| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Department of Interdisciplinary Oncology, Moffitt Cancer Center and Research Institute University of South Florida [R. N., L. F., P. B., M. G., J. T., L. M., C. S., J. W., R. J., K. B.], Tampa, Florida 33614, and Novartis Pharmaceutical, Inc. (P. A.), Summit, New Jersey
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
B signaling, which activate several antiapoptotic mechanisms (13, 14, 15, 16)
.
Because of the proliferation and survival advantage conferred by Bcr-Abl, depleting its levels or activity has emerged as a rational strategy to treat the chronic and advanced phases of CML (9
, 17
, 18)
. STI-571, now known as Gleevec (imatinib mesylate), is a phenylaminopyrimidine derivative and a relatively specific ATP binding site antagonist of Bcr-Abl TK (19)
. At relatively low and clinically achievable concentrations (
0.25 µM), imatinib selectively causes in vitro and in vivo growth arrest and apoptosis of Bcr-Abl-positive leukemia but not of normal hematopoietic progenitor cells (20, 21, 22, 23)
. Imatinib has demonstrated an impressive clinical activity in the chronic phase of CML, with
95% of patients achieving durable complete clinical remissions (24)
. However,
50% of patients with the chronic phase fail to achieve a cytogenetic complete response after imatinib therapy (24
, 25)
. In the accelerated phase of CML and CML-BC after treatment with imatinib, the complete clinical and cytogenetic remission rates are even lower, with most patients suffering relapse and succumbing to imatinib-refractory CML-BC (24
, 26
, 27)
. The mechanisms of resistance to imatinib identified in CML-BC cells include mutations in the kinase domain of bcr-Abl and amplification of the bcr-abl gene, resulting in the overexpression of Bcr-Abl (28
, 29)
. Importantly, ectopic expression of the mutant Bcr-Abl was shown to transform murine hematopoietic cells and confer resistance against imatinib (28
, 30) . Recently, in 29 of 32 patients, whose disease relapsed after an initial response to imatinib, 15 different amino acid substitutions affecting 13 residues were identified as mutations in the Bcr-Abl kinase domain (30)
. Two groups of mutations were noted. These included those that altered amino acids that directly contact imatinib (e.g., T315I) or those that prevented Bcr-Abl from achieving the inactive conformational state required for binding to imatinib (e.g., E255K). These mutations conferred varying degrees of resistance to imatinib in the leukemia cells. These observations emphasize the need to develop and test novel anti-Bcr-Abl agents, which have mechanisms of antileukemia activity distinct from those described for imatinib. Especially attractive would be those agents that not only enhance the antileukemia effects of imatinib but also exert cytotoxic effects against imatinib-refractory CML-BC (9)
.
Histone acetyltransferases and HDACs are able to regulate gene expression patterns through recruitment to target genes in association with specific transcription factors (31) . HDACs catalyze deacetylation of lysine residues in the NH2-terminal tails of the core nucleosomal histones, resulting in chromatin condensation and transcriptional regulation of cell cycle- and differentiation-regulatory genes (32) . Consequently, treatment with HDIs cause hyperacetylation of the NH2-terminal lysine residues of the nucleosomal histones, which transcriptionally up-regulates p21WAF1 expression and induces cell cycle arrest and apoptosis of cancer and leukemia cells (33 , 34) . Recently, a natural product HDI, depsipeptide (FK228), was also shown to cause acetylation of the hsp90. This was shown to destabilize the stable chaperone complex of hsp90 with its client proteins, thereby promoting their degradation by the proteasome. These client proteins include ErbB2, Raf-1, and mutant p53 (35) . A different class of HDIs, the hydroxamic acid analogues, e.g., TSA and SAHA, have also been demonstrated to exert potent in vitro and in vivo antileukemia effects (36, 37, 38) . Recently, a cinnamic acid hydroxamate, LAQ824, has been shown to act as a potent HDI at submicromolar levels (39) . In the present studies, we determined the effects of LAQ824 treatment on the mRNA and protein expression of bcr-abl. We also determined the effects of LAQ824 on the cell cycle status and apoptosis of the cultured and primary CML-BC cells. Whether treatment with LAQ824 would deplete the mutant Bcr-Abl and induce apoptosis of imatinib-refractory human CML-BC cells was also probed in the present studies. Finally, because it had been previously reported that Bcr-Abl is a client protein for hsp90 (40) , we determined whether LAQ824 treatment would induce acetylation of hsp90 and whether this would disrupt the chaperone association of Bcr-Abl to hsp90, leading to the proteasomal degradation and depletion of Bcr-Abl.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Primary and Cultured CML-BC Cells.
CML-BC K562 and LAMA-84 cells were cultured as described previously (42)
. The primary CML-BC cells were procured from the peripheral blood and/or bone marrow of 5 patients who had CML-BC. Of these, 3 patients showed clear evidence of disease progression in the bone marrow and/or peripheral blood while receiving imatinib at a dose of 600 mg/day. Two additional samples were purified from the peripheral blood and/or bone marrow obtained from imatinib-naïve patients. All samples were obtained with informed consent as part of a clinical protocol approved by the Institutional Review Board. Bone marrow aspirate or the peripheral blood sample was obtained in heparinized tubes, and mononuclear cells (BMMCs) were isolated by centrifugation through Ficoll-Hypaque (Amersham Pharmacia Biotech) and washed with RPMI 1640. To isolate CD34+ leukemic blasts from BMMCs, the cells were coated with anti-CD34-PE conjugated antibody (PharMingen, Inc.) and anti-PE microbeads (Miltenyi Biotech). The CD34+ cells were then isolated using magnetic cell sorting with LS+ columns and Variomax magnets (Miltenyi Biotech). The magnetic cell sorting-selected cells were analyzed by flow cytometry before and after sorting to determine the percentage of CD34+ cells, which was routinely
95% using this technique.
Isolation of CD34+ Cells.
CD34+ hematopoietic progenitors were isolated from the marrow of healthy donors after obtaining Institutional Review Board informed consent. Mononuclear cells were prepared using Ficoll-Hypaque and then CD34+ cells isolated to >98% purity using fluorescence activated cell sorting. This was accomplished using a FACSVantage equipped with a TurboSort option (Becton Dickinson Immunocytometry Systems, San Jose, CA). Recoveries of 5070% and routine purities of >98% were obtained (43)
. For CD34 analysis and sorting, cells were stained with directly conjugated fluorescent anti-CD34 antibody (clone 8G12, i.e., HPCA-2; Becton Dickinson Immunocytometry Systems). Dead and dying cells were excluded on the basis of 7-amino-actinomycin D staining as described previously (43)
. Fluorochrome-conjugated anti-CD34 was excited at 488 nm, and fluorescence emission was detected using standard filters. CellQuest (Becton Dickinson Immunocytometry Systems) and FlowJo (TreeStar, Inc., Palo Alto, CA) software were used for data acquisition and storage.
Cells and Transfection of the bcr-abl Gene.
Human acute myelogenous leukemia HL-60/Bcr-Abl (p210) wt and HL-60/Bcr-Abl (p210) T315I cells were created by transfection of the bcr-abl gene encoding the wt p210 Bcr-Abl or the mutant bcr-abl gene encoding the Bcr-Abl (p210) T315I mutant protein, as described previously (28
, 30
, 44)
. The bcr-abl cDNA was a kind gift of Dr. Thomas Skorski (Temple University, Philadelphia, PA). wt bcr-abl was cloned into the BamHI site of the plasmid vector pSTAR (44)
. The p210 bcr-abl (T315I) mutant construct was created from the wt bcr-abl by site-directed mutagenesis, using Quick-change XL mutagenesis kit (Clontech, Palo Alto, CA). The resulting pSTAR bcr-Abl (wt) and p210 bcr-abl (T315I) plasmid vectors were stably transfected into HL-60 cells (44)
. Stable clones were selected, subcloned by limiting dilution method, and maintained, as described previously (44)
. Logarithmically growing cells were used for the studies described below.
Flow Cytometric Analysis of Cell Cycle Status and Apoptosis.
The flow cytometric evaluation of the cell cycle status and apoptosis was performed according to a previously described method (22)
. The percentage of cells in the G1, S, and G2-M phases were calculated using Multicycle software (Phoenix Flow Systems, San Diego, CA).
Apoptosis Assessment by Annexin V Staining.
After drug treatments, cells were resuspended in 100 µl of the staining solution containing annexin V fluorescein and propidium iodide in a HEPES buffer (Annexin V-FLUOS Staining Kit; Boehringer-Mannheim and Indianapolis, IN). After incubation at room temperature for 15 min, annexin V-positive cells were estimated by flow cytometry, as described previously (42)
.
Morphological Assessment of Apoptosis.
After drug treatment, 50 x 103 cells were washed and resuspended in PBS (pH 7.3). Cytospun preparations of the cell suspensions were fixed and stained with Wright stain. Cell morphology was determined by light microscopy. In all, five different fields were randomly selected for counting of at least 500 cells. The percentage of apoptotic cells was calculated for each experiment, as described previously (22
, 42)
.
Western Blot Analyses.
Western analyses of Bcr-Abl, Bcl-xL, p-AKT, p21, p27, and acetylated histone H3 and H4 proteins and ß-actin were performed using specific antisera or monoclonal antibodies (see above), as described previously (22
, 42)
. Horizontal scanning densitometry was performed on Western blots by using acquisition into Adobe PhotoShop (Adobe Systems, Inc., San Jose, CA) and analysis by the NIH Image Program (NIH, Bethesda, MD). The expression of ß-actin was used as a control.
Autophosphorylation of Bcr-Abl.
Cells were lysed in the lysis buffer [1% Triton X-100, 0.5% deoxycholate, 150 mM NaCl, 2.0 mM EDTA, 1.0 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 1 µg/ml Pepstin-A, 2 µg/ml Aprotinin, 25 mM NaF, 1.0 mM 4-(2-aminoethyl) benzenesulfonylfluoride hydrochloride, 20 mM P-nitrophenyl phosphate, 0.5 mM sodium orthovanadate for 30 min, and the nuclear and cellular debris cleared by centrifugation]. Protein G-agarose beads were washed twice in lysis buffer then incubated with anti-Abl monoclonal antibody [1 in 100 dilution (Santa Cruz Biotechnology] at 4°C for 2 h. After washing the protein G beads and the antibody mix with the lysis buffer, 100 µg of total cell lysates were added and incubated overnight at 4°C. The immunoprecipitates were washed three times in lysis buffer, and proteins were eluted with the SDS sample loading buffer. Proteins were separated by SDS-PAGE as described previously (22)
. Immunoprecipitates were examined by Western blot analysis after transfer of proteins to nitrocellulose membranes (22
, 42) . Western blot analyses were performed with antiphospho tyrosine antibody (PharMingen, Inc.) and anti-Abl antibody to control for equal loading (42)
.
Real-Time Quantitative RT-PCR.
Total RNA was isolated from cells using an RNeasy kit (Qiagen, Inc., Valencia, CA) according to the manufacturers instructions. Two µl of total RNA (0.1 µg) were added to 23 µl of a reaction mix (Taqman RT-PCR reagent kit; Perkin-Elmer, Boston, MA), consisting of 19.7 µl of H2O, 0.15 µl of enzyme mix, 0.5 µl of the forward B2A2-primer, 0.5 µl of reverse B2A2-primer, 1.0 µl of bcr-abl gene-specific oligonucleotide probe, 0.5 µl of histone H1 forward primer, 0.5 µl of histone H1 reverse primer, and 0.5 µl of histone-specific oligonucleotide probe were placed in a 96-well plate. The plate was transferred to an ABI 7700 thermocycler (Perkin-Elmer), and samples were passed through 48°C, 30 min and 95°C, 10 min; these were followed by 35 amplification cycles (95°C, 15 s, 60°C, 1 min), during which fluorescent signals of bcr-abl and histone H1 probes were measured as described previously (45)
. Serial dilutions of 106-101 of bcr-abl plasmid DNA and histone plasmid DNA were used as a reference standard of fluorescent signals for copy number as described previously (45)
. Histone H1 primers (forward primer, 5'-GCGAGAAATTGCTCAGGACTTTA-3'; reverse primer, 5'-GTGTCTTCAAAAAGGCCAACCA-3') and a probe (5'-CCTCACTTGCCTCCTGCAAAGCACC-3') were used in the reaction. p210 Bcr-Abl (e2a2) forward primer, 5'-TCCACTCAGCCACTGGATTTAA-3'; reverse primer, 5'-TGAGGCTCAAAGTCAGATGCTACT-3', and a probe CAGAGTTCAAAAGCCCTTCAGCGGC. p185 Bcr-Abl (e1a2) forward primer, 5'-TGTGAAACTCCAGACTGTCCACA-3'; reverse primer, 5'-AAAGTCAGATGCTACTGGCCG-3'; and probe, 5'-TGACCATCAATAAGGAAGAAGCCCCTTCAGC-3'. All of the probes carried a 5'-FAM reporter label and a 3'-TAMRA quencher group. All primers and probes were synthesized by PE-Applied Biosystems (Perkin-Elmer).
Northern Blot Analysis.
Northern blot analysis of bcr-abl mRNA was performed, using a previously reported method (38)
. Total RNA was extracted from treated and untreated cells using RNeasy mini kit (Qiagen, Inc.). Total RNA (20 µg) was separated on 1% agarose gel containing formaldehyde (0.22 M) and transferred overnight to an uncharged nylon membrane by capillary transfer in 10x SSC. Membranes were treated with an UV cross-linker (Stratagene) and subsequently probed with 32P-
[dCTP]-radiolabeled probe. A 413-bp fragment from the joining regions of bcr-abl generated by PCR using primers Bcr-b1 (forward) GAAGTGTTTCAGAAGCTTCTCC and ABL-A3 (reverse) GTTTGGGCTTCACACCATTCC was used as template for generating bcr-abl probe.
ChIP Assay.
ChIP analysis was performed by a slight modification of a previously described method (33)
. Cells were incubated overnight at a density of 0.25 x 106 cells/ml at 37°C with 5% CO2. Next day, cells were cultured with 0, 50, 100, or 250 nM LAQ 824 for 24 h. Formaldehyde was then added to the cells to a final concentration of 1%, and the cells were gently shaken at room temperature for 10 min. After this, the cells were pelleted, suspended in 1 ml of ice-cold PBS containing protease inhibitors (Complete; Boehringer Mannheim). Cells were again pelleted, resuspended in 0.5 ml of SDS lysis buffer [1% SDS, 1.0 mM EDTA, and 50 mM Tris·HCl (pH 8.1)], and incubated on ice for 20 min. Lysates were sonicated with 15-s bursts. Debris was removed from samples by centrifugation for 20 min at 15,000 x g at 4°C. An aliquot of the chromatin preparation (100 µl) was set aside and designated as Input Fraction. The supernatants were diluted 3-fold in the immunoprecipitation buffer [0.01% SDS, 1.0% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris·HCl (pH 8.1), and 150 mM NaCl], and 80 µl of 50% protein A-Sepharose slurry containing 20-µg sonicated salmon sperm DNA and 1 mg/ml BSA in the TE buffer [10 mM Tris·HCl (pH 8.0) and 1 mM EDTA] were added and incubated by rocking for 2 h at 4°C. Beads were pelleted by centrifugation, and supernatants were placed in fresh tubes with 5 µg of the antiacetylated histone H3 antibody, antiacetylated histone H4 antibody, or normal rabbit serum and incubated overnight at 4°C. Protein A-Sepharose slurry (60 µl) was added, and the samples were rocked for 1 h at 4°C. Protein A complexes were centrifuged and washed three times for 5 min each with immunoprecipitation buffer and twice for 5 min each with immunoprecipitation buffer containing 500 mM NaCl. Immune complexes were eluted twice with 250 µl of elution buffer (1% SDS, 0.1 M NaHCO3) for 15 min at room temperature. Twenty µl of 5 M NaCl were added to the combined eluates, and the samples were incubated at 65°C for 24 h. EDTA, Tris·HCl (pH 6.5), and proteinase K were then added to the samples at a final concentration of 10 mM, 40 mM, and 0.04 µg/µl, respectively. The samples were incubated at 37°C for 30 min. Immunoprecipitated DNA (both immunoprecipitation samples and Input) was recovered by phenol/chloroform extraction and ethanol precipitation and analyzed by PCR. Actin, p21WAF1, or bcr-specific primers were used to perform PCR on DNA isolated from ChIP experiments and Input samples. The optimal reaction conditions for PCR were determined for each primer pair. Parameters were denaturation at 95°C for 1 min and annealing at 56°C for 1 min, followed by elongation at 72°C for 1 min. PCR products were analyzed by 2.5% agarose/ethidium bromide gel electrophoresis. The primer pairs used for p21WAF1ChIP analysis were: 5'-GGTGTCTAGGTGCTCCAGGT-3' (dp1) and 5'-TGTCTAGGTGCTCCAG-3' (up1). The primer pairs used for Bcr ChIP analysis were: 5'-GCCGGAGGGGAGCCAAGTGTT-3'(BCRup1), 5'-TCC CGGAAC ATG AGG TAG GTG GTG-3' (BCR up2), 5'-CTC GAG CCC CCG TCC CTG TGC CTT TTG-3' (BCRd1). The ratio between the immunoprecipitated DNA and Input DNA and was calculated for each treatment and primer set. The fold increases after treatment with LAQ824 was calculated from the indicated ratio.
[3H]Acetyl Lysine Labeling of Hsp90 and Its Binding to ATP-Sepharose.
K562 cells were centrifuged (1500 x g) and resuspended in RPMI medium containing 10% FBS, 0.2 mCi/ml [3H]]acetic acid (specific activity: 5 Ci/mM) and/or LAQ824 and incubated for 24 h at 37°C (pH 7.3) with gentle stirring. After this, cells were chilled on ice, centrifuged (500 x g for 5 min), and washed three times in 50 ml of PBS and 10 mM sodium butyrate. Cells were then lysed in TNESV buffer (50 mM Tris, 2 mM EDTA, 100 nM NaCl, 1 nM sodium vanadate, and 1% NP40 at pH 7.5), and total cellular proteins were quantified using the BCA protein assay. Hsp90 was immunoprecipitated from 200 µg of total protein using mouse hsp90 antibody, and immunoprecipitates were run on 10% SDS PAGE gel, fixed, dried, and autoradiographed for 4872 h to detect [3H]]acetyl lysine-labeled hsp90 protein. Alternatively, hsp90 was affinity precipitated from 200 µg of total protein using ATP-Sepharose beads, and ATP bound proteins were eluted using 25 mM HEPES at pH 7.4, 150 mM NaCl, 1 mM NADH, 1 mM NAD, 1 mM ADP, 1 mM AMP, 1 mM DTT, 60 mM MgCl2, and 10 mM ATP at pH 7.4. Eluted proteins were used to immunoprecipitate hsp90 using mouse hsp90 antibody, and the immunoprecipitates were run on 10% SDS PAGE gel, fixed, dried, and exposed to autoradiographed for 4872 h to detect ATP bound [3H]]acetyl lysine-labeled hsp90 protein (35)
.
Preparation of Detergent-soluble and -insoluble Fractions.
After the designated drug treatments, cells were lysed with TNSEV buffer [50 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM sodium orthovanadate, 1% NP40 containing 20 µg/ml aprotonin, 20 µg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride, 25 mM NAF, and 5 mM N-ethylmaleimide; Ref. 40
]. The insoluble fraction (pellet) was solubilized with SDS buffer [80 mM Tris (pH 6.8), 2% SDS, 100 mM DTT, and 10% glycerol]. Fifty µg of proteins from the NP40 soluble and insoluble fractions were separated on 7.5% SDS-polyacrylamide gel and analyzed by Western blotting (40)
.
HDAC Activity Inhibition Assay.
HDAC activity assay was performed using a kit purchased from Biomol Research Labs (Plymouth, MA), as per the manufacturers instructions. HeLa cell nuclear extracts (500 ng) containing HDAC activity were incubated with 50 µM of the Fluar de lys peptide substrate, which contains an acetylated lysine side chain (Biomol Research Labs) and several different concentrations of LAQ824 at room temperature. Reactions were stopped after 20 min with Fluar de lys developer and the fluorescence measured (excitation at 360 nm and emission at 460 nm; Ref. 37
). The percentage decline in the fluorescence of the peptide substrate attributable to LAQ824 treatment was determined. TSA-mediated inhibition of the HDAC activity in the HeLa cell nuclear extract was used as the positive control.
Statistical Analyses.
Data were expressed as mean ± SE. Comparisons used students t test or ANOVA, as appropriate. Ps of <0.05 were assigned significance.
| RESULTS |
|---|
|
|
|---|
25.0 nM (Fig. 1A)
|
|
|
LAQ824-mediated Depletion of the mRNA of bcr-abl Is Dependent on New Protein Synthesis.
Next, we determined whether LAQ824-mediated depletion of Bcr-Abl is because of repression of the bcr-abl mRNA. After treatment with LAQ824 for varying time intervals, the ratios of the mRNA transcripts of bcr-abl and histone H1 genes were determined by the real-time quantitative RT-PCR technique. LAQ824-treated K562 cells displayed a marked decline in the ratios of the mRNA transcripts of bcr-abl to histone H1 in a time-dependent manner for up to 24 h. The ratio declined from 0.49 in the untreated cells to a ratio of 0.24 at 4 h, 0.09 at 8 h, and 0.05 at 24 h of treatment with LAQ824. Northern analysis confirmed that exposure to LAQ824 for 4 h attenuated the bcr-abl message by 50% and exposure for 16 h by 80% in K562 cells (estimated by densitometry with GAPDH mRNA as the loading control; Fig. 3A
). This occurred before an appreciable decline in the Bcr-Abl protein levels (data not shown). We next addressed the possibility that LAQ824-induced acetylation of histones or transcription factors may indirectly, through the induction of another regulatory protein, lead to repression of the bcr-abl message (34)
. Fig. 3B
demonstrates that cotreatment with cycloheximide (100 µg/ml) reversed the LAQ824 (100 nM for 5 h)-mediated decline (estimated by densitometry to be 60% as compared with the untreated cells, with GAPDH message as the loading control) in the bcr-abl mRNA in K562 cells. These results indicate that LAQ824-mediated repression of the bcr-abl message requires new protein synthesis. This supports the interpretation that LAQ824 augments the levels and activity of a transcriptional repressor for bcr-abl, an outcome that is neutralized by cotreatment with cycloheximide. This conclusion was additionally supported by the results of the ChIP analyses performed on the lysates of the untreated or LAQ824-treated K562 and LAMA-84 cells to assess the association of the promoters of the bcr-abl with the acetylated histones. As shown in Fig. 3C
, exposure to 50250 nM of LAQ824 did not affect the bcr-abl promoter associated with acetylated histones H3 and H4 in either cell types. As a control, after exposure to 50250 nM LAQ824 for 24 h,
2.0-fold more p21WAF1 promoter DNA was associated with acetylated histones compared with the same region associated with histones from cells cultured without LAQ824 (data not shown). Previous studies have clearly shown an increase in the association of p21WAF1 promoter DNA with acetylated histones after treatment with SAHA (33)
.
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The mRNA transcript levels of bcr-abl declined markedly after short exposure intervals to LAQ824, as determined by Northern and the real-time RT-PCR analyses. LAQ824-mediated repression of bcr-abl message was similar to what was seen in CML-BC cells after treatment with SAHA (38) . It is noteworthy that treatment with a different hydroxamic acid analogue, i.e., TSA, has been reported to inhibit the mRNA synthesis of another oncogene, erbB2, as detected by a genomically integrated ErbB2 promoter cell screen (51) . Although exposure to TSA had no effect on the open chromatin configuration of this gene, as monitored by DNase I hypersensitivity, TSA selectively destabilized and enhanced the decay of the mature ErbB2 transcripts (51) . In the present studies, the results of the ChIP analyses clearly demonstrated that treatment with LAQ824 did not affect the association of the bcr-abl promoter with the acetylated histones. This raises the possibility that HDIs may repress bcr-abl indirectly through the induction of other regulatory proteins. This is supported by our finding that cotreatment with cycloheximide reversed the LAQ824-mediated repression of the bcr-abl message. In addition to acetylating the core nucleosomal histones, HDIs may induce acetylation and alteration of DNA binding and activity of transcription factors, e.g., p53, E2F, and GATA-1 (31 , 32 , 52 , 53) . Because this was not examined in the present studies, whether LAQ824 treatment induces the activity of a transcriptional repressor of bcr-abl by this mechanism remains to be established. However, the decline in Bcr-Abl levels because of LAQ824 treatment did not appear to be caused by the processing of Bcr-Abl during LAQ824-induced apoptosis. Cotreatment with the multicaspase inhibitor z-VAD-fmk abrogated the PARP cleavage activity of the caspases, without affecting LAQ824-mediated decline in Bcr-Abl levels in CML-BC cells (data not shown).
Although the specific nuclear and/or cytosolic HDAC(s) inhibited by LAQ824, which may be involved in the acetylation of hsp90, were not elucidated, the present studies demonstrate that treatment with LAQ824 increased the acetylation of lysine residues on hsp90. This reduced the binding of hsp90 to ATP, which was associated with the disruption of the chaperone association of hsp90 with Bcr-Abl and c-Raf-1. Another hsp90 inhibitor geldanamycin or its less toxic analogue 17-allylamino-demethoxy geldanamycin has been shown to have similar effects (40 , 54) . Although attenuating the association of Bcr-Abl with the stable multichaperone complex, including hsp90, LAQ824 treatment increased the association of Bcr-Abl with the less stable multichaperone complex with hsp70. This directed the accumulation of Bcr-Abl in the detergent-insoluble cellular fraction promoting its degradation by the proteasome because cotreatment with the proteasome inhibitor PS341 with LAQ824 increased the levels of Bcr-Abl in the detergent-insoluble cellular fraction. A similar outcome was previously reported to occur, after cotreatment of CML-BC cells with 17-allylamino-demethoxy geldanamycin and PS341 (40 , 55) .
Several novel therapeutic agents have shown promising activity against imatinib-refractory CM-BC cells (9) . These agents are either able to target and inhibit the TK activity of the mutant or amplified Bcr-Abl, e.g., PD180970, farnesyl transferase inhibitor, and flavopiridol, and/or abrogate the alternative growth promoting and survival mechanisms, e.g. Lyn or Erk1/2 kinases (55, 56, 57, 58, 59) . As noted above, geldanamycin analogues and arsenic trioxide lower the levels of not only wt but also mutant Bcr-Abl and have been shown to exert antileukemia effects against imatinib-refractory CML-BC cells (42 , 60) . Recent studies from our laboratory have also demonstrated that the HDI SAHA can lower Bcr-Abl levels and induce apoptosis of imatinib-refractory CML-BC cells (38) . Present studies clearly demonstrate that LAQ824 is especially promising because it improves the selective cytotoxic effects of imatinib against CML-BC versus normal CD34+ hemopoietic progenitor cells. LAQ824 is also able to deplete not only wt but also mutant Bcr-Abl levels in imatinib-refractory CML-BC cells at concentrations as low as 100 nM. In addition, the ability of LAQ824 to attenuate c-Raf-1, Src, and AKT levels by promoting their degradation through the proteasome additionally contributes to its activity against imatinib-refractory CML-BC cells. Taken together, these attributes strongly support the in vivo testing of LAQ824 against imatinib-sensitive and -refractory forms of CML-BC.
| FOOTNOTES |
|---|
1 To whom requests for reprints should be addressed, at Moffitt Cancer Center & Research Institute, 12902 Magnolia Drive, MRC 3 East, Room 3056, Tampa, FL 33612. Phone: (813) 903-6861; Fax: (813) 903-6817; E-mail: bhallakn{at}moffitt.usf.edu ![]()
2 The abbreviations used are: CML, chronic myeloid leukemia; BC, blast crisis; TK, tyrosine kinase; PI3K, phosphatidylinositol-3-kinase; HDAC, histone deacetylase; HDI, HDAC inhibitor; hsp, heat shock protein; wt, wild-type; SAHA, suberoylanilide hydroxamic acid; PARP, poly(ADP-ribose) polymerase; PE, phycoerythrin; RT-PCR, reverse transcription-PCR; ChIP, chromatin immunoprecipitation; TSA, trichostatin A; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. ![]()
Received 2/19/03. Revised 5/22/03. Accepted 6/30/03.
| REFERENCES |
|---|
|
|
|---|
B activation and I
B
phosphorylation: relationship with down-regulation of TNF receptors. J. Biol. Chem., 277: 30622-30628, 2002.This article has been cited by other articles:
![]() |
L. Ellis, M. Bots, R. K. Lindemann, J. E. Bolden, A. Newbold, L. A. Cluse, C. L. Scott, A. Strasser, P. Atadja, S. W. Lowe, et al. The histone deacetylase inhibitors LAQ824 and LBH589 do not require death receptor signaling or a functional apoptosome to mediate tumor cell death or therapeutic efficacy Blood, July 9, 2009; 114(2): 380 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Shi, Y. Jin, C. Cheng, H. Zhang, W. Zou, Q. Zheng, Z. Lu, Q. Chen, Y. Lai, and J. Pan Triptolide Inhibits Bcr-Abl Transcription and Induces Apoptosis in STI571-resistant Chronic Myelogenous Leukemia Cells Harboring T315I Mutation Clin. Cancer Res., March 1, 2009; 15(5): 1686 - 1697. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bazzaro, Z. Lin, A. Santillan, M. K. Lee, M.-C. Wang, K. C. Chan, R. E. Bristow, R. Mazitschek, J. Bradner, and R. B.S. Roden Ubiquitin Proteasome System Stress Underlies Synergistic Killing of Ovarian Cancer Cells by Bortezomib and a Novel HDAC6 Inhibitor Clin. Cancer Res., November 15, 2008; 14(22): 7340 - 7347. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fiskus, Y. Wang, R. Joshi, R. Rao, Y. Yang, J. Chen, R. Kolhe, R. Balusu, K. Eaton, P. Lee, et al. Cotreatment with Vorinostat Enhances Activity of MK-0457 (VX-680) against Acute and Chronic Myelogenous Leukemia Cells Clin. Cancer Res., October 1, 2008; 14(19): 6106 - 6115. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fiskus, R. Rao, P. Fernandez, B. Herger, Y. Yang, J. Chen, R. Kolhe, A. Mandawat, Y. Wang, R. Joshi, et al. Molecular and biologic characterization and drug sensitivity of pan-histone deacetylase inhibitor-resistant acute myeloid leukemia cells Blood, October 1, 2008; 112(7): 2896 - 2905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kurokawa, C. Zhao, T. Reya, and S. Kornbluth Inhibition of Apoptosome Formation by Suppression of Hsp90{beta} Phosphorylation in Tyrosine Kinase-Induced Leukemias Mol. Cell. Biol., September 1, 2008; 28(17): 5494 - 5506. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rao, W. Fiskus, Y. Yang, P. Lee, R. Joshi, P. Fernandez, A. Mandawat, P. Atadja, J. E. Bradner, and K. Bhalla HDAC6 inhibition enhances 17-AAG-mediated abrogation of hsp90 chaperone function in human leukemia cells Blood, September 1, 2008; 112(5): 1886 - 1893. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dai, S. Chen, C. A. Venditti, X.-Y. Pei, T. K. Nguyen, P. Dent, and S. Grant Vorinostat synergistically potentiates MK-0457 lethality in chronic myelogenous leukemia cells sensitive and resistant to imatinib mesylate Blood, August 1, 2008; 112(3): 793 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Quintas-Cardama and J. Cortes Therapeutic Options Against BCR-ABL1 T315I-Positive Chronic Myelogenous Leukemia Clin. Cancer Res., July 15, 2008; 14(14): 4392 - 4399. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Wandinger, K. Richter, and J. Buchner The Hsp90 Chaperone Machinery J. Biol. Chem., July 4, 2008; 283(27): 18473 - 18477. [Full Text] [PDF] |
||||
![]() |
W.-Y. Chen, F.-R. Chang, Z.-Y. Huang, J.-H. Chen, Y.-C. Wu, and C.-C. Wu Tubocapsenolide A, a Novel Withanolide, Inhibits Proliferation and Induces Apoptosis in MDA-MB-231 Cells by Thiol Oxidation of Heat Shock Proteins J. Biol. Chem., June 20, 2008; 283(25): 17184 - 17193. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Egler, S. Korur, M. Failly, J.-L. Boulay, R. Imber, M. M. Lino, and A. Merlo Histone Deacetylase Inhibition and Blockade of the Glycolytic Pathway Synergistically Induce Glioblastoma Cell Death Clin. Cancer Res., May 15, 2008; 14(10): 3132 - 3140. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhou, A. T. Agoston, P. Atadja, W. G. Nelson, and N. E. Davidson Inhibition of Histone Deacetylases Promotes Ubiquitin-Dependent Proteasomal Degradation of DNA Methyltransferase 1 in Human Breast Cancer Cells Mol. Cancer Res., May 1, 2008; 6(5): 873 - 883. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Dasmahapatra, N. Yerram, Y. Dai, P. Dent, and S. Grant Synergistic Interactions between Vorinostat and Sorafenib in Chronic Myelogenous Leukemia Cells Involve Mcl-1 and p21CIP1 Down-Regulation Clin. Cancer Res., July 15, 2007; 13(14): 4280 - 4290. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Peng, J. Brain, Y. Hu, A. Goodrich, L. Kong, D. Grayzel, R. Pak, M. Read, and S. Li Inhibition of heat shock protein 90 prolongs survival of mice with BCR-ABL-T315I-induced leukemia and suppresses leukemic stem cells Blood, July 15, 2007; 110(2): 678 - 685. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Nguyen, M. Rahmani, H. Harada, P. Dent, and S. Grant MEK1/2 inhibitors sensitize Bcr/Abl+ human leukemia cells to the dual Abl/Src inhibitor BMS-354/825 Blood, May 1, 2007; 109(9): 4006 - 4015. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D.-A. Tran, T. P. Marmo, A. A. Salam, S. Che, E. Finkelstein, R. Kabarriti, H. S. Xenias, R. Mazitschek, C. Hubbert, Y. Kawaguchi, et al. HDAC6 deacetylation of tubulin modulates dynamics of cellular adhesions J. Cell Sci., April 15, 2007; 120(8): 1469 - 1479. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Soverini, I. Iacobucci, M. Baccarani, and G. Martinelli Targeted therapy and the T315I mutation in Philadelphia-positive leukemias Haematologica, April 1, 2007; 92(4): 437 - 439. [Full Text] [PDF] |
||||
![]() |
D. L. Marrocco, W. D. Tilley, T. Bianco-Miotto, A. Evdokiou, H. I. Scher, R. A. Rifkind, P. A. Marks, V. M. Richon, and L. M. Butler Suberoylanilide hydroxamic acid (vorinostat) represses androgen receptor expression and acts synergistically with an androgen receptor antagonist to inhibit prostate cancer cell proliferation Mol. Cancer Ther., January 1, 2007; 6(1): 51 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fiskus, M. Pranpat, M. Balasis, B. Herger, R. Rao, A. Chinnaiyan, P. Atadja, and K. Bhalla Histone deacetylase inhibitors deplete enhancer of zeste 2 and associated polycomb repressive complex 2 proteins in human acute leukemia cells Mol. Cancer Ther., December 1, 2006; 5(12): 3096 - 3104. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Catley, E. Weisberg, T. Kiziltepe, Y.-T. Tai, T. Hideshima, P. Neri, P. Tassone, P. Atadja, D. Chauhan, N. C. Munshi, et al. Aggresome induction by proteasome inhibitor bortezomib and {alpha}-tubulin hyperacetylation by tubulin deacetylase (TDAC) inhibitor LBH589 are synergistic in myeloma cells Blood, November 15, 2006; 108(10): 3441 - 3449. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fiskus, M. Pranpat, M. Balasis, P. Bali, V. Estrella, S. Kumaraswamy, R. Rao, K. Rocha, B. Herger, F. Lee, et al. Cotreatment with Vorinostat (Suberoylanilide Hydroxamic Acid) Enhances Activity of Dasatinib (BMS-354825) against Imatinib Mesylate-Sensitive or Imatinib Mesylate-Resistant Chronic Myelogenous Leukemia Cells. Clin. Cancer Res., October 1, 2006; 12(19): 5869 - 5878. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baccarani, G. Saglio, J. Goldman, A. Hochhaus, B. Simonsson, F. Appelbaum, J. Apperley, F. Cervantes, J. Cortes, M. Deininger, et al. Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet Blood, September 15, 2006; 108(6): 1809 - 1820. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fiskus, M. Pranpat, P. Bali, M. Balasis, S. Kumaraswamy, S. Boyapalle, K. Rocha, J. Wu, F. Giles, P. W. Manley, et al. Combined effects of novel tyrosine kinase inhibitor AMN107 and histone deacetylase inhibitor LBH589 against Bcr-Abl-expressing human leukemia cells Blood, July 15, 2006; 108(2): 645 - 652. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Quintas-Cardama and J. E. Cortes Chronic Myeloid Leukemia: Diagnosis and Treatment Mayo Clin. Proc., July 1, 2006; 81(7): 973 - 988. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bhalla Overview and Cytoplasmic Targets of HDAC Inhibitors Am. Assoc. Cancer Res. Educ. Book, April 1, 2006; 2006(1): 309 - 312. [Full Text] [PDF] |
||||
![]() |
J. Codony-Servat, M. A. Tapia, M. Bosch, C. Oliva, J. Domingo-Domenech, B. Mellado, M. Rolfe, J. S. Ross, P. Gascon, A. Rovira, et al. Differential cellular and molecular effects of bortezomib, a proteasome inhibitor, in human breast cancer cells. Mol. Cancer Ther., March 1, 2006; 5(3): 665 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cai, Y. Wang, O. G. Ottmann, P. J. Barth, A. Neubauer, and A. Burchert FLT3-ITD-, but not BCR/ABL-transformed cells require concurrent Akt/mTor blockage to undergo apoptosis after histone deacetylase inhibitor treatment Blood, March 1, 2006; 107(5): 2094 - 2097. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Z. Qian, Y. Kato, S. Shabbeer, Y. Wei, H. M.W. Verheul, B. Salumbides, T. Sanni, P. Atadja, and R. Pili Targeting Tumor Angiogenesis with Histone Deacetylase Inhibitors: the Hydroxamic Acid Derivative LBH589 Clin. Cancer Res., January 15, 2006; 12(2): 634 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Rosato, S. C. Maggio, J. A. Almenara, S. G. Payne, P. Atadja, S. Spiegel, P. Dent, and S. Grant The Histone Deacetylase Inhibitor LAQ824 Induces Human Leukemia Cell Death through a Process Involving XIAP Down-Regulation, Oxidative Injury, and the Acid Sphingomyelinase-Dependent Generation of Ceramide Mol. Pharmacol., January 1, 2006; 69(1): 216 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Guo, K. Rocha, P. Bali, M. Pranpat, W. Fiskus, S. Boyapalle, S. Kumaraswamy, M. Balasis, B. Greedy, E. S. M. Armitage, et al. Abrogation of Heat Shock Protein 70 Induction as a Strategy to Increase Antileukemia Activity of Heat Shock Protein 90 Inhibitor 17-Allylamino-Demethoxy Geldanamycin Cancer Res., November 15, 2005; 65(22): 10536 - 10544. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Chung, S. Lee, E. A. Sausville, Q. Ryan, J. E. Karp, I. Gojo, W. G. Telford, M.-J. Lee, H. S. Kong, and J. B. Trepel Histone Deacetylase Inhibitor Pharmacodynamic Analysis by Multiparameter Flow Cytometry Ann. Clin. Lab. Sci., October 1, 2005; 35(4): 397 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Acharya, A. Sparreboom, J. Venitz, and W. D. Figg Rational Development of Histone Deacetylase Inhibitors as Anticancer Agents: A Review Mol. Pharmacol., October 1, 2005; 68(4): 917 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cortes and H. Kantarjian New Targeted Approaches in Chronic Myeloid Leukemia J. Clin. Oncol., September 10, 2005; 23(26): 6316 - 6324. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, S. Meng, H. Wang, P. Bali, W. Bai, B. Li, P. Atadja, K. N. Bhalla, and J. Wu Chemical ablation of androgen receptor in prostate cancer cells by the histone deacetylase inhibitor LAQ824 Mol. Cancer Ther., September 1, 2005; 4(9): 1311 - 1319. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bali, M. Pranpat, R. Swaby, W. Fiskus, H. Yamaguchi, M. Balasis, K. Rocha, H.-G. Wang, V. Richon, and K. Bhalla Activity of Suberoylanilide Hydroxamic Acid Against Human Breast Cancer Cells with Amplification of Her-2 Clin. Cancer Res., September 1, 2005; 11(17): 6382 - 6389. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bali, M. Pranpat, J. Bradner, M. Balasis, W. Fiskus, F. Guo, K. Rocha, S. Kumaraswamy, S. Boyapalle, P. Atadja, et al. Inhibition of Histone Deacetylase 6 Acetylates and Disrupts the Chaperone Function of Heat Shock Protein 90: A NOVEL BASIS FOR ANTILEUKEMIA ACTIVITY OF HISTONE DEACETYLASE INHIBITORS J. Biol. Chem., July 22, 2005; 280(29): 26729 - 26734. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Melnick, K. Adelson, and J. D. Licht The Theoretical Basis of Transcriptional Therapy of Cancer: Can It Be Put Into Practice? J. Clin. Oncol., June 10, 2005; 23(17): 3957 - 3970. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Bhalla Epigenetic and Chromatin Modifiers As Targeted Therapy of Hematologic Malignancies J. Clin. Oncol., June 10, 2005; 23(17): 3971 - 3993. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Drummond, C. Marx, Z. Guo, G. Scott, C. Noble, D. Wang, M. Pallavicini, D. B. Kirpotin, and C. C. Benz Enhanced Pharmacodynamic and Antitumor Properties of a Histone Deacetylase Inhibitor Encapsulated in Liposomes or ErbB2-Targeted Immunoliposomes Clin. Cancer Res., May 1, 2005; 11(9): 3392 - 3401. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rahmani, E. Reese, Y. Dai, C. Bauer, L. B. Kramer, M. Huang, R. Jove, P. Dent, and S. Grant Cotreatment with Suberanoylanilide Hydroxamic Acid and 17-Allylamino 17-demethoxygeldanamycin Synergistically Induces Apoptosis in Bcr-Abl+ Cells Sensitive and Resistant to STI571 (Imatinib Mesylate) in Association with Down-Regulation of Bcr-Abl, Abrogation of Signal Transducer and Activator of Transcription 5 Activity, and Bax Conformational Change Mol. Pharmacol., April 1, 2005; 67(4): 1166 - 1176. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Deininger, E. Buchdunger, and B. J. Druker The development of imatinib as a therapeutic agent for chronic myeloid leukemia Blood, April 1, 2005; 105(7): 2640 - 2653. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. George, P. Bali, S. Annavarapu, A. Scuto, W. Fiskus, F. Guo, C. Sigua, G. Sondarva, L. Moscinski, P. Atadja, et al. Combination of the histone deacetylase inhibitor LBH589 and the hsp90 inhibitor 17-AAG is highly active against human CML-BC cells and AML cells with activating mutation of FLT-3 Blood, February 15, 2005; 105(4): 1768 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Guo, C. Sigua, P. Bali, P. George, W. Fiskus, A. Scuto, S. Annavarapu, A. Mouttaki, G. Sondarva, S. Wei, et al. Mechanistic role of heat shock protein 70 in Bcr-Abl-mediated resistance to apoptosis in human acute leukemia cells Blood, February 1, 2005; 105(3): 1246 - 1255. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Z. Qian, X. Wang, S. K. Kachhap, Y. Kato, Y. Wei, L. Zhang, P. Atadja, and R. Pili The Histone Deacetylase Inhibitor NVP-LAQ824 Inhibits Angiogenesis and Has a Greater Antitumor Effect in Combination with the Vascular Endothelial Growth Factor Receptor Tyrosine Kinase Inhibitor PTK787/ZK222584 Cancer Res., September 15, 2004; 64(18): 6626 - 6634. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dai, M. Rahmani, S. J. Corey, P. Dent, and S. Grant A Bcr/Abl-independent, Lyn-dependent Form of Imatinib Mesylate (STI-571) Resistance Is Associated with Altered Expression of Bcl-2 J. Biol. Chem., August 13, 2004; 279(33): 34227 - 34239. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bali, P. George, P. Cohen, J. Tao, F. Guo, C. Sigua, A. Vishvanath, A. Scuto, S. Annavarapu, W. Fiskus, et al. Superior Activity of the Combination of Histone Deacetylase Inhibitor LAQ824 and the FLT-3 Kinase Inhibitor PKC412 against Human Acute Myelogenous Leukemia Cells with Mutant FLT-3 Clin. Cancer Res., August 1, 2004; 10(15): 4991 - 4997. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dai, M. Rahmani, X.-Y. Pei, P. Dent, and S. Grant Bortezomib and flavopiridol interact synergistically to induce apoptosis in chronic myeloid leukemia cells resistant to imatinib mesylate through both Bcr/Abl-dependent and -independent mechanisms Blood, July 15, 2004; 104(2): 509 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Y. Pei, Y. Dai, and S. Grant Synergistic Induction of Oxidative Injury and Apoptosis in Human Multiple Myeloma Cells by the Proteasome Inhibitor Bortezomib and Histone Deacetylase Inhibitors Clin. Cancer Res., June 1, 2004; 10(11): 3839 - 3852. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. George, P. Bali, P. Cohen, J. Tao, F. Guo, C. Sigua, A. Vishvanath, W. Fiskus, A. Scuto, S. Annavarapu, et al. Cotreatment with 17-Allylamino-Demethoxygeldanamycin and FLT-3 Kinase Inhibitor PKC412 Is Highly Effective against Human Acute Myelogenous Leukemia Cells with Mutant FLT-3 Cancer Res., May 15, 2004; 64(10): 3645 - 3652. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Guo, C. Sigua, J. Tao, P. Bali, P. George, Y. Li, S. Wittmann, L. Moscinski, P. Atadja, and K. Bhalla Cotreatment with Histone Deacetylase Inhibitor LAQ824 Enhances Apo-2L/Tumor Necrosis Factor-Related Apoptosis Inducing Ligand-Induced Death Inducing Signaling Complex Activity and Apoptosis of Human Acute Leukemia Cells Cancer Res., April 1, 2004; 64(7): 2580 - 2589. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rahmani, C. Yu, Y. Dai, E. Reese, W. Ahmed, P. Dent, and S. Grant Coadministration of the Heat Shock Protein 90 Antagonist 17-Allylamino- 17-demethoxygeldanamycin with Suberoylanilide Hydroxamic Acid or Sodium Butyrate Synergistically Induces Apoptosis in Human Leukemia Cells Cancer Res., December 1, 2003; 63(23): 8420 - 8427. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |