G. Y. Vascular endothelial growth factor expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and E- selectin through nuclear factor-
B activation in endothelial cells. J. Biol. Chem., 276: 7614-7620, 2001.[Abstract/Free Full Text]
- Gerber H. P., Dixit V., Ferrara N. Vascular endothelial growth factor induces expression of the antiapoptotic proteins Bcl-2 and A1 in vascular endothelial cells. J. Biol. Chem., 273: 13313-13316, 1998.[Abstract/Free Full Text]
- Prall O. W., Sarcevic B., Musgrove E. A., Watts C. K., Sutherland R. L. Estrogen-induced activation of Cdk4 and Cdk2 during G1-S phase progression is accompanied by increased cyclin D1 expression and decreased cyclin-dependent kinase inhibitor association with cyclin E- Cdk2. J. Biol. Chem., 272: 10882-10894, 1997.[Abstract/Free Full Text]
- Nakshatri H., Bhat-Nakshatri P., Martin D. A., Goulet R. J., Jr., Sledge G. W., Jr. Constitutive activation of NF-
B during progression of breast cancer to hormone-independent growth. Mol. Cell. Biol., 17: 3629-3639, 1997.[Abstract]
- Dong L., Wang W., Wang F., Stoner M., Reed J. C., Harigai M., Samudio I., Kladde M. P., Vyhlidal C., Safe S. Mechanisms of transcriptional activation of bcl-2 gene expression by 17ß-estradiol in breast cancer cells. J. Biol. Chem., 274: 32099-32107, 1999.[Abstract/Free Full Text]
- Dickson R. B., McManaway M. E., Lippman M. E. Estrogen-induced factors of breast cancer cells partially replace estrogen to promote tumor growth. Science (Wash. DC), 232: 1540-1543, 1986.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
H. Gong, M. J. Jarzynka, T. J. Cole, J. H. Lee, T. Wada, B. Zhang, J. Gao, W.-C. Song, D. B. DeFranco, S.-Y. Cheng, et al.
Glucocorticoids Antagonize Estrogens by Glucocorticoid Receptor-Mediated Activation of Estrogen Sulfotransferase
Cancer Res.,
September 15, 2008;
68(18):
7386 - 7393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Qu, S. Van Ginkel, A. M. Roy, L. Westbrook, M. Nasrin, Y. Maxuitenko, A. R. Frost, D. Carey, W. Wang, R. Li, et al.
Vascular Endothelial Growth Factor Reduces Tamoxifen Efficacy and Promotes Metastatic Colonization and Desmoplasia in Breast Tumors
Cancer Res.,
August 1, 2008;
68(15):
6232 - 6240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Gong, P. Guo, Y. Zhai, J. Zhou, H. Uppal, M. J. Jarzynka, W.-C. Song, S.-Y. Cheng, and W. Xie
Estrogen Deprivation and Inhibition of Breast Cancer Growth in Vivo through Activation of the Orphan Nuclear Receptor Liver X Receptor
Mol. Endocrinol.,
August 1, 2007;
21(8):
1781 - 1790.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Imanishi, B. Hu, M. J. Jarzynka, P. Guo, E. Elishaev, I. Bar-Joseph, and S.-Y. Cheng
Angiopoietin-2 Stimulates Breast Cancer Metastasis through the {alpha}5{beta}1 Integrin-Mediated Pathway
Cancer Res.,
May 1, 2007;
67(9):
4254 - 4263.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Banka, C. V. Lund, M. T.N. Nguyen, A. J. Pakchoian, B. M. Mueller, and B. P. Eliceiri
Estrogen Induces Lung Metastasis through a Host Compartment-Specific Response.
Cancer Res.,
April 1, 2006;
66(7):
3667 - 3672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Hicklin and L. M. Ellis
Role of the Vascular Endothelial Growth Factor Pathway in Tumor Growth and Angiogenesis
J. Clin. Oncol.,
February 10, 2005;
23(5):
1011 - 1027.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Tangkeangsirisin and G. Serrero
PC cell-derived growth factor (PCDGF/GP88, progranulin) stimulates migration, invasiveness and VEGF expression in breast cancer cells
Carcinogenesis,
September 1, 2004;
25(9):
1587 - 1592.
[Abstract]
[Full Text]
[PDF]
|
 |
|