Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium  Joint Metastasis Research Society-AACR Conference on Metastasis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riley, R. R.
Right arrow Articles by Arbeit, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riley, R. R.
Right arrow Articles by Arbeit, J. M.
[Cancer Research 63, 4862-4871, August 15, 2003]
© 2003 American Association for Cancer Research


Regular Articles

Dissection of Human Papillomavirus E6 and E7 Function in Transgenic Mouse Models of Cervical Carcinogenesis1

Rebeccah R. Riley, Stefan Duensing, Tiffany Brake, Karl Münger, Paul F. Lambert and Jeffrey M. Arbeit2

University of California San Francisco Comprehensive Cancer Center and Department of Surgery, University of California, San Francisco 94143-0808 [R. R. R., J. M. A.]; Department of Pathology, Harvard Medical School, Boston, Massachusetts 02115 [S. D., K. M.]; and McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, Wisconsin 53706 [T. B., P. F. L.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human cervix cancer is caused by high-risk human papillomaviruses encoding E6 and E7 oncoproteins, each of which alter function of distinct targets regulating the cell cycle, apoptosis, and differentiation. Here we determined the molecular contribution of E6 or E7 to neoplastic progression and malignant growth in a transgenic mouse model of cervical carcinogenesis. E7 increased proliferation and centrosome copy number, and produced progression to multifocal microinvasive cervical cancers. E6 elevated centrosome copy number and eliminated detectable p53 protein, but did not produce neoplasia or cancer. E6 plus E7 additionally elevated centrosome copy number and created large, extensively invasive cancers. Centrosome copy number increases and p53 loss likely contributed to malignant growth; however, dysregulated proliferation and differentiation were required for carcinogenic progression.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cervical cancer, a worldwide health problem, has been directly linked to genital infection by HPV,3 and HPV DNA and viral gene expression has been detected in nearly all cervical malignancies (1 , 2) . HPVs are mucosal-trophic viruses infecting basal squamous epithelial cells, with the productive phase of the viral life cycle elaborated in the upper squamous epithelial cell layers. Most HPV infections are transient, but in the minority of patients persistent viral disease localizes in basal squamous cervical epithelial cells of the cervix, and underlies neoplastic progression and emergence of invasive malignancies (3) .

There are >100 types of HPVs, but only a subset of "high-risk" viral types induce cervical carcinogenesis. HPVs contain two genes in their early region, E6and E7, and high-risk viral types encode E6 and E7 oncoproteins with an enhanced affinity for host cellular targets (1 , 4) . Whereas transcriptional activity has been associated with both E6 and E7, as these oncoproteins are not DNA binding transcription factors, the major thrust of investigation has centered on protein-protein interactions with cellular targets (5, 6, 7) . In many instances, association of the cellular target with a HPV oncoprotein leads to target protein destabilization and ultimate destruction (8, 9, 10) . In other instances, viral oncoprotein binding may activate the host cellular protein (11) . Several studies support a functional role for the E6and E7oncogenes in tumorigenesis. Both oncogenes are expressed consistently in cervical cancer tissues obtained from patients (2) . Cell transfection of high-risk HPV16 or 18 E6and E7oncogenes transforms established cell lines and immortalizes primary cells (12, 13, 14, 15) . Ubiquitous or targeted expression of E6 and E7 has been shown to produce benign tumors or cancers in transgenic mice (16, 17, 18, 19, 20, 21) . The potential importance of E6 and E7 function in cervical carcinogenesis has also spawned vaccine development targeting viral oncoprotein epitopes (22, 23, 24, 25) . These vaccine efforts are a parallel approach to prophylaxis based on immunization against viral capsid antigens (26) . Rational drug design is also being applied to target the enzymatic functions of E6 or more recently E7 (27, 28, 29) . Thus, the importance of HPV oncogenes for viral infection, carcinogenesis, and potential therapy mandates a complete understanding of their molecular, cellular, and tissue biology in cervical epithelial cells.

However, despite insights into viral oncogene function, the discrete biology of the individual E6 and E7 oncoproteins in cervical epithelial cells is unclear. Therefore, we combined our expertise in the induction of cervix cancer in HPV transgenic mice by chronic estrogen administration (30 , 31) with transgenic mice engineered to express either HPV E6 or E7 oncoprotein individually (32) , to determine the discrete effects of each HPV oncogene in cervical carcinogenesis. Surprisingly, E7 alone was sufficient to produce both high-grade cervical dysplasia and invasive cervical malignancies. In mice engineered for expression of E6 oncoprotein alone, only low-grade cervical dysplasia was evident without additional neoplastic progression within the 6-month treatment interval of the study. Coexpression of E6 and E7 in double-transgenic mice revealed that E6 modulated the malignant phenotype produced by E7, in that cervical cancers were larger and more extensive. As such, this study demonstrates the potent cocarcinogenic activity of the HPV16 E7 oncoprotein with estrogen in the mouse cervix. HPV16 E6 appears to have predominant efficacy as a modulator of E7 estrogen cervical cocarcinogenesis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transgenic Mice.
The K14-HPV16 (19) , K14-E7 (32) , and K14-E6 (33) transgenic mice have been described previously. K14-HPV16 have been backcrossed in the FVB/n background for 40 generations, maintained, and used as heterozygotes in these experiments. Mice expressing either E7 or E6 oncogenes were transgenic with constructs containing only the overlapping HPV16 E6 and E7 ORFs spanning nucleotides 79–883. K14-E6ttl/E7 (designated as K14-E7) transgenic mice have a ttl in the E6 gene precluding E6 expression (32) . K14-E7 transgenic mice were maintained and used as transgenic heterozygotes. K14-E6/E7ttl (designated as K14-E6) transgenic mice contain a ttl in the E7 region and were used as transgenic homozygotes (33) . K14-E7 and K14-E6 transgenic mice were created and maintained in the FVB/n inbred strain. K14-E6:E7 mice were derived by intercrossing heterozygous K14-E7 with homozygous K14-E6 mice generating double-transgenic K14-E6:E7 heterozygous progeny. All of the mice were housed in a pathogen-free barrier facility, and all of the experiments and procedures were approved by the University of California San Francisco Committee on Animal Research.

Hormone Treatment.
One-month virgin female transgenic and nontransgenic mice were anesthetized with halothane, s.c. implanted in the dorsal skin with continuous release pellets delivering 0.05 mg 17ß-estradiol over 60 days (Innovative Research of America, Sarasota, FL). Mice were treated with hormone for 1, 3, or 6 months; the longer treatment times required an additional insertion of one or two pellets (31) . Groups of 4–7 transgenic and nontransgenic mice were treated for 1 and 3 months. Larger groups comprising 20 (K14-E6, K14-E7, K14-E6:E7, and nontransgenic) or 40 (K14-HPV16) transgenic mice were treated with 17ß-estradiol for 6 months. Data from the K14-HPV16 transgenic mice were pooled from two concurrent studies.

Tissue Procurement, Histopathological Analysis, and Determination of Cancer Size.
Mice were anesthetized with 2.5% Avertin and perfused through the aorta with 3.75% paraformaldehyde. The entire reproductive tract including parametrial, retroperitoneal soft tissue and lymph nodes were dissected, placed in an embedding cassette (Fisher) with one sponge for compression, and postfixed in 3.75% paraformaldehyde overnight at 4°C. In-cassette postfixation produced a linear reproductive tract facilitating subsequent sectioning of the entire organ in one plane (Fig. 1)Citation . The posterior vaginal wall was removed leaving an intact rim of vulvar tissue, and a 3–5 mm end piece of plastic pipette tip was inserted into the vaginal opening to keep the vagina open during subsequent processing steps. Tissues were washed in 1x PBS, and dehydrated through graded alcohols and xylene using a Leica TP1050 vacuum tissue processor (Leica Microsystems, Inc., Bannockburn, IL). After pipette tip removal, the reproductive tract was embedded with the cut vaginal wall surface oriented downward. The entire reproductive tract was serially sectioned, and 10–15 sections were collected at 75 µm intervals for H&E staining and immunohistochemistry.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1. A composite H&E image of an entire K14-HPV transgenic reproductive tract treated with estrogen for 6 months. Division of the reproductive tract into anatomical regions that were comparatively analyzed for histopathology, DNA synthesis, and mRNA expression levels. Acquisition of a reproductive tract tissue section as displayed here requires special tissue processing techniques as detailed in "Materials and Methods." Precise tissue orientation and step sectioning facilitates identification, localization, and assessment of the degree of malignant stromal invasion in each transgenic animal. Here a squamous carcinoma is present at the transformation zone (see inset).

 
To determine cancer size, malignancies from reproductive tracts of transgenic mice treated with estrogen for 6 months were visually screened histologically and classified as "small" or "large." Each large cancer was then measured using the Axiovision 4.0 software package on images acquired from a Zeiss Axioplan 2 imaging microscope with an AxioCam color-masked CCD sensor. Images were acquired at 14-bitdepth and the programmable 1300 x 1030 pixel resolution for each color channel. Pixel conversion to microns was done by calibrating each objective with a stage micrometer. Each large cancer measured >2000 µm2.

HPV16 E6/E7 mRNA Transgene Expression.
Transgenic (n = 6 for each genotype; K14-HPV16, K14-E7, and K14-E6 transgenic mice) and nontransgenic (n = 4) mice were treated with 17ß-estradiol for 1 month. After sacrifice by cervical dislocation and thoracotomy, the uterus, cervix, and vagina were rapidly removed. The uterine horns were separated and discarded from the cervix, vagina, and vulva, which were maintained as an intact tissue block (see cervico-vaginal region, Fig. 1Citation ). This distal reproductive tract block was snap frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted after a 90-s homogenization in TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. DNA was removed using AMBION DNA free kit (Ambion, Austin, TX). RNA samples were quantified by UV spectroscopy, and 500 ng of total RNA was used for reverse transcription, as described previously (16) . After inactivation of reverse transcriptase by heating at 95°C for 5 min, transgene E6/E7 expression was determined by real-time TaqMan RT-PCR (34 , 35) using PCR primers 5' and 3' to the E6* splice site and a TaqMan probe specific for the 3' splice acceptor side of the E6* splice site. This primer and TaqMan probe set detected both full-length E6 and E6* mRNA. Primer and TaqMan probe sequences were: E6 forward, (5') GCACAGAGCTGCAAACAACTATACA; E6 reverse, (5') GCTTTTTGTCCAGATGTCTTTGCT; TaqMan probe, 6-carboxyfluorescein-TGCGACGTGAGGTGTATTAACTGTCAAAAGC-6-carboxy-tetramethyl-rhodamine-3' (Integrated DNA Technologies, Coralville, IA). PCR was conducted in triplicate, on an ABI PRISM 7700 instrument (Applied Biosystems, Foster City, CA), in 50-µl reaction volumes containing: 1x PCR buffer, 5.5 mM MgCl2, 0.9 µM of each primer, 200 µM dNTPs, 200 nM of probe, and 0.025 units/µl Taq Gold (Applied Biosystems). PCR cycling conditions consisted of 95°C for 15 min, followed by 40 cycles of 95°C for 30 s and 60°C for 60 s. Using histone 3.3A as an endogenous control gene, relative expression levels for E6 ORF expression were calculated as 2-(Ct E6 –Ct histone 3.3A), as described previously (35) .

Determination of Reproductive Tract Proliferation Using BrdUrd Incorporation.
Labeling of S phase cells by BrdUrd was performed as described previously (19 , 36) . An intermediate magnification image of the entire cervical-lower uterine transformation zone (see box, Fig. 1Citation ) was captured, and all of the S phase epithelial cells within this region were counted. The entire squamous epithelium of the transformation zone, from the squamo-columnar junction to the opening of the cervical canal, but not including the canal, was counted on five to six adjacent x10 fields. Analysis for the number of BrdUrd-positive cells was conducted on 4–7 animals per genotype and time point.

p53 Immunohistochemistry.
Five µm paraffin-embedded sections were processed as described above and endogenous peroxidase activity quenched with 3% H2O2 in methanol for 30 min, followed by antigen retrieval (Retrievit pH 2; Biogenex, San Ramon, CA) in a 95°C water bath for 35 min. After room temperature equilibration, sections were washed in PBS and blocked at with 5% albumin:5% goat serum in PBS for 30 min. An avidin and biotin block was performed for 15 min each per the manufacturer’s instructions (Avidin/Biotin blocking kit; Vector Laboratories). The p53 antibody (CM 5 clone; Novacastra) was applied overnight at 4°C and diluted 1:2000 in 5% albumin:5% goat serum. After incubation with a biotinylated goat-antirabbit (1:200; Vector Laboratories) antibody for 45 min, antibody detection and visualization was performed by sequential applications of the Vector Elite ABC kit, and the chromagen 3,3 diaminobenzadine (Sigma). Sections were counterstained in Gills #1 Hematoxylin (Sigma).

Determination of Apoptosis.
For analysis of DNA fragmentation in the squamous epithelium of reproductive tracts, the Trevigen DermaTacs Apoptag kit (Trevigen, Gaithersburg, MD) was used, which incorporates BrdUrd into sites of double-strand DNA breakage. The experiments were performed according to the manufacturer’s instructions, except that reagent incubation times were extended, in addition to a less stringent blocking for endogenous peroxidase. Briefly, sections were digested with proteinase K (1:50) for 1 h at 37°C, followed by endogenous peroxidase quenching in 1% H2O2 in PBS for 5 min. After equilibration in 1x terminal deoxynucleotidyltransferase buffer, sections were incubated at ambient temperature for 1 h each with terminal deoxynucleotidyltransferase labeling mix and then the anti-BrdUrd antibody. Sections were subsequently incubated with peroxidase-conjugated streptavidin for 20 min, developed with Tacs blue label for 15 min, and counterstained for 10 min using Counterstain Red C (DermaTacs kit).

Determination of Centrosome Copy Number.
Formalin-fixed, paraffin-embedded 5-µm tissue sections were deparaffinized in xylene for 30 min, rehydrated in alcohols and water as described above, and boiled in 10 mM citrate buffer (pH 6.0) for 30 min in a microwave oven. After a room temperature dH2O wash, sections were treated with Digest-All 3 (Zymed) for 10 min at 37°C, blocked with 10% normal donkey serum in PBS for 15 min, and incubated overnight with a 1:50 dilution of a polyclonal rabbit antipericentrin antibody (BAbCO) at 4°C. Antibody detection was performed using a 1:1000 dilution of a rhodamine red-labeled donkey antirabbit antibody (Jackson Immunoresearch) for 2 h at 37°C. Sections were counterstained and mounted with 4',6-diamidino-2-phenylindole-Vectashield (Vector Laboratories). Cells were analyzed using a Leica DMLB Epifluorescence microscope equipped with a Sony DKC5000 digital camera system.

Image and Statistical Analysis.
Images were captured using a SPOT CCD camera (Diagnostics Instruments, Sterling Heights, MI) attached to a LEICA DMRXA microscope. Figures were composed using Adobe PhotoShop 6.0 (San Jose, CA). Numerical data are presented as the mean ± SD, and were analyzed statistically by ANOVA, two-tailed unpaired Student’s t test and {chi}2 analysis, where appropriate.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Estrogen Induction of Cervix Cancers According to Expression of Individual HPV ORFs.
To determine the discrete biology of the HPV16 E6 or E7 ORFs in mouse cervical carcinogenesis, K14-E7 and K14-E6 transgenic mice (see "Materials and Methods") were treated with our protocol for induction of squamous carcinomas of the cervix and vagina by chronic estrogen treatment (31) . Concurrent and sequential positive controls were K14-HPV16-transgenic mice containing the entire early region, and negative control, nontransgenic FVB/n littermates. The original studies of the p1427 and p1466 constructs, containing ttls in either the E6 or E7 ORFs, respectively, demonstrated that these mutations were both molecularly and biologically tight, and lacked expression of attenuated E6 or E7 functions (15) . Subsequent studies of transfected cells (37) and transgenic mice in which these expression of these constructs was targeted to lens epithelium (38) , or basal epidermal keratinocytes (32 , 33 , 39 , 40) , also validated the discrete E6 or E7 functions encoded by each of these constructs. Strikingly, 80% of the estrogen-treated K14-E7 transgenic mice developed reproductive tract carcinoma (Table 1)Citation . With the exception of one uterine adenocarcinoma, all of the reproductive tract cancers in the K14-E7-transgenic mice originated in squamous epithelium (see next paragraph). Similar to previous work, 83% of K14-HPV16-transgenic mice developed reproductive tract squamous cancer (Table 1Citation ; Refs. 30 , 31 ). In stark contrast, none of the K14-E6 or nontransgenic mice developed reproductive tract malignancies.


View this table:
[in this window]
[in a new window]
 
Table 1 Summary of histopathology and characteristics of cancer development in the cervico-vaginal epithelium of K1-HPV16, K14-E7, K14-E6:E7, and K14-E6 transgenic mice in response to 6 months of estrogen treatment

 
Despite a similar incidence, there were significant differences in reproductive tract location, quantity, size, and growth characteristics of malignancies arising in K14-E7 versus K14-HPV transgenic mice (Table 1)Citation . To determine a distinct biology for each HPV transgenic genotype, the complete reproductive tract from ovaries to vulva was harvested, embedded, cut, and stained in one tissue plane, and the entire organ was analytically divided into discrete anatomical regions (Fig. 1)Citation . Reproductive tract squamous carcinomas in K14-E7 transgenic mice were dispersed throughout the cervico-vaginal epithelium, with a biased incidence favoring localization in the lower reproductive tract squamous epithelium (vulva, vagina, and outer cervix) compared with the cervical-uterine transformation zone at the junction of the upper cervix and lower uterus (Table 1Citation ; Fig. 1Citation ). In contrast, reproductive tract malignancy in K14-HPV16-transgenic mice was more frequently detected at the cervical transformation zone (Table 1)Citation . The number of mice with multiple cancers and the mean number of reproductive tract cancers per mouse were greater in K14-E7 compared with K14-HPV16-transgenic mice (Table 1)Citation . However, cervical cancer size was significantly less in the K14-E7 compared with either K14-HPV16 or K14-E6:E7 transgenic counterparts (Table 1)Citation .

Development of a Histopathological Grading System for Transgenic Mouse Cervical Squamous Carcinogenesis.
The marked discrepancy in the extent of carcinogenic progression in estrogen-treated K14-E7 versus K14-E6-transgenic mice motivated us to determine differences in histological progression according to genotype. Therefore, we developed a system to determine the degree of dysplastic or carcinogenic progression in the mouse cervix, initially using estrogen-treated K14-HPV16 transgenic mice in which histopathological progression to cervical malignancy was first demonstrated (Refs. 30 , 31 ; Fig. 2Citation ). This grading system was based on the established criteria for classification of human cervical neoplasia or malignancy accounting for differences between the mouse model and patients. One major difference was that high-grade dysplastic mouse cervical epithelium always retained multiple suprabasal cell layers with largely intact terminal differentiation. In contrast, high-grade dysplasia or CIS in the human consisted of replacement of the entire extent of squamous epithelium by immature basal-type squamous cells, each of which are almost entirely composed of enlarged, anaplastic nuclei with scant cytoplasm (41) . As such, the grade of neoplastic progression in mouse squamous epithelium was determined by the increase in nuclear:cytoplasmic ratio in individual squamous epithelial cells, the frequency of such cells within the squamous epithelium, and the morphology of the interface between squamous epithelium and the underlying vaginal or cervical stroma.



View larger version (182K):
[in this window]
[in a new window]
 
Fig. 2. Histopathology of the CIN scoring system based on the K14-HPV mouse. The murine CIN grading system depicting degree of reproductive tract squamous epithelial dysplasia and neoplastic progression in estrogen treated K14-HPV transgenic mice (panels 2–6) and nontransgenic controls (panel 1). The squamous epithelium in nontransgenic mice is hyperplastic and mitotic figures are present only in basal cells (black arrow, panel 1). CIN I lesions (panel 2) evidence occasional anaplastic squamous epithelial cells that are persistent in the upper differentiated layers (white arrowhead). CIN II lesions (panel 3) display epithelial cell projections into the stroma (papillation, black arrows), and cells with an additional degree of nuclear anaplasia (white arrowheads). CIN III lesions (panel 4) are similar to CIN II except the frequency of anaplastic squamous epithelial cells is increased. CIS lesions (panel 5) are distinguished by additional cytological squamous epithelial cell progression and more irregularity of the epithelial-stromal border. Squamous cell carcinoma (SCC; panel 6) retain a well to moderate degree of squamous epithelial differentiation and invade into the stroma without evidence of encirclement by basement membrane (black arrows). SCCs often arise from glandular squamous metaplasia at the transformation zone (black arrowhead). Bar, panels 1–5 = 20 µm; panel 6 = 100 µm.

 
Using this mouse cervical neoplasia grading system, CIN-I consisted of a 2-fold increase in the basal/basaloid cell layers of cervical and vaginal squamous epithelia of transgenic compared with estrogen-treated nontransgenic mice (Fig. 2Citation , compare panels 1 and 2). Interspersed in the basal and immediate suprabasal cell layers were individual cells with an increased nuclear:cytoplasmic ratio and nuclear atypia (Fig. 2Citation , black arrowhead). CIN II lesions contained cells with additional increases in nuclear size, degree of anaplasia, frequency, and distribution of dysplastic cells in the suprabasal layers of the squamous epithelium (Fig. 2Citation , panel 3). Moreover, the basal aspect of the squamous epithelium was thrown into papillary folds projecting into the underlying vaginal or cervical stroma (Fig. 2Citation , panel 3). CIN III lesions contained abundant anaplastic cells, some with pronounced increases in nuclear size (Fig. 2Citation , panel 4). CIS demonstrated a pronounced degree of remodeling and undulation of the epithelial-stromal border (Fig. 2Citation , panel 5), and most of the cellular features of well-differentiated squamous carcinoma, with retention of an intact basement membrane without evidence of microinvasion on serial sections. Invasive, well-differentiated squamous cancers consisted of invading nests of cancer cells arranged in part in keratin pearls (Ref. 42 ; Fig. 2Citation , panel 6). In contrast with transgenic mice, continuous estrogen treatment for 6 months in nontransgenic mice produced squamous epithelial hyperplasia similar to persistent estrus, with an increase in the number of squamous epithelial cell layers, occasional basal cell mitotic figures, and preservation of differentiated suprabasal keratinocytes (Fig. 2Citation , panel 1).

Distribution of Severity of Histopathological Lesions According to Expressed HPV ORF.
To additionally elucidate differences in the biology of E6 and E7 functions in the estrogen-treated cervix, we applied our CIN grading system to determine the extent of neoplastic progression in transgenic mice expressing the E6 or E7 oncoproteins individually and in combination (Fig. 3)Citation . Invasive cancer or high-grade dysplastic lesions (CIN III and CIS) occurred in 100% of K14-E7, K14-E6:E7, and K14-HPV16 transgenic mice, whereas dysplastic lesions in K14-E6 transgenic mice did not progress beyond CIN II (Fig. 3A)Citation . Histologically, CIN III and CIS lesions in K14-E7 (Fig. 3Citation , panel 3) and K14-E6:E7 (Fig. 3Citation , panel 4) transgenic mice were similar to those observed in K14-HPV16 mice, except that the degree of nuclear anaplasia and increase in nuclear:cytoplasmic ratio was greater in transgenic mice expressing the entire early region (see Fig. 2Citation , panels 4 and 5). In K14-E6 transgenic mice, the cervical and vaginal squamous epithelium was thicker compared with nontransgenic control mice, with occasional dysplastic cells with increased nuclear size and anaplasia (see arrow Fig. 3Citation B, panel 2). The epithelial-stromal border of K14-E6 transgenic mice was more undulating compared with the linear border in nontransgenic controls; however, the marked papillary stromal projections of squamous epithelium characteristic of K14-E7 or K14-HPV16 transgenic mice (Fig. 2Citation , panel 3) was absent in K14-E6 transgenic mice. Cancer formation and growth also appeared to distinctively vary according to which HPV ORFs were expressed in the estrogen-treated cervix. Cervical and vaginal cancers in K14-E7 transgenic mice were microinvasive, small, and multifocal (Fig. 3Citation B, panel 5). Cervical malignancies in K14-E6:E7 and K14-HPV16 transgenic mice consisted of multiple nests of invasive squamous cells dispersed over a large area of cervical stromal tissue (Fig. 3Citation B, panel 6). The distinctive biological differences in cancer growth in transgenic mice expressing E7 versus both E6 and E7 support a role for E6 as a late-stage progression factor for cervical cancer in this model.



View larger version (89K):
[in this window]
[in a new window]
 
Fig. 3. Extent of cervical and vaginal carcinogenic progression, and representative histopathology of transgenic and nontransgenic mice after 6 months of estrogen treatment. A, distribution of most advanced lesions [highest grades (Fig. 2)Citation of dysplasia or cancer] in K14-HPV16, K14-E7, and K14-E6:E7 transgenic mice sacrificed after 6 months of estrogen treatment (estrogen treatment started at 1 month of age, therefore, the mice are 7 months old). All of the K14-HPV16, K14-E7, and K14-E6:E7 transgenic mice developed CIN III, CIS, or invasive cancer. K14-E6 transgenic mice displayed only CIN I or CIN II lesions despite prolonged estrogen exposure. B, representative histopathology of squamous epithelium after 6 months of estrogen treatment in transgenic and nontransgenic mice. Compared with nontransgenic controls (panel 1) the epithelium in K14-E6 transgenic mice (panel 2) displays squamous epithelial cells with mild nuclear atypia, rare suprabasal cells with enlarged nuclei (see arrowhead), and an intact differentiation pattern. Examples of CIN III/CIS lesions in K14-E7 (panel 3) and K14-E6:E7 (panel 4) transgenic mice, with arrowheads indicating dysplastic cervical epithelial cells. Low power views of the outer cervix illustrating the size and multifocal nature of microinvasive cancers (arrowheads and arrow indicate 2 different cancers) seen in K14-E7 mice (panel 5, plus inset) compared with the larger and more extensive cancers (arrowheads delineate cancer margins) that occur in K14-E6:E7 mice (panel 6). Bar: panels 1–4 = 20 µm; panels 5 and 6 = 400 µm; panel 5 inset = 100 µm.

 
Effect of Each HPV ORF on Reproductive Tract Squamous Cell Proliferation at Specific Stages of Carcinogenic Progression.
One explanation for the differential extent of histological progression in K14-E7 compared with K14-E6 transgenic mice could be lack of induction of proliferation. To precisely determine the temporal and spatial affects of each HPV oncogene on cell proliferation in the cervix, we both quantified and determined the squamous epithelial distribution of BrdUrd-labeled cells in the entire cervical transformation zone after 1, 3, and 6 months of estrogen treatment (Fig. 4, A and B)Citation . The mean number of S phase squamous epithelial cells progressively increased at each time point in K14-HPV16 and K14-E7 compared with either K14-E6 transgenic mice or nontransgenic controls (Fig. 4A)Citation . Moreover, S phase cells were present in multiple cell layers in the squamous epithelia of both K14-E7 (Fig. 4Citation B, panel 5) and K14-HPV16 (Fig. 4Citation B, panel 7) transgenic mice, particularly abundant in each papillary projection of squamous epithelium into the cervical (and vaginal) stroma. In contrast, BrdUrd-positive cells were restricted to the basal and immediate suprabasal cell layers in cervical squamous epithelium of K14-E6 transgenic mice and nontransgenic controls (Fig. 4Citation B, panels 1 and 2).



View larger version (99K):
[in this window]
[in a new window]
 
Fig. 4. Reproductive tract squamous epithelial proliferation in transgenic compared with nontransgenic mice. Reproductive tract squamous epithelial proliferation is incrementally increased over time in K14-HPV16 (n = 6), K14-E7 (n = 4–6), and K14-E6:E7 (data not shown) transgenic mice compared with either K14-E6 (n = 4–8) transgenic counterparts or nontransgenic controls (n = 5–7; A, P < 0.05, ANOVA). B, distribution of proliferative squamous epithelial cells in transgenic and nontransgenic reproductive tract (panels 1, 3, 5, and 7) and ear skin (panels 2, 4, 6, and 8). Nontransgenic (panel 1) and K14-E6 (panel 3) mice demonstrate a similar pattern in the cervical epithelium with proliferating squamous epithelial cells restricted to the basal and immediate suprabasal layers. In contrast, the cervical epithelia of both K14-E7 (panel 5) and K14-HPV16 (panel 7) evidence BrdUrd-positive cells in the upper suprabasal layers and filling papillary projections into the stroma. In nontransgenic skin, rare basal cells are proliferating (panel 2), whereas in each transgenic line (K14-E6, panel 4; K14-E7, panel 6; and K14-HPV16, panel 8) multiple epidermal cell layers are filled with proliferating keratinocytes. The contrast between induction of proliferation in ear and cervix of K14-E6 transgenic mice (panels 3 and 4) is striking. Bar = 20 µm all panels, B.

 
Analysis of the ear skin from the same transgenic mice from which reproductive tracts were harvested demonstrated marked differences, particularly in K14-E6 transgenic mice, compared that of the cervix. Each genotype of HPV transgenic mouse displayed numerous S phase cells in multiple epidermal cell layers. Moreover, BrdUrd-positive cells were present in the upper granular epidermal cell layers, a region restricted to nonreplicating, terminally differentiated keratinocytes in nontransgenic controls. These data are consistent with prior work (32 , 33 , 43) , and likely reflect the ability of either the E6 or E7 oncogenes to "uncouple" proliferation from terminal differentiation in epidermal keratinocytes (Ref. 44 ; see "Discussion"). These data highlight the discordant biology of the individual HPV oncogenes in skin and cervix. In particular, E6 has no effect on the distribution of proliferating and differentiating cells in the estrogen-primed cervix, whereas it has the near equivalent ability of E7 to disrupt squamous epithelial differentiation and cell cycle regulation in the skin.

Real-time RT-PCR Analysis of E6/E6* Transgene Expression.
One explanation for the lack of neoplastic progression in the K14-E6 transgenic mice could have been "insufficient" transgene expression in cervical epithelium. To determine transgene mRNA expression, quantitative real-time RT-PCR was performed using PCR primers and a TaqMan probe amplifying both full-length and E6* mRNA on total RNA isolated from the lower reproductive tract tissue block ("Materials and Methods"). E6 ORF mRNA expression of homozygous K14-E6 transgenic mice was 13–24-fold elevated compared with heterozygous K14-E7 and HPV transgenic mice (Fig. 5)Citation . Development of complete carcinogenesis in K14-E7 and K14-HPV transgenic mice despite a threshold level of transgene expression highlights the cocarcinogenic potency of the E7 oncoprotein in conjunction with estrogen in cervical squamous epithelium. Thus, lack of carcinogenic progression in the K14-E6 transgenic mice cannot be explained by insufficient transgene expression.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. Transgene mRNA expression levels in the cervico-vaginal epithelium of transgenic mice in response to 1 month of estrogen treatment. Real-time quantitative RT-PCR from mRNA isolated from the lower reproductive tract (see Fig. 1Citation ), using PCR primers and a TaqMan probe specific for both full-length and E6* mRNA. The Y axis is relative transgene expression data normalized for the content of endogenous histone 3.3A mRNA. Despite the modest phenotype, homozygous K14-E6 transgenic mice evidence marked transgene expression compared with K14-E7 and K14-HPV16 transgenic counterparts.

 
Differential Cervical p53 Expression in Transgenic Mice Expressing Either E6 or E7.
Two questions remained that hinged on levels of cervical squamous epithelial p53 protein expression. First, one mechanism for induction of carcinogenesis in transgenic mice expressing E7 oncoprotein alone would be coordinate mutation of p53, based in part on previous work demonstrating mutation of p53 in HPV-negative cervical cancer cell lines (45) . Second, despite robust expression of transgene mRNA, demonstration of functional activity of the E6 transgene would bolster our findings that lack of neoplastic cervical progression was because of differential oncoprotein function rather than differential transgenic protein expression in mouse cervical epithelial cells. In CINIII lesions of K14-E7 transgenic mice, there was a low-level induction of p53 protein expression compared with nontransgenic controls (Fig. 6Citation , panels 3 and 1, respectively), with an additional induction of p53 protein in cervical cancers from this transgenic lineage (Fig. 6Citation , panel 4). However, the intensity of p53 immunostaining in these cancers remained much less than that from islet cell carcinomas derived from transgenic mice expressing SV40 T-antigen behind a rat insulin promoter (Fig. 5Citation , panel 6). These data are consistent with coordinate p53 up-regulation by E7 oncoprotein (46) , rather than stabilization and accumulation of a mutant p53 protein (47) . In marked contrast to p53 induction in K14-E7 transgenic mice, there was no detectable p53 immunostaining in CINI/II lesions in K14-E6 or invasive transformation zone squamous cancers in K14-HPV16 transgenic mice (Fig. 6Citation , panels 2 and 5) consistent with E6-E6AP mediated p53 protein destruction (48 , 49) .



View larger version (114K):
[in this window]
[in a new window]
 
Fig. 6. Immunohistochemical determination of reproductive tract squamous epithelial p53 protein expression in transgenic and nontransgenic mice. Low-level p53 staining is evident in both basal (arrow and inset) and suprabasal cells (arrow) of nontransgenic mice (panel 1). In contrast, the basal and suprabasal cells (brackets) of K14-E6 transgenic mice lack detectable p53 protein expression (panel 2 and inset). p53 protein expression appears to be coordinately and incrementally induced in K1-E7 transgenic mice in CIN III (panel 3) and invasive cancers (panel 4). Invasive cancers of K14-HPV16 transgenic mice (panel 5) display a low to moderate level of p53 protein expression, possibly related to a lower level of E6 transgene expression compared with their homozygous K14-E6 counterparts. An islet cell carcinoma from a RIP-TAg transgenic mouse (panel 6) displays marked induction of p53 protein expression because of sequestration by SV40 T antigen. This level of p53 protein detection would be also consistent with stabilized, mutant p53. Bar, all panels = 20 µm.

 
Apoptosis in Cervical Carcinogenesis in Transgenic Mice.
As previous work in transgenic lens and retina demonstrated an increase in apoptosis when E7 was expressed alone without E6 (38 , 50) , we expected a similar biology in the estrogen-induced cervical epithelium of K14-E7 transgenic mice. However, a combination of histopathology and terminal deoxynucleotidyltransferase-mediated nick end labeling assay failed to demonstrate apoptotic cells either at early (4 weeks hormone treatment) or final (24 weeks hormone treatment) stages of estrogen-induced cervical carcinogenesis in transgenic mice of each genotype in this study (data not shown). Induction of apoptosis was also not detected in the cervical squamous epithelium of other genotypes of transgenic mice during cervical carcinogenesis or nontransgenic controls in response to chronic estrogen.

Centrosome Abnormalities in Cervical Neoplasia and Cancers in Transgenic Mice.
Centrosome abnormalities have been reported previously in a wide array of human cancers including cervical neoplasia (37) . In particular, both E6 and E7 viral oncoproteins have been shown to induce an increase in centrosome number albeit via different mechanisms (51 , 52) . However, one mechanism for the differential carcinogenic progression in K14-E6 transgenic mice versus transgenic counterparts expressing functional E7 could be differential induction of centrosome abnormalities in the latter compared with the former. To determine centrosome numbers, immunofluorescent staining for pericentrin, a protein component of the centrosome, was performed on deparaffinized tissue sections from transgenic and nontransgenic mice treated with estrogen for 6 months (Fig. 7Citation A, top and bottom panels). This analysis yielded several surprising results. First, premalignant lesions from each group of transgenic mice evidenced an increase in centrosome number compared with nontransgenic controls (Fig. 7B)Citation . As such, CINII lesions in K14-E6, and CINIII/CIS lesions in K14-E7 or K14-HPV16 transgenic mice each displayed a similar 6–8% incidence of cells with centrosome number elevations compared with 2.5% frequency in estrogen-treated nontransgenic mice. Second, the frequency of elevated centrosome copy number markedly increased in cervical cancers from estrogen-treated K14-HPV16 transgenic mice compared with either precursor CIN III/CIS lesions in mice of the same genotype or to malignant cells in cancers evident in K14-E7 transgenic counterparts (17 versus 9.5%; Fig. 7BCitation ). Whereas the differences between centrosome abnormalities in premalignant lesions in each genotype of transgenic mice were not significantly different from nontransgenic controls, the difference between centrosome number in cancers of HPV transgenic mice compared with nontransgenic controls was significantly different. These data plus the trend in the comparison between the K14-HPV versus the K14-E7 transgenic mice support a hypotheses that E6 functions as a late-stage, malignant progression factor, in combination with other carcinogenic effectors, such as E7, or chemical carcinogens (see "Discussion").



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 7. Centrosome abnormalities in the cervix of estrogen-treated transgenic and nontransgenic mice. A H&E section from an invasive transformation zone cancer in an estrogen-treated K14-HPV16 transgenic mouse (see black arrowhead, top panel A) and the corresponding high-magnification image (white arrowhead, bottom panel A) of a cell with three centrosomes from the region delineated by the arrow in the top panel. Analysis of the frequency of squamous cervical epithelial cells with more than two centrosomes per cell in estrogen-treated transgenic and nontransgenic mice (B). Transgenic mice expressing E6, E7, or the entire early region evidence the same level of chromosome copy number increase compared with nontransgenic controls. Cervix cancers in K14-HPV16 transgenic mice have a greater degree of centrosome copy number elevation compared with cervical malignancies in their K14-E7 transgenic and nontransgenic counterparts (P < 0.07, two-tailed, Student’s t test, K14-HPV16 versus K14-E7 and P < 0.05 K14-HPV16 versus nontransgenic mice). Bar, top panel, A = 50 µm, bottom panel, A = 10 µm.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Using our model of estrogen-induced cervical carcinogenesis, we were able to discriminate both discrete biology and distinct functions for the HPV E6 and E7 oncogenes. The cervix and vagina were exquisitely sensitive to E7 expression by itself. Multiple hyperproliferative, dysplastic lesions were produced, and carcinogenic progression proceeded to invasive malignancies. In contrast, E6 expression alone was unable to affect neoplastic progression, a phenotype that was strikingly different from malignant progression produced in the skin of the same transgenic mice. The fact that centrosome copy number elevations were produced by each HPV oncogene individually demonstrates that this potential facet of genomic instability is insufficient for cervical neoplastic progression by itself. Despite a lack of solo carcinogenic potency, E6 was a progression factor in combination with E7, producing larger and more invasive malignancies in double-transgenic mice. As such, both viral oncoproteins are validated as molecular therapeutic targets, with temporal implications for treatment of early versus late-stage lesions in cervical carcinogenesis.

One notable finding in our study was the remarkable potency of the HPV16 E7 oncogene as an estrogen cocarcinogen in the mouse cervix. E7 expression in conjunction with estrogen was sufficient to induce the requisite components of carcinogenic progression including hyperproliferation, inhibition of epithelial differentiation leading to high-grade dysplasia, insufficient compensatory induction of apoptosis, and centrosome copy number elevations (53) . Hyperproliferation could be explained by a repertoire of E7 functions shown previously to dysregulate the cell cycle including: E7 binding, destabilization, and consequent destruction of pRB, p107, and p130, sequestration of Mi2 histone deacetylase, induction of c-Myc, and abrogation of transforming growth factor ß inhibitory signaling (5) . It is important to keep in mind that estrogen itself increased reproductive tract squamous epithelial proliferation (54) . Our data suggested that E7 complemented and amplified an underlying proliferative stimulus propagated by the estrogen alone. One molecular explanation for this finding was induction of c-Jun/AP-1 activity by estrogen and HPV16 E7. In particular, HPV16/18 E7 has been shown to increase c-Jun protein levels and transcriptional activity (11) , and ligand-bound estrogen receptor has also been shown to activate AP-1 mediated transcription by indirect "tethered" binding to AP-1 complexes on DNA (55) . In addition to hyperproliferation, the development of neoplastic progression via high-grade dysplasia and ultimately malignancy in K14-E7 transgenic mice was likely facilitated by a combination of p21 inactivation, which uncoupled squamous epithelial terminal differentiation from proliferation (44) , and centrosome copy number dysregulation, which produced multipolar mitotic spindles, abnormal nuclear divisions, and potentially, cellular multinucleation and aneuploidy (52 , 56 , 57) . Estrogen itself could induce direct DNA damage via its catechol metabolites (58, 59, 60) , which could have been the potential "initiating" step in our model of cervical carcinogenesis.

The absence of concomitant apoptosis, at any stage of cervical neoplastic progression in estrogen-treated K14-E7 transgenic mice, was also surprising. Previous studies demonstrated coordinate induction of apoptosis in both embryonic lens and retina, and the epidermis of transgenic mice with E7 expression targeted to each of these epithelia (38 , 50) . Whereas induction of apoptosis in embryonic tissue by E7 could have been because of increased sensitivity of developing epithelia to E7 functions, the differential apoptosis in skin compared with cervix merits additional discussion. In the skin, apoptosis was primarily detected in the granular and stratum corneum layers. These epidermal layers contained nucleated cells in the transgenic mice (parakeratosis) compared with anucleate cells in nontransgenic controls (38 , 50) . As such, apoptosis in the skin model could have been because of persistent E7 expression in keratinocytes, in which the terminal differentiation program was already activated. However, the granular and corneal squamous epithelial cell layers do not exist in the cervix. Therefore, lack of susceptible target cells could be one mechanism underlying the lack of apoptosis in the cervix of estrogen-treated K14-E7 transgenic mice. In addition, the inability to detect apoptosis in the basal layer of cervical squamous epithelium in these same transgenic mice could have been because of paracrine elaboration of survival factors, such as insulin-like growth factor I, epidermal growth factor, platelet-derived growth factor, and transforming growth factor {alpha}, from the subjacent stroma (61, 62, 63, 64, 65, 66) . These survival factors could have balanced the unopposed expression of E7 in the vaginal and cervical basal squamous epithelial cells of estrogen-treated K14-E7 transgenic mice. Importantly, prior work in the skin has also demonstrated functional p53 in the squamous epithelium of K14-E7 mice. Specifically, coordinate induction of p53 and its target p21 was maintained in the keratinocytes within irradiated transgenic skin (40) . As such, the lack of apoptosis in the estrogen-treated cervices of K14-E7 transgenic mice was likely not because of failure of p53 function. Conversely, our immunohistochemical analysis of p53 expression in cervical carcinomas in K14-E7 transgenic mice failed to demonstrate stabilization of p53 protein to a level consistent with independent mutation and oncogenic gain of function.

The inability of E6 to affect neoplastic progression beyond low-grade dysplasia was another surprising finding of this study considering the repertoire and functions of cellular targets of this viral oncoprotein (7) . E6 binding to the calcium-binding protein, E6BP (67 , 68) , has been shown to inhibit keratinocyte terminal differentiation in cell culture and could have been a potential mechanism for uncoupling terminal differentiation from proliferation. E6 complex formation with either the human homologue of the Drosophila discs-large protein (69) or paxillin (70) could each disrupt basal cell polarity potentially increasing proliferation and facilitating dysplasia by permitting escape of these proliferating cells into the upper stratified squamous epithelial layers. E6-mediated activation of the human telomerase reverse transcriptase component of telomerase (71 , 72) could also have contributed to in vivo immortalization of squamous epithelial cells, allowing for persistence of transformed cells and their subsequent progression to malignancy. However, the lack of induction of cervical epithelial cell proliferation and high-grade dysplasia, suggests that either these cellular targets do not interact with E6 in the tissue and hormonal context of this model or that the murine cervix is resistant to their dysregulation despite perturbation by the oncoprotein. Certainly the lack of a robust neoplastic phenotype cannot be explained by either lack of reproductive tract E6 expression or even function, as both p53 expression was decreased and centrosome copy number elevated in these transgenic mice. However, our results clearly demonstrated that these particular E6 functions by themselves were insufficient to support neoplastic progression in the face of the inability of the oncoprotein by itself to affect cervical epithelial proliferation and differentiation.

Similarly, the discordance in neoplastic potency between HPV E7 and E6 in the face of similar elevations in centrosome number in this model of cervical carcinogenesis reinforced our previous conclusions regarding the relevance of this parameter of genomic instability, per se, as a predictor of ultimate neoplastic progression. Our current model is that centrosome elevations arise by two different mechanisms in E6- or E7-expressing cells (56 , 57) . In E6-expressing cells, centrosome abnormalities were detected in polynucleated cells, many of which were senescent. These data were consistent with the detection of occasional cells with markedly increased nuclear:cytoplasmic ratio in the cervical epithelium of estrogen-treated K14-E6 transgenic mice (Fig. 3)Citation . In contrast, centrosome abnormalities in E7-expressing cells were detected in proliferative diploid cells before additional features of genomic instability (57) , suggesting that E7 itself is an independent driving force for the induction of genomic stability in cells with the potential for neoplastic progression. The current study is the first determination that this concept of parallel alteration in centrosome number control indeed occurs in the cervix expressing either HPV oncogene and that these centrosome abnormalities are associated with different neoplastic consequences.

However, our results with individual expression of E7 or E6 in the estrogen-treated cervix contrasted sharply to that seen in the skin of the same transgenic mice. In skin, both E7 and E6 were potent inducers of hyperproliferation (Fig. 4Citation ; Refs. 32 , 33 ). Both oncogenes dysregulated terminal differentiation and allowed escape of proliferating cells to the upper epidermal layers. Most strikingly, the carcinogenic potential of these oncogenes was reversed in skin. There, E7, alone or in combination with two-stage chemical carcinogens, induced predominantly benign papillomas, possessing a low frequency of malignant conversion (32 , 39) , whereas epidermal cancer was the predominant lesion in transgenic mice expressing E6 alone (33) or in combination with chemical carcinogens (39) . Additional examination of the data from these experiments also supported a role for E6 as a late-stage malignant progression factor in epidermis, reminiscent of our current results in the mouse cervix, albeit when both HPV oncogenes were coexpressed. In skin, the combination of E6 and chemical carcinogens increased the frequency of spindle-cell compared with well-differentiated epidermal carcinomas. Spindle-cell cancer is a more advanced stage of malignant progression in mouse skin carcinogenesis (73) . Despite this similarity, the overall discordance in solo carcinogenic potency of E7 and E6 in mouse skin and cervix highlights the importance of cell-type, tissue, and hormonal context in the modeling of human disease by transgenic models.

However, despite our compelling demonstration of distinctive E7 and E6 functions in the mouse cervix, these viral oncogenes are invariably coexpressed in human HPV disease (2) . Both our current and prior work is concordant with a role for E6 as a late-stage malignant progression factor in both cervix and skin of double E6:E7 transgenic mice (39) . In the cervix, E6 and E7 coexpression contributes to the formation of large, extensively invasive cancers in double-transgenic mice, and the enhanced chromosomal copy number dysregulation in the malignancies in these mice compared with counterparts expressing E7 alone.

In summary, this study highlights the distinctive functions of the E7 and E6 oncogenes in cervical carcinogenesis with the caveats that several species-specific and technological differences exist between our model and human cervical neoplastic or malignant disease. Collectively, our data suggest that both induction of squamous epithelial proliferation and perturbation of centrosome copy number contribute to progression to invasive cervical cancer. Moreover, whereas E6 appears to have a low neoplastic penetrance alone, it facilitates the genesis of aggressively malignant cervical cancers in conjunction with E7. Future work will genetically dissect discrete E7 and E6 oncoprotein functions to elucidate the mechanisms underlying their cooperation in cervical carcinogenesis.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grants R01-CA71398, NO1-CN-95115, NCI R01 CA 66980, and NCI R01 CA22443. Back

2 To whom requests for reprints should be addressed, at Cancer Genetics Program, University of California San Francisco Comprehensive Cancer Center, 2340 Sutter Street, Room N419, San Francisco, CA 94143-0808. Phone: (415) 502-3292; Fax: (415) 476-8218; E-mail: jarbeit{at}cc.ucsf.edu Back

3 The abbreviations used are: HPV, human papillomavirus; ORF, open reading frame; ttl, translation termination linker; RT-PCR, reverse transcription-PCR; BrdUrd, bromodeoxyuridine; CIN, cervical intraepithelial neoplasia; CIS, carcinoma in situ; AP-1, activator protein. Back

Received 3/10/03. Revised 6/ 9/03. Accepted 6/10/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Münger K. The role of human papillomaviruses in human cancers. Front. Biosci., 7: d641-649, 2002.[Medline]
  2. zur Hausen H. Papillomaviruses and cancer: from basic studies to clinical application. Nat. Rev. Cancer, 2: 342-350, 2002.[Medline]
  3. zur Hausen H. Molecular pathogenesis of cancer of the cervix and its causation by specific human papillomavirus types. Curr. Top. Microbiol. Immunol., 186: 131-156, 1994.[Medline]
  4. Münger K. The molecular biology of cervical cancer.. J. Cell. Biochem. Suppl., 23: 55-60, 1995.[Medline]
  5. Münger K., Basile J. R., Duensing S., Eichten A., Gonzalez S. L., Grace M., Zacny V. L. Biological activities and molecular targets of the human papillomavirus E7 oncoprotein.. Oncogene, 20: 7888-7898, 2001.[Medline]
  6. McMurray H., Nguyen D., Westbrook T., McCance D. Biology of human papillomaviruses.. Int. J. Exp. Pathol., 82: 15-33, 2001.[Medline]
  7. Mantovani F., Banks L. The human papillomavirus E6 protein and its contribution to malignant progression.. Oncogene, 20: 7874-7887, 2001.[Medline]
  8. Jones D. L., Münger K. Interactions of the human papillomavirus E7 protein with cell cycle regulators.. Semin. Cancer Biol., 7: 327-337, 1996.[Medline]
  9. Jones D. L., Thompson D. A., Münger K. Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis.. Virology, 239: 97-107, 1997.[Medline]
  10. Scheffner M., Werness B., Huibregste J., Howley P. The E6 oncoprotein encoded by human papillomavirus type 16 and 18 promotes the degradation of p53.. Cell, 63: 1129-1136, 1990.[Medline]
  11. Antinore M. J., Birrer M. J., Patel D., Nader L., McCance D. J. The human papillomavirus type 16 E7 gene product interacts with and trans-activates the AP1 family of transcription factors.. EMBO J., 15: 1950-1960, 1996.[Medline]
  12. Barbosa M. S., Schlegel R. The E6 and E7 genes of HPV-18 are sufficient for inducing two-stage in vitro transformation of human keratinocytes.. Oncogene, 4: 1529-1532, 1989.[Medline]
  13. Howley P. M., Münger K., Werness B. A., Phelps W. C., Schlegel R. Molecular mechanisms of transformation by the human papillomaviruses.. Princess Takamatsu Symp., 20: 199-206, 1989.[Medline]
  14. Villa L. L., Schlegel R. Differences in transformation activity between HPV-18 and HPV-16 map to the viral LCR-E6–E7 region.. Virology, 181: 374-377, 1991.[Medline]
  15. Münger K., Phelps W. C., Bubb V., Howley P. M., Schlegel R. The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes.. J. Virol., 63: 4417-4421, 1989.[Abstract/Free Full Text]
  16. Arbeit J. M., Münger K., Howley P. M., Hanahan D. Neuroepithelial carcinomas in mice transgenic with human papillomavirus type 16 E6/E7 ORFs.. Am. J. Pathol., 142: 1187-1197, 1993.[Abstract]
  17. Griep A. E., Herber R., Jeon S., Lohse J. K., Dubielzig R. R., Lambert P. F. Tumorigenicity by human papillomavirus type 16 E6 and E7 in transgenic mice correlates with alterations in epithelial cell growth and differentiation.. J. Virol., 67: 1373-1384, 1993.[Abstract/Free Full Text]
  18. Lambert P., Pan H., Pitot H., et al Epidermal cancer associated with expression of human papillomavirus type 16 E6 and E7 oncogenes in the skin of transgenic mice.. Proc. Natl. Acad. Sci. USA, 90: 5583-5587, 1993.[Abstract/Free Full Text]
  19. Arbeit J. M., Münger K., Howley P. M., Hanahan D. Progressive squamous epithelial neoplasia in K14-human papillomavirus type 16 transgenic mice.. J. Virol., 68: 4358-4368, 1994.[Abstract/Free Full Text]
  20. Searle P., Thomas D., Faulkner K., Tinsley J. Stomach cancer in transgenic mice expressing human papillomavirus type 16 genes from a keratin promoter.. J. Gen. Virol., 75: 1125-1137, 1994.[Abstract/Free Full Text]
  21. Kondoh G., Murata Y., Aozasa K., Yutsudo M., Hakura A. Very high incidence of germ cell tumorigenesis (seminomagenesis) in human papillomavirus type 16 transgenic mice.. J. Virol., 65: 3335-3339, 1991.[Abstract/Free Full Text]
  22. Adams M., Borysiewicz L., Fiander A., Man S., Jasani B., Navabi H., Lipetz C., Evans A. S., Mason M. Clinical studies of human papilloma vaccines in pre-invasive and invasive cancer.. Vaccine, 19: 2549-2556, 2001.[Medline]
  23. Di Lonardo A. D., Marcante M. L., Poggiali F., Hamsoikova E., Venuti A. Egg yolk antibodies against the E7 oncogenic protein of human papillomavirus type 16.. Arch. Virol., 146: 117-125, 2001.[Medline]
  24. Pumpens P., Razanskas R., Pushko P., Renhof R., Gusars I., Skrastina D., Ose V., Borisova G., Sominskaya I., Petrovskis I., Jansons J., Sasnauskas K. Evaluation of HBs, HBc, and frCP virus-like particles for expression of human papillomavirus 16 E7 oncoprotein epitopes.. Intervirology, 45: 24-32, 2002.[Medline]
  25. Galloway D. A. Papillomavirus oncoproteins as vaccine candidates.. Lancet, 347: 1498-1499, 1996.[Medline]
  26. Schiller J. T., Hidesheim A. Developing HPV virus-like particle vaccines to prevent cervical cancer: a progress report. J. Clin. Virol., 19: 67-74, 2000.[Medline]
  27. Phelps W. C., Barnes J. A., Lobe D. C. Molecular targets for human papillomaviruses: prospects for antiviral therapy. Antivir. Chem. Chemother., 9: 359-377, 1998.[Medline]
  28. Underwood M. R., Shewchuk L. M., Hassell A. M., Phelps W. C. Searching for antiviral drugs for human papillomaviruses.. Antivir. Ther., 5: 229-242, 2000.[Medline]
  29. Beerheide W., Sim M. M., Tan Y. J., Bernard H. U., Ting A. E. Inactivation of the human papillomavirus-16 E6 oncoprotein by organic disulfides.. Bioorg. Med. Chem., 8: 2549-2560, 2000.[Medline]
  30. Arbeit J. M., Howley P. M., Hanahan D. Chronic estrogen induced cervical and vaginal squamous carcinogenesis in HPV16 transgenic mice.. Proc. Natl. Acad. Sci. USA, 93: 2930-2935, 1996.[Abstract/Free Full Text]
  31. Elson D. A., Riley R. R., Lacey A., Thordarson G., Talamantes F., Arbeit J. M. Sensitivity of the cervical transformation zone to estrogen-induced squamous carcinogenesis.. Cancer Res., 60: 1267-1275, 2000.[Abstract/Free Full Text]
  32. Herber R., Liem A., Pitot H., Lambert P. F. Squamous epithelial hyperplasia and carcinoma in mice transgenic for the human papillomavirus type 16 E7 oncogene.. J. Virol., 70: 1873-1881, 1996.[Abstract]
  33. Song S., Pitot H. C., Lambert P. F. The human papillomavirus type 16 E6 gene alone is sufficient to induce carcinomas in transgenic animals.. J. Virol., 73: 5887-5893, 1999.[Abstract/Free Full Text]
  34. Litvak K., Flood S., Marmato J., Giusti W., Deetz K. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization.. PCR Method. Appl., 4: 357-362, 1995.[Medline]
  35. Elson D. A., Thurston G., Huang L. E., Ginzinger D. G., McDonald D. M., Johnson R. S., Arbeit J. M. Induction of hypervascularity without leak or inflammation in transgenic mice overexpressing hypoxia-inducible factor-1{alpha}.. Genes Dev., 15: 2520-2532, 2001.[Abstract/Free Full Text]
  36. Arbeit J. M., Riley R. R., Huey B., Porter C., Kelloff G., Lubet R., Ward J. M., Pinkel D. DFMO chemoprevention of epidermal carcinogenesis in K14-HPV16 transgenic mice.. Cancer Res., 59: 3610-3620, 1999.[Abstract/Free Full Text]
  37. Duensing S., Lee L. Y., Duensing A., Basile J., Piboonniyom S., Gonzalez S., Crum C. P., Münger K. The human papillomavirus type 16 E6 and E7 oncoproteins cooperate to induce mitotic defects and genomic instability by uncoupling centrosome duplication from the cell division cycle.. Proc. Natl. Acad. Sci. USA, 97: 10002-10007, 2000.[Abstract/Free Full Text]
  38. Pan H., Griep A. Altered cell cycle regulation in the lens of HPV16 E6 or E7 transgenic mice: implications for tumor suppressor gene function in development. Genes Dev., 8: 1285-1299, 1994.[Abstract/Free Full Text]
  39. Song S., Liem A., Miller J. A., Lambert P. F. Human papillomavirus types 16 E6 and E7 contribute differently to carcinogenesis.. Virology, 267: 141-150, 2000.[Medline]
  40. Song S., Gulliver G. A., Lambert P. F. Human papillomavirus type 16 E6 and E7 oncogenes abrogate radiation-induced DNA damage responses in vivo through p53-dependent and p53-independent pathways.. Proc. Natl. Acad. Sci. USA, 95: 2290-2295, 1998.[Abstract/Free Full Text]
  41. Crum C., Nuovo G. Genital Papillomaviruses and Related Neoplasms16-19, Raven Press New York 1991.
  42. Broders A. Practical points on the microscopic grading of carcinoma.. New York State J. Med., 32: 667-671, 1932.
  43. Gulliver G. A., Herber R. L., Liem A., Lambert P. F. Both conserved region 1 (CR1) and CR2 of the human papillomavirus type 16 E7 oncogene are required for induction of epidermal hyperplasia and tumor formation in transgenic mice.. J. Virol., 71: 5905-5914, 1997.[Abstract]
  44. Jones D. L., Alani R. M., Münger K. The human papillomavirus E7 oncoprotein can uncouple cellular differentiation and proliferation in human keratinocytes by abrogating p21Cip1-mediated inhibition of cdk2.. Genes Dev., 11: 2101-2111, 1997.[Abstract/Free Full Text]
  45. Scheffner M., Münger K., Byrne J. C., Howley P. M. The state of the p53 and retinoblastoma genes in human cervical carcinoma cell lines.. Proc. Natl. Acad. Sci. USA, 88: 5523-5527, 1991.[Abstract/Free Full Text]
  46. Demers G. W., Halbert C. L., Galloway D. A. Elevated wild-type p53 protein levels in human epithelial cell lines immortalized by the human papillomavirus type 16 E7 gene.. Virology, 198: 169-174, 1994.[Medline]
  47. Levine A. p53, the cellular gatekeeper for growth and division.. Cell, 88: 323-331, 1997.[Medline]
  48. Talis A. L., Huibregtse J. M., Howley P. M. The role of E6AP in the regulation of p53 protein levels in human papillomavirus (HPV)-positive and HPV-negative cells.. J. Biol. Chem., 273: 6439-6445, 1998.[Abstract/Free Full Text]
  49. Scheffner M., Huibregtse J. M., Vierstra R. D., Howley P. M. The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53.. Cell, 75: 495-505, 1993.[Medline]
  50. Howes K. A., Ransom N., Papermaster D. S., Lasudry J. G., Albert D. M., Windle J. J. Apoptosis or retinoblastoma: alternative fates of photoreceptors expressing the HPV-16 E7 gene in the presence or absence of p53. Genes Dev., 8: 1300-1310, 1994.[Abstract/Free Full Text]
  51. Tarapore P., Fukasawa K. Loss of p53 and centrosome hyperamplification.. Oncogene, 21: 6234-6240, 2002.[Medline]
  52. Duensing S., Münger K. Human papillomaviruses and centrosome duplication errors: modeling the origins of genomic instability. Oncogene, 21: 6241-6248, 2002.[Medline]
  53. Hanahan D., Weinberg R. A. The hallmarks of cancer.. Cell, 100: 57-70, 2000.[Medline]
  54. Korach K. Insights from the study of animals lacking functional estrogen receptor.. Science (Wash. DC), 266: 1524-1527, 1994.[Abstract/Free Full Text]
  55. Webb P., Lopez G., Uht R., Kushner P. Tamoxifen activation of the estrogen receptor/AP-1 pathway: Potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol. Endocrinol., 9: 443-456, 1995.[Abstract]
  56. Duensing S., Duensing A., Flores E. R., Do A., Lambert P. F., Münger K. Centrosome abnormalities and genomic instability by episomal expression of human papillomavirus type 16 in raft cultures of human keratinocytes.. J. Virol., 75: 7712-7716, 2001.[Abstract/Free Full Text]
  57. Duensing S., Duensing A., Crum C. P., Münger K. Human papillomavirus type 16 E7 oncoprotein-induced abnormal centrosome synthesis is an early event in the evolving malignant phenotype.. Cancer Res., 61: 2356-2360, 2001.[Abstract/Free Full Text]
  58. Auborn K., Woodworth C., DiPaolo J., Bradlow H. The interaction between HPV infection and estrogen metabolism in cervical carcinogenesis.. Int. J. Cancer, 49: 867-869, 1990.
  59. Mesia-Vela S., Sanchez R. I., Li J. J., Li S. A., Conney A. H., Kauffman F. C. Catechol estrogen formation in liver microsomes from female ACI and Sprague-Dawley rats: comparison of 2- and 4-hydroxylation revisited. Carcinogenesis (Lond.), 23: 1369-1372, 2002.[Abstract/Free Full Text]
  60. Zhu B. T., Conney A. H. Functional role of estrogen metabolism in target cells: review and perspectives. Carcinogenesis (Lond.), 19: 1-27, 1998.[Abstract/Free Full Text]
  61. Hana V., Murphy L. J. Interdependence of epidermal growth factor and insulin-like growth factor-I expression in the mouse uterus.. Endocrinology, 135: 107-112, 1994.[Abstract]
  62. Sato T., Wang G., Hardy M. P., Kurita T., Cunha G. R., Cooke P. S. Role of systemic and local IGF-I in the effects of estrogen on growth and epithelial proliferation of mouse uterus.. Endocrinology, 143: 2673-2679, 2002.[Abstract/Free Full Text]
  63. Gray K., Eitzman B., Raszmann K., Steed T., Geboff A., McLachlan J., Bidwell M. Coordinate regulation by diethylstilbestrol of the platelet-derived growth factor-A (PDGF-A) and -B chains and the PDGF receptor {alpha}- and ß-subunits in the mouse uterus and vagina: potential mediators of estrogen action. Endocrinology, 136: 2325-2340, 1995.[Abstract]
  64. Paria B. C., Das S. K., Huet-Hudson Y. M., Dey S. K. Distribution of transforming growth factor {alpha} precursors in the mouse uterus during the periimplantation period and after steroid hormone treatments.. Biol. Reprod., 50: 481-491, 1994.