Cancer Research Cancer Medicine 8  2010 Workshops
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nimmanapalli, R.
Right arrow Articles by Bhalla, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nimmanapalli, R.
Right arrow Articles by Bhalla, K.
[Cancer Research 63, 5126-5135, August 15, 2003]
© 2003 American Association for Cancer Research


Regular Articles

Histone Deacetylase Inhibitor LAQ824 Both Lowers Expression and Promotes Proteasomal Degradation of Bcr-Abl and Induces Apoptosis of Imatinib Mesylate-sensitive or -refractory Chronic Myelogenous Leukemia-Blast Crisis Cells

Ramadevi Nimmanapalli, Lianne Fuino, Purva Bali, Maura Gasparetto, Michele Glozak, Jianguo Tao, Lynn Moscinski, Clayton Smith, Jie Wu, Richard Jove, Peter Atadja and Kapil Bhalla1

Department of Interdisciplinary Oncology, Moffitt Cancer Center and Research Institute University of South Florida [R. N., L. F., P. B., M. G., J. T., L. M., C. S., J. W., R. J., K. B.], Tampa, Florida 33614, and Novartis Pharmaceutical, Inc. (P. A.), Summit, New Jersey


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Treatment with LAQ824 (Novartis Pharmaceutical, Inc.), a cinnamyl hydroxamic acid analogue inhibitor of histone deacetylases, depleted the mRNA and protein expression of Bcr-Abl in human chronic myeloid leukemia blast crisis (CML-BC) cells. Exposure to LAQ824 induced the expression of the cell cycle-dependent kinase inhibitors p21 and p27 and caused cell cycle G1-phase accumulation and apoptosis of CML-BC cells. LAQ824 also induced acetylation of heat shock protein 90. This inhibited the chaperone association of Bcr-Abl with heat shock protein 90, thereby promoting the proteasomal degradation of Bcr-Abl. Cotreatment with LAQ824 increased imatinib mesylate-induced apoptosis of CML-BC cells. Additionally, LAQ824 down-regulated the levels of mutant Bcr-Abl possessing the T315I point mutation, as well as induced apoptosis of imatinib-refractory primary CML-BC cells. Therefore, LAQ824 may be a promising therapeutic agent in the treatment of imatinib-sensitive or -refractory human leukemia.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The reciprocal chromosomal translocation t (9;22)(q34;q11) creates the Philadelphia chromosome and the bcr-abl fusion gene, which is the molecular, hallmark of 95% of CML2 (1 , 2) . The dysregulated activity of the TK encoded by the bcr-abl importantly contributes toward the malignant phenotype of Bcr-Abl-expressing leukemia cells in the chronic and advanced blastic phases of CML (1 , 2) . For example, Bcr-Abl TK activates the PI3K/AKT kinase pathway resulting in the increased expression of cyclin D2 (3 , 4) , as well as the phosphorylation, proteasomal degradation, and decreased levels of the cyclin-dependent kinase 2 inhibitor p27, thus promoting cell cycle progression and cell proliferation (5 , 6) . Also, Bcr-Abl-expressing leukemia blasts of CML-BC display differentiation arrest and resistance to apoptosis, even after exposure to high doses of antileukemia drugs (7 , 8) . Intracellularly, Bcr-Abl activates several diverse molecular mechanisms known to inhibit apoptosis, which contribute toward the drug resistance of the leukemia cells (1 , 2 , 9) . These include increased phosphorylation and transactivation by signal transducers and activators of transcription 5, which leads to increased expression of the antiapoptotic Bcl-xL protein (10, 11, 12) . Bcr-Abl TK also activates PI3K/Akt kinase and nuclear factor-{kappa}B signaling, which activate several antiapoptotic mechanisms (13, 14, 15, 16) .

Because of the proliferation and survival advantage conferred by Bcr-Abl, depleting its levels or activity has emerged as a rational strategy to treat the chronic and advanced phases of CML (9 , 17 , 18) . STI-571, now known as Gleevec (imatinib mesylate), is a phenylaminopyrimidine derivative and a relatively specific ATP binding site antagonist of Bcr-Abl TK (19) . At relatively low and clinically achievable concentrations (~0.25 µM), imatinib selectively causes in vitro and in vivo growth arrest and apoptosis of Bcr-Abl-positive leukemia but not of normal hematopoietic progenitor cells (20, 21, 22, 23) . Imatinib has demonstrated an impressive clinical activity in the chronic phase of CML, with ~95% of patients achieving durable complete clinical remissions (24) . However, ~50% of patients with the chronic phase fail to achieve a cytogenetic complete response after imatinib therapy (24 , 25) . In the accelerated phase of CML and CML-BC after treatment with imatinib, the complete clinical and cytogenetic remission rates are even lower, with most patients suffering relapse and succumbing to imatinib-refractory CML-BC (24 , 26 , 27) . The mechanisms of resistance to imatinib identified in CML-BC cells include mutations in the kinase domain of bcr-Abl and amplification of the bcr-abl gene, resulting in the overexpression of Bcr-Abl (28 , 29) . Importantly, ectopic expression of the mutant Bcr-Abl was shown to transform murine hematopoietic cells and confer resistance against imatinib (28 , 30) . Recently, in 29 of 32 patients, whose disease relapsed after an initial response to imatinib, 15 different amino acid substitutions affecting 13 residues were identified as mutations in the Bcr-Abl kinase domain (30) . Two groups of mutations were noted. These included those that altered amino acids that directly contact imatinib (e.g., T315I) or those that prevented Bcr-Abl from achieving the inactive conformational state required for binding to imatinib (e.g., E255K). These mutations conferred varying degrees of resistance to imatinib in the leukemia cells. These observations emphasize the need to develop and test novel anti-Bcr-Abl agents, which have mechanisms of antileukemia activity distinct from those described for imatinib. Especially attractive would be those agents that not only enhance the antileukemia effects of imatinib but also exert cytotoxic effects against imatinib-refractory CML-BC (9) .

Histone acetyltransferases and HDACs are able to regulate gene expression patterns through recruitment to target genes in association with specific transcription factors (31) . HDACs catalyze deacetylation of lysine residues in the NH2-terminal tails of the core nucleosomal histones, resulting in chromatin condensation and transcriptional regulation of cell cycle- and differentiation-regulatory genes (32) . Consequently, treatment with HDIs cause hyperacetylation of the NH2-terminal lysine residues of the nucleosomal histones, which transcriptionally up-regulates p21WAF1 expression and induces cell cycle arrest and apoptosis of cancer and leukemia cells (33 , 34) . Recently, a natural product HDI, depsipeptide (FK228), was also shown to cause acetylation of the hsp90. This was shown to destabilize the stable chaperone complex of hsp90 with its client proteins, thereby promoting their degradation by the proteasome. These client proteins include ErbB2, Raf-1, and mutant p53 (35) . A different class of HDIs, the hydroxamic acid analogues, e.g., TSA and SAHA, have also been demonstrated to exert potent in vitro and in vivo antileukemia effects (36, 37, 38) . Recently, a cinnamic acid hydroxamate, LAQ824, has been shown to act as a potent HDI at submicromolar levels (39) . In the present studies, we determined the effects of LAQ824 treatment on the mRNA and protein expression of bcr-abl. We also determined the effects of LAQ824 on the cell cycle status and apoptosis of the cultured and primary CML-BC cells. Whether treatment with LAQ824 would deplete the mutant Bcr-Abl and induce apoptosis of imatinib-refractory human CML-BC cells was also probed in the present studies. Finally, because it had been previously reported that Bcr-Abl is a client protein for hsp90 (40) , we determined whether LAQ824 treatment would induce acetylation of hsp90 and whether this would disrupt the chaperone association of Bcr-Abl to hsp90, leading to the proteasomal degradation and depletion of Bcr-Abl.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents.
LAQ824 and imatinib were kindly provided by Novartis Pharmaceuticals, Inc. (East Hanover, NJ). The pyrido[2,3-d] pyrimidine derivative PD180970 was synthesized by Parke-Davis Pharmaceuticals and was kindly provided by Dr. Alan Kraker (41) . PD180970 was diluted in DMSO. Anti-Bcl-xL was purchased from PharMingen, Inc. (San Diego, CA), anti-Abl antibody from Santa Cruz Biotechnology (Santa Cruz Biotechnology, CA) Anti-Hsp70 and anti-Hsp90 antibodies were purchased from StressGen Biotechnologies Corp. (Victoria, British Columbia, Canada). Polyclonal anti-PARP antibody was purchased from Cell Signaling (Beverly, MA). The antibodies for the immunoblot analyses to detect the levels of proteins, including Bcl-xL, phospho-AKT, AKT, p21, and p27 were obtained, as described previously (38 , 40 , 42) .

Primary and Cultured CML-BC Cells.
CML-BC K562 and LAMA-84 cells were cultured as described previously (42) . The primary CML-BC cells were procured from the peripheral blood and/or bone marrow of 5 patients who had CML-BC. Of these, 3 patients showed clear evidence of disease progression in the bone marrow and/or peripheral blood while receiving imatinib at a dose of 600 mg/day. Two additional samples were purified from the peripheral blood and/or bone marrow obtained from imatinib-naïve patients. All samples were obtained with informed consent as part of a clinical protocol approved by the Institutional Review Board. Bone marrow aspirate or the peripheral blood sample was obtained in heparinized tubes, and mononuclear cells (BMMCs) were isolated by centrifugation through Ficoll-Hypaque (Amersham Pharmacia Biotech) and washed with RPMI 1640. To isolate CD34+ leukemic blasts from BMMCs, the cells were coated with anti-CD34-PE conjugated antibody (PharMingen, Inc.) and anti-PE microbeads (Miltenyi Biotech). The CD34+ cells were then isolated using magnetic cell sorting with LS+ columns and Variomax magnets (Miltenyi Biotech). The magnetic cell sorting-selected cells were analyzed by flow cytometry before and after sorting to determine the percentage of CD34+ cells, which was routinely >=95% using this technique.

Isolation of CD34+ Cells.
CD34+ hematopoietic progenitors were isolated from the marrow of healthy donors after obtaining Institutional Review Board informed consent. Mononuclear cells were prepared using Ficoll-Hypaque and then CD34+ cells isolated to >98% purity using fluorescence activated cell sorting. This was accomplished using a FACSVantage equipped with a TurboSort option (Becton Dickinson Immunocytometry Systems, San Jose, CA). Recoveries of 50–70% and routine purities of >98% were obtained (43) . For CD34 analysis and sorting, cells were stained with directly conjugated fluorescent anti-CD34 antibody (clone 8G12, i.e., HPCA-2; Becton Dickinson Immunocytometry Systems). Dead and dying cells were excluded on the basis of 7-amino-actinomycin D staining as described previously (43) . Fluorochrome-conjugated anti-CD34 was excited at 488 nm, and fluorescence emission was detected using standard filters. CellQuest (Becton Dickinson Immunocytometry Systems) and FlowJo (TreeStar, Inc., Palo Alto, CA) software were used for data acquisition and storage.

Cells and Transfection of the bcr-abl Gene.
Human acute myelogenous leukemia HL-60/Bcr-Abl (p210) wt and HL-60/Bcr-Abl (p210) T315I cells were created by transfection of the bcr-abl gene encoding the wt p210 Bcr-Abl or the mutant bcr-abl gene encoding the Bcr-Abl (p210) T315I mutant protein, as described previously (28 , 30 , 44) . The bcr-abl cDNA was a kind gift of Dr. Thomas Skorski (Temple University, Philadelphia, PA). wt bcr-abl was cloned into the BamHI site of the plasmid vector pSTAR (44) . The p210 bcr-abl (T315I) mutant construct was created from the wt bcr-abl by site-directed mutagenesis, using Quick-change XL mutagenesis kit (Clontech, Palo Alto, CA). The resulting pSTAR bcr-Abl (wt) and p210 bcr-abl (T315I) plasmid vectors were stably transfected into HL-60 cells (44) . Stable clones were selected, subcloned by limiting dilution method, and maintained, as described previously (44) . Logarithmically growing cells were used for the studies described below.

Flow Cytometric Analysis of Cell Cycle Status and Apoptosis.
The flow cytometric evaluation of the cell cycle status and apoptosis was performed according to a previously described method (22) . The percentage of cells in the G1, S, and G2-M phases were calculated using Multicycle software (Phoenix Flow Systems, San Diego, CA).

Apoptosis Assessment by Annexin V Staining.
After drug treatments, cells were resuspended in 100 µl of the staining solution containing annexin V fluorescein and propidium iodide in a HEPES buffer (Annexin V-FLUOS Staining Kit; Boehringer-Mannheim and Indianapolis, IN). After incubation at room temperature for 15 min, annexin V-positive cells were estimated by flow cytometry, as described previously (42) .

Morphological Assessment of Apoptosis.
After drug treatment, 50 x 103 cells were washed and resuspended in PBS (pH 7.3). Cytospun preparations of the cell suspensions were fixed and stained with Wright stain. Cell morphology was determined by light microscopy. In all, five different fields were randomly selected for counting of at least 500 cells. The percentage of apoptotic cells was calculated for each experiment, as described previously (22 , 42) .

Western Blot Analyses.
Western analyses of Bcr-Abl, Bcl-xL, p-AKT, p21, p27, and acetylated histone H3 and H4 proteins and ß-actin were performed using specific antisera or monoclonal antibodies (see above), as described previously (22 , 42) . Horizontal scanning densitometry was performed on Western blots by using acquisition into Adobe PhotoShop (Adobe Systems, Inc., San Jose, CA) and analysis by the NIH Image Program (NIH, Bethesda, MD). The expression of ß-actin was used as a control.

Autophosphorylation of Bcr-Abl.
Cells were lysed in the lysis buffer [1% Triton X-100, 0.5% deoxycholate, 150 mM NaCl, 2.0 mM EDTA, 1.0 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 1 µg/ml Pepstin-A, 2 µg/ml Aprotinin, 25 mM NaF, 1.0 mM 4-(2-aminoethyl) benzenesulfonylfluoride hydrochloride, 20 mM P-nitrophenyl phosphate, 0.5 mM sodium orthovanadate for 30 min, and the nuclear and cellular debris cleared by centrifugation]. Protein G-agarose beads were washed twice in lysis buffer then incubated with anti-Abl monoclonal antibody [1 in 100 dilution (Santa Cruz Biotechnology] at 4°C for 2 h. After washing the protein G beads and the antibody mix with the lysis buffer, 100 µg of total cell lysates were added and incubated overnight at 4°C. The immunoprecipitates were washed three times in lysis buffer, and proteins were eluted with the SDS sample loading buffer. Proteins were separated by SDS-PAGE as described previously (22) . Immunoprecipitates were examined by Western blot analysis after transfer of proteins to nitrocellulose membranes (22 , 42) . Western blot analyses were performed with antiphospho tyrosine antibody (PharMingen, Inc.) and anti-Abl antibody to control for equal loading (42) .

Real-Time Quantitative RT-PCR.
Total RNA was isolated from cells using an RNeasy kit (Qiagen, Inc., Valencia, CA) according to the manufacturer’s instructions. Two µl of total RNA (0.1 µg) were added to 23 µl of a reaction mix (Taqman RT-PCR reagent kit; Perkin-Elmer, Boston, MA), consisting of 19.7 µl of H2O, 0.15 µl of enzyme mix, 0.5 µl of the forward B2A2-primer, 0.5 µl of reverse B2A2-primer, 1.0 µl of bcr-abl gene-specific oligonucleotide probe, 0.5 µl of histone H1 forward primer, 0.5 µl of histone H1 reverse primer, and 0.5 µl of histone-specific oligonucleotide probe were placed in a 96-well plate. The plate was transferred to an ABI 7700 thermocycler (Perkin-Elmer), and samples were passed through 48°C, 30 min and 95°C, 10 min; these were followed by 35 amplification cycles (95°C, 15 s, 60°C, 1 min), during which fluorescent signals of bcr-abl and histone H1 probes were measured as described previously (45) . Serial dilutions of 106-101 of bcr-abl plasmid DNA and histone plasmid DNA were used as a reference standard of fluorescent signals for copy number as described previously (45) . Histone H1 primers (forward primer, 5'-GCGAGAAATTGCTCAGGACTTTA-3'; reverse primer, 5'-GTGTCTTCAAAAAGGCCAACCA-3') and a probe (5'-CCTCACTTGCCTCCTGCAAAGCACC-3') were used in the reaction. p210 Bcr-Abl (e2a2) forward primer, 5'-TCCACTCAGCCACTGGATTTAA-3'; reverse primer, 5'-TGAGGCTCAAAGTCAGATGCTACT-3', and a probe CAGAGTTCAAAAGCCCTTCAGCGGC. p185 Bcr-Abl (e1a2) forward primer, 5'-TGTGAAACTCCAGACTGTCCACA-3'; reverse primer, 5'-AAAGTCAGATGCTACTGGCCG-3'; and probe, 5'-TGACCATCAATAAGGAAGAAGCCCCTTCAGC-3'. All of the probes carried a 5'-FAM reporter label and a 3'-TAMRA quencher group. All primers and probes were synthesized by PE-Applied Biosystems (Perkin-Elmer).

Northern Blot Analysis.
Northern blot analysis of bcr-abl mRNA was performed, using a previously reported method (38) . Total RNA was extracted from treated and untreated cells using RNeasy mini kit (Qiagen, Inc.). Total RNA (20 µg) was separated on 1% agarose gel containing formaldehyde (0.22 M) and transferred overnight to an uncharged nylon membrane by capillary transfer in 10x SSC. Membranes were treated with an UV cross-linker (Stratagene) and subsequently probed with 32P-{alpha} [dCTP]-radiolabeled probe. A 413-bp fragment from the joining regions of bcr-abl generated by PCR using primers Bcr-b1 (forward) GAAGTGTTTCAGAAGCTTCTCC and ABL-A3 (reverse) GTTTGGGCTTCACACCATTCC was used as template for generating bcr-abl probe.

ChIP Assay.
ChIP analysis was performed by a slight modification of a previously described method (33) . Cells were incubated overnight at a density of 0.25 x 106 cells/ml at 37°C with 5% CO2. Next day, cells were cultured with 0, 50, 100, or 250 nM LAQ 824 for 24 h. Formaldehyde was then added to the cells to a final concentration of 1%, and the cells were gently shaken at room temperature for 10 min. After this, the cells were pelleted, suspended in 1 ml of ice-cold PBS containing protease inhibitors (Complete; Boehringer Mannheim). Cells were again pelleted, resuspended in 0.5 ml of SDS lysis buffer [1% SDS, 1.0 mM EDTA, and 50 mM Tris·HCl (pH 8.1)], and incubated on ice for 20 min. Lysates were sonicated with 15-s bursts. Debris was removed from samples by centrifugation for 20 min at 15,000 x g at 4°C. An aliquot of the chromatin preparation (100 µl) was set aside and designated as Input Fraction. The supernatants were diluted 3-fold in the immunoprecipitation buffer [0.01% SDS, 1.0% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris·HCl (pH 8.1), and 150 mM NaCl], and 80 µl of 50% protein A-Sepharose slurry containing 20-µg sonicated salmon sperm DNA and 1 mg/ml BSA in the TE buffer [10 mM Tris·HCl (pH 8.0) and 1 mM EDTA] were added and incubated by rocking for 2 h at 4°C. Beads were pelleted by centrifugation, and supernatants were placed in fresh tubes with 5 µg of the antiacetylated histone H3 antibody, antiacetylated histone H4 antibody, or normal rabbit serum and incubated overnight at 4°C. Protein A-Sepharose slurry (60 µl) was added, and the samples were rocked for 1 h at 4°C. Protein A complexes were centrifuged and washed three times for 5 min each with immunoprecipitation buffer and twice for 5 min each with immunoprecipitation buffer containing 500 mM NaCl. Immune complexes were eluted twice with 250 µl of elution buffer (1% SDS, 0.1 M NaHCO3) for 15 min at room temperature. Twenty µl of 5 M NaCl were added to the combined eluates, and the samples were incubated at 65°C for 24 h. EDTA, Tris·HCl (pH 6.5), and proteinase K were then added to the samples at a final concentration of 10 mM, 40 mM, and 0.04 µg/µl, respectively. The samples were incubated at 37°C for 30 min. Immunoprecipitated DNA (both immunoprecipitation samples and Input) was recovered by phenol/chloroform extraction and ethanol precipitation and analyzed by PCR. Actin, p21WAF1, or bcr-specific primers were used to perform PCR on DNA isolated from ChIP experiments and Input samples. The optimal reaction conditions for PCR were determined for each primer pair. Parameters were denaturation at 95°C for 1 min and annealing at 56°C for 1 min, followed by elongation at 72°C for 1 min. PCR products were analyzed by 2.5% agarose/ethidium bromide gel electrophoresis. The primer pairs used for p21WAF1ChIP analysis were: 5'-GGTGTCTAGGTGCTCCAGGT-3' (dp1) and 5'-TGTCTAGGTGCTCCAG-3' (up1). The primer pairs used for Bcr ChIP analysis were: 5'-GCCGGAGGGGAGCCAAGTGTT-3'(BCRup1), 5'-TCC CGGAAC ATG AGG TAG GTG GTG-3' (BCR up2), 5'-CTC GAG CCC CCG TCC CTG TGC CTT TTG-3' (BCRd1). The ratio between the immunoprecipitated DNA and Input DNA and was calculated for each treatment and primer set. The fold increases after treatment with LAQ824 was calculated from the indicated ratio.

[3H]Acetyl Lysine Labeling of Hsp90 and Its Binding to ATP-Sepharose.
K562 cells were centrifuged (1500 x g) and resuspended in RPMI medium containing 10% FBS, 0.2 mCi/ml [3H]]acetic acid (specific activity: 5 Ci/mM) and/or LAQ824 and incubated for 24 h at 37°C (pH 7.3) with gentle stirring. After this, cells were chilled on ice, centrifuged (500 x g for 5 min), and washed three times in 50 ml of PBS and 10 mM sodium butyrate. Cells were then lysed in TNESV buffer (50 mM Tris, 2 mM EDTA, 100 nM NaCl, 1 nM sodium vanadate, and 1% NP40 at pH 7.5), and total cellular proteins were quantified using the BCA protein assay. Hsp90 was immunoprecipitated from 200 µg of total protein using mouse hsp90 antibody, and immunoprecipitates were run on 10% SDS PAGE gel, fixed, dried, and autoradiographed for 48–72 h to detect [3H]]acetyl lysine-labeled hsp90 protein. Alternatively, hsp90 was affinity precipitated from 200 µg of total protein using ATP-Sepharose beads, and ATP bound proteins were eluted using 25 mM HEPES at pH 7.4, 150 mM NaCl, 1 mM NADH, 1 mM NAD, 1 mM ADP, 1 mM AMP, 1 mM DTT, 60 mM MgCl2, and 10 mM ATP at pH 7.4. Eluted proteins were used to immunoprecipitate hsp90 using mouse hsp90 antibody, and the immunoprecipitates were run on 10% SDS PAGE gel, fixed, dried, and exposed to autoradiographed for 48–72 h to detect ATP bound [3H]]acetyl lysine-labeled hsp90 protein (35) .

Preparation of Detergent-soluble and -insoluble Fractions.
After the designated drug treatments, cells were lysed with TNSEV buffer [50 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM sodium orthovanadate, 1% NP40 containing 20 µg/ml aprotonin, 20 µg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride, 25 mM NAF, and 5 mM N-ethylmaleimide; Ref. 40 ]. The insoluble fraction (pellet) was solubilized with SDS buffer [80 mM Tris (pH 6.8), 2% SDS, 100 mM DTT, and 10% glycerol]. Fifty µg of proteins from the NP40 soluble and insoluble fractions were separated on 7.5% SDS-polyacrylamide gel and analyzed by Western blotting (40) .

HDAC Activity Inhibition Assay.
HDAC activity assay was performed using a kit purchased from Biomol Research Labs (Plymouth, MA), as per the manufacturer’s instructions. HeLa cell nuclear extracts (500 ng) containing HDAC activity were incubated with 50 µM of the Fluar de lys peptide substrate, which contains an acetylated lysine side chain (Biomol Research Labs) and several different concentrations of LAQ824 at room temperature. Reactions were stopped after 20 min with Fluar de lys developer and the fluorescence measured (excitation at 360 nm and emission at 460 nm; Ref. 37 ). The percentage decline in the fluorescence of the peptide substrate attributable to LAQ824 treatment was determined. TSA-mediated inhibition of the HDAC activity in the HeLa cell nuclear extract was used as the positive control.

Statistical Analyses.
Data were expressed as mean ± SE. Comparisons used student’s t test or ANOVA, as appropriate. Ps of <0.05 were assigned significance.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
LAQ824 Treatment Induces p21 and p27 but Depletes Bcr-Abl Levels, as well as Causes Cell Cycle G1-phase Arrest and Apoptosis of CML Cells.
We first determined the effects of LAQ824 treatment on the in vitro HDAC activity in the HeLa cell nuclear extracts. Exposure to LAQ824 (5–250 nM) resulted in inhibition of HDAC activity in a dose-dependent manner. The IC50 of LAQ824 for this activity was ~25.0 nM (Fig. 1A)Citation . We next determined the effect of LAQ824 on histone acetylation, Bcr-Abl, p21, and p27 levels, as well as on growth arrest and apoptosis of Bcr-Abl expressing human CML-BC cells. Treatment with 100 nM LAQ824 for 24 h increased the acetylation of histone H3 in K562 and LAMA-84 cells (Fig. 1B)Citation . If controlled for the total amount of histone H3, treatment with 250 nM LAQ824 further slightly increased the acetylation of histone H3 in K562 and LAMA-84 cells (Fig. 1B)Citation . After exposure to LAQ824, a similar increase in the histone H4 acetylation was also observed (data not shown). LAQ824-mediated histone hyperacetylation was associated with induction of p21 and p27 expression in LAMA-84 but only p27 in K562 cells (Fig. 1C)Citation . These results are consistent with the previous studies that SAHA induces hyperacetylation of nucleosomal histones associated with p21 but not p27 gene promoter, thereby transcriptionally up-regulating p21 but increasing p27 levels by alternative nontranscriptional mechanism (33) . Up-regulation of the expression of p27 by LAQ824 or SAHA may be attributable to the modulation of the expression and/or TK activity of Bcr-Abl in K562 and LAMA-84 cells because Griffin et al. (5 , 38) have demonstrated that Bcr-Abl down-regulates p27 levels through the activity of PI3K/AKT. Despite acetylation of the nucleosomal histones by LAQ824, p21 remained repressed in K562 cells, as was also observed after treatment with SAHA (38) . The effect of LAQ824 on the cell cycle status of K562 cells is shown in Table 1Citation . The results show that exposure to 100 nM LAQ824 for 24 h markedly increased the percentage of K562 cells in the G1 phase of the cell cycle: a change from 42.3% in the untreated cells to 96.8% in the cells treated with 100 nM LAQ824. Exposure to higher concentrations of LAQ824 (250 nM) only marginally increased the percentage of G1-phase cells to 98.0%. The cell cycle G1-phase accumulation was also seen, but to a lesser extent, after exposure to 0.25 or 0.50 µM of imatinib or with 0.1 or 0.25 µM of the dual Src/Bcr-Abl TK inhibitor PD180970 (9 , 42) . Similar effects were observed in LAMA-84 cells (data not shown). Importantly, treatment with 100 or 250 nM of LAQ824 for 24 h markedly depleted Bcr-Abl levels in K562 and LAMA-84 cells (Fig. 1D)Citation . This was associated with down-regulation of Bcl-xL and p-AKT levels and induction of PARP cleavage activity of caspase-3 (Fig. 1D)Citation . Exposure of K562 and LAMA-84 cells to LAQ824 also induced a dose-dependent increase in the percentage of apoptotic cell, as detected by positive staining for annexin V (Fig. 2A)Citation . This was also confirmed by morphological assessment of apoptosis (data not shown).



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. LAQ824 inhibits HDAC activity and induces p21 and p27 but depletes Bcr-Abl expression in K562 and LAMA-84 cells. A, HeLa cell nuclear extracts plus HDAC-fluorescinated substrate were treated with the indicated concentrations of LAQ824 and percentage of inhibition of HDAC activity was determined and represented as a bar graph. Cells were treated with the indicated concentrations of LAQ824 for 24 h. After this, Western blot analyses of acetylated histone H3 and histone H3 (B), p21 and p27 (C), as well as of Bcr-Abl, Bcl-xL, phospho (p)-AKT, and PARP or its cleaved fragment were performed, using the cell lysates from K562 and LAMA-84 cells (D). The levels of ß-actin served as the loading control.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Effect of LAQ824 and/or imatinib or PD180970 on cell cycle status of K562 cellsa

 


View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. LAQ824 induces apoptosis of the wt p210Bcr-Abl or its mutant T315I p210 Bcr-Abl-expressing leukemia cells. A, K562 and LAMA-84 cells were treated with the indicated concentration of LAQ824 for 48 h. After this, the percentage of annexin V-stained apoptotic cells were determined by flow cytometry. Values (mean ± SE) are represented by the bar graphs. B and C, HL-60 cells with a stable ectopic expression of the wt p210Bcr-Abl (HL-60/p210 wt) or mutant T315I p210 Bcr-Abl (HL-60/p210 T-I) were exposed to the indicated concentrations of LAQ824 (B) or imatinib mesylate (Gleevec; C). After this, the percentage of annexin V-stained apoptotic cells were determined by flow cytometry. Values (mean ± SE) are represented by the bar graphs. D and E, HL-60/p210 wt or HL-60/p210 T-I cells were exposed to the indicated concentrations of LAQ824 for 24 h. After this, Western blot analyses of Bcr-Abl and PARP or its cleaved fragment were performed, using the cell lysates from the cells. The levels of ß-actin served as the loading control.

 
LAQ824 Depletes wt and Mutant Bcr-Abl and Induces Apoptosis of Imatinib Refractory CML Cells.
Next, we investigated whether treatment with LAQ824 would also down-regulate the levels of the Bcr-Abl that contained the kinase domain point mutation, T315I, which has been shown to confer imatinib resistance in CML-BC cells (28) . This mutation contains the single nucleotide C to T change that results in a threonine to isoleucine substitution at position 315 of Bcr-Abl. We engineered a T315I mutation into the wt p210 bcr-abl and transfected the wt and the mutant construct into the human acute myelogenous leukemia HL-60 cells through the pSTAR expression vector (44) . Subclones of the cells were isolated that demonstrated expression of either the wt (HL-60/p210 wt) or T315I mutation-containing Bcr-Abl (HL-60/p210 T315I; Fig. 2, D and ECitation ). Consistent with this, whereas exposure to imatinib induced apoptosis of HL-60/p210 wt cells in a dose-dependent manner, HL-60/p210 T315I cells were resistant to imatinib-induced apoptosis (Fig. 2B)Citation . In contrast, treatment with LAQ824 for 24 h clearly reduced the levels of the wt and T315I mutation containing Bcr-Abl in a dose-dependent manner in the HL-60/p210 wt and HL-60/p210 T315I cells, respectively (Fig. 2, D and E)Citation . In both transfectants, exposure to LAQ824 also induced the PARP cleavage activity of caspase-3 and increased the percentage of annexin V-positive apoptotic cells (Fig. 2, C–E)Citation .

LAQ824-mediated Depletion of the mRNA of bcr-abl Is Dependent on New Protein Synthesis.
Next, we determined whether LAQ824-mediated depletion of Bcr-Abl is because of repression of the bcr-abl mRNA. After treatment with LAQ824 for varying time intervals, the ratios of the mRNA transcripts of bcr-abl and histone H1 genes were determined by the real-time quantitative RT-PCR technique. LAQ824-treated K562 cells displayed a marked decline in the ratios of the mRNA transcripts of bcr-abl to histone H1 in a time-dependent manner for up to 24 h. The ratio declined from 0.49 in the untreated cells to a ratio of 0.24 at 4 h, 0.09 at 8 h, and 0.05 at 24 h of treatment with LAQ824. Northern analysis confirmed that exposure to LAQ824 for 4 h attenuated the bcr-abl message by 50% and exposure for 16 h by 80% in K562 cells (estimated by densitometry with GAPDH mRNA as the loading control; Fig. 3ACitation ). This occurred before an appreciable decline in the Bcr-Abl protein levels (data not shown). We next addressed the possibility that LAQ824-induced acetylation of histones or transcription factors may indirectly, through the induction of another regulatory protein, lead to repression of the bcr-abl message (34) . Fig. 3BCitation demonstrates that cotreatment with cycloheximide (100 µg/ml) reversed the LAQ824 (100 nM for 5 h)-mediated decline (estimated by densitometry to be 60% as compared with the untreated cells, with GAPDH message as the loading control) in the bcr-abl mRNA in K562 cells. These results indicate that LAQ824-mediated repression of the bcr-abl message requires new protein synthesis. This supports the interpretation that LAQ824 augments the levels and activity of a transcriptional repressor for bcr-abl, an outcome that is neutralized by cotreatment with cycloheximide. This conclusion was additionally supported by the results of the ChIP analyses performed on the lysates of the untreated or LAQ824-treated K562 and LAMA-84 cells to assess the association of the promoters of the bcr-abl with the acetylated histones. As shown in Fig. 3CCitation , exposure to 50–250 nM of LAQ824 did not affect the bcr-abl promoter associated with acetylated histones H3 and H4 in either cell types. As a control, after exposure to 50–250 nM LAQ824 for 24 h, ~2.0-fold more p21WAF1 promoter DNA was associated with acetylated histones compared with the same region associated with histones from cells cultured without LAQ824 (data not shown). Previous studies have clearly shown an increase in the association of p21WAF1 promoter DNA with acetylated histones after treatment with SAHA (33) .



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Treatment with LAQ824 represses bcr-abl mRNA expression, which is reversed by cotreatment with cycloheximide. A, samples of 15 µg of total cellular RNA were isolated from K562 cells treated with LAQ824 at the indicated concentrations and exposure intervals and analyzed by Northern blotting. A 1000-bp probe from the b3-a2 junction sequence of bcr-abl was used as a probe, which detected a 615-kb transcript. The same membrane was stripped and rehybridized with a GAPDH probe. B, K562 cells were exposed to either 100 nM of LAQ824 (Lane 2) or cycloheximide (100 µg/ml) alone (Lane 3) or cotreatment with LAQ824 and cycloheximide for 5 h (Lane 4). After this, samples of 15 µg of total cellular RNA were isolated and analyzed by Northern blotting for bcr-abl mRNA expression, as above. Lane 1 contains RNA from untreated cells. C, LAQ824 does not induce the accumulation of acetylated histones in chromatin associated with bcr-abl gene. Soluble chromatin was immunoprecipitated with antiacetylated histone H3 and H4 antibodies from untreated and LAQ824 treated K562 cells for 24 h. PCR primers for a region of the promoter of the bcr-abl gene (see text) were used to amplify the DNA isolated from the immunoprecipitated chromatin. Lanes 1 and 8, untreated cells; Lanes 2 and 9, 50 nM LAQ824; Lanes 3 and 10, 100 nM LAQ824; Lanes 4 and 11, 250 nM LAQ824, Lanes 5 and 12, input DNA, Lanes 6 and 13, normal rabbit serum; and Lanes 7 and 14, without template.

 
LAQ824 Induces Acetylation of Hsp90, Inhibits Its Chaperone Function, and Promotes the Proteasomal Degradation of Bcr-Abl.
Prompted by the studies that the HDI depsipeptide causes acetylation and inhibition of hsp90 as a chaperone protein for Her-2 kinase (35) , we determined the effects of LAQ824 on hsp90 and its chaperone function for Bcr-Abl TK in human CML-BC cells. Fig. 4ACitation demonstrates that treatment with LAQ824 caused marked acetylation of hsp90 in K562 cells, detected by immunoprecipitation of hsp90, followed by immunoblotting with an antibody that recognized antiacetylated lysine residues. Additionally, after LAQ824 treatment of K562 cells cultured in a medium containing [3H]acetic acid, increased amounts of the labeled hsp90 could be immunoprecipitated from the cell lysates (Fig. 4B)Citation . Alternatively, these lysates from the labeled K562 cells were incubated with ATP-Sepharose resin, and the labeled hsp90 was immunoprecipitated from the eluates from the resin and estimated by autoradiography. After exposure to LAQ824, a decline in the acetylated hsp90 that could bind to the ATP-Sepharose resin was observed (Fig. 4C)Citation . Thus, LAQ824 clearly increased the acetylation of hsp90, which was associated with a reduced binding to ATP. Similar findings were noted in LAQ824-treated LAMA-84 cells (data not shown). Next, we evaluated the impact of these modifications on the chaperone associations of hsp90. Bcr-Abl was immunoprecipitated from cell lysates of the untreated and LAQ824 treated K562 cells, and the binding of Bcr-Abl to hsp90 versus hsp70 was determined. Fig. 4DCitation demonstrates that LAQ824 treatment shifts the chaperone association of Bcr-Abl from hsp90 to hsp70. A similar shift in the chaperone association of c-Raf-1 and Akt was also seen in the LAQ824-treated cells (data not shown). Previous studies have shown that the shift to the unstable multichaperone complex, including hsp70, induces the client proteins Bcr-Abl, c-Raf-1, and Akt to accumulate in the detergent-insoluble cellular fraction, as well as directs them for polyubiquitination and proteasomal degradation (40 , 46) . Fig. 4ECitation demonstrates that treatment with LAQ824 alone depleted the levels of Bcr-Abl, c-Raf-1, and AKT in the detergent (NP40)-soluble fraction. In contrast, LAQ824 treatment increased Bcr-Abl, but not c-Raf-1 and AKT, accumulation in detergent-insoluble fraction. This has been previously shown to precede Bcr-Abl degradation by the proteasome (40) . Consistent with this, cotreatment with the proteasome inhibitor PS341 and LAQ824 increased the accumulations of Bcr-Abl in the detergent (NP40)-insoluble cellular fraction (Fig. 4E)Citation . This was also seen for c-Raf-1 and AKT. Taken together, these data indicate that, by inducing acetylation of hsp90, treatment with LAQ824 disrupts the stable chaperone association of Bcr-Abl with hsp90, which promotes the proteasomal degradation of Bcr-Abl. The decline in Bcr-Abl levels was not because of its processing by caspases during LAQ824-induced apoptosis because cotreatment with the caspase inhibitor z-VAD-fmk that blocked the PARP cleavage activity of the caspases did not reverse LAQ824-mediated decline in the Bcr-Abl levels in K562 cells (data not shown).



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. LAQ824 acetylates lysine residues on the Hsp90 inhibits its binding to ATP-Sepharose and shifts the chaperone association of Bcr-Abl from hsp90 to hsp70. A, K562 cells were exposed to the indicated concentrations of LAQ824 for 4 h. After this, Hsp90 was immunoprecipitated from the cell lysates and immunoblotted with either anti-Hsp90 or anti-antiacetylated lysine antibody. B, alternatively, K562 cells were exposed to [3H]acetic acid alone or in combination with the indicated concentrations of LAQ824 for 4 h. After this, the immunoprecipitated Hsp90 from the cell lysates was subjected to autoradiography. C, K562 cells were exposed to [3H]acetic acid alone or in combination with the indicated concentrations of LAQ824 for 4 h, as above. After this, the immunoprecipitated hsp90 from the cell lysates was affinity precipitated with ATP-Sepharose and subjected to autoradiography. D, K562 cells were treated with the indicated concentration of LAQ824 for 4 or 8 h. After this, immunoprecipitates of Bcr-Abl from the cell lysates were immunoblotted with anti-Hsp90, anti-hsp70 or anti-Abl antibodies. E, K562 cells were either cotreated with the indicated concentrations of LAQ824 and PS341, or either agent alone, for 8 h. The detergent (NP40)-soluble or -insoluble fractions were immunoblotted with anti-Abl, c-Raf-1, or anti-Akt antibody. The levels of ß-actin served as the loading control.

 
Cotreatment with LAQ824 Enhances Imatinib or PD180970-induced Apoptosis of CML Cells.
Agents that lower Bcr-Abl levels have been shown to enhance the apoptotic effects of the Bcr-Abl TK inhibitors, e.g., imatinib, against CML-BC cells (45 , 47) . We therefore determined the effects of LAQ824 and/or imatinib or the dual Src/Abl TK inhibitor PD180970, both on the levels (and TK activity) of Bcr-Abl and on apoptosis of K562 and LAMA-84 cells. Fig. 5, A and BCitation , demonstrate that as compared with treatment with any agent alone, combined treatment with LAQ824 and imatinib or PD180970 for 48 h induced more apoptosis of K562 cells. Similar apoptotic effects of the combinations were also observed against LAMA-84 cells (data not shown). As compared with LAQ824 alone, treatment with 100 nM LAQ824 plus 0.25 µM imatinib or PD180970 for 24 h was associated with a greater decline (estimated by densitometry) in the levels of Bcr-Abl (60 versus 40% with LAQ824 alone; Fig. 5, C and ECitation ). Concomitantly, a greater decline in the autotyrosine phosphorylation of Bcr-Abl was also observed after treatment with LAQ824 and imatinib (Fig. 5D)Citation . Combined treatments with LAQ824 plus imatinib or PD180970, as compared with the treatment with LAQ824 alone, also produced more decline in Bcr-Abl (70 versus 50% with LAQ824 alone) and Bcl-xL (60 versus 40% with LAQ824 alone) as well as larger increase in the expression of p27 (250 versus 80% with LAQ824) in K562 cells (estimated by densitometry) and LAMA-84 cells (data not shown). Shorter exposure intervals to LAQ824 and PD180970 or imatinib induced less effect on Bcr-Abl levels and apoptosis of K562 and LAMA-84 cells (data not shown).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Cotreatment with LAQ824 enhances imatinib mesylate (Gleevec) or PD180970-induced apoptosis of K562 cells. K562 cells were exposed either to the indicated concentrations of LAQ824 for 24 h alone or cotreated with the indicated concentration of matinib (A) or PD180970 (B). After this, the percentage of annexin V-stained apoptotic cells were determined by flow cytometry. Values (mean ± SE) are represented by the bar graphs. C–E, K562 cells were treated with the indicated concentrations of LAQ824 plus imatinib (C and D) or PD180970 (E) or the agent alone for 24 h. After this, immunoblot analyses of Bcr-Abl, Bcl-xL, p27, and ß-actin were performed on the cell lysates (C and E). Alternatively, Bcr-Abl was immunoprecipitated with anti-Abl antibody and immunoblotted with either the antiphosphotyrosine (p-tyrosine) or anti-Abl antibody (D).

 
LAQ824 Depletes Bcr-Abl and Induces Apoptosis of Imatinib-resistant and -sensitive Primary CML-BC Cells.
We next determined whether, similar to the findings in the cultured CML-BC cells, exposure to LAQ824 would also down-regulate the levels of Bcr-Abl and induce apoptosis of CML-BC cells derived from patients with imatinib-sensitive or -refractory CML-BC. For these studies, either samples of bone marrow-derived CD34+ leukemia progenitor cells or the mononuclear cells isolated from the peripheral blood of patients containing >90% circulating leukemia blasts were used. These samples showed varying levels of sensitivity to 0.25–1.0 µM imatinib. The percentage level of apoptosis (mean) ranged from 12.2 (sample no. 1) to 51.2 (sample no. 5; Table 2Citation ). In the three imatinib-refractory samples (samples nos. 1–3), the effects of LAQ824 were determined on the intracellular levels of Bcr-Abl and Bcl-xL, as well as on the acetylation of histone H3 and PARP cleavage activity of caspase-3. Exposure to 100 nM LAQ824 for 24 h induced acetylation of histone H3, as well as caused a decline in the Bcr-Abl and Bcl-xL levels (Fig. 6A)Citation . This was also associated with the induction of the PARP cleavage activity of caspase-3. In all of the five samples, treatment with LAQ824 induced a dose-dependent increase in apoptosis (Table 2)Citation . These findings confirmed that as in the cultured CML-BC cells, LAQ824 exerts similar effects on histone acetylation and Bcr-Abl levels, as well as induces apoptosis of the primary CML-BC cells, regardless of their sensitivity to imatinib. In the imatinib-refractory CML-BC cells, because of the limited sample size, it was not feasible to determine whether the mechanism of resistance against imatinib was bcr-abl gene amplification or point mutations in the kinase domain of the Bcr-Abl (28 , 30) . LAQ824-induced apoptosis was also determined in CD34+ normal hemopoietic progenitor cells. Fig. 6BCitation demonstrates that exposure to 50, 100, and 250 nM of LAQ824 induced apoptosis of CD34+ cells in a dose-dependent manner. This was significantly lower than the percentage of apoptosis observed after exposure of cultured or primary CML-BC cells to similar concentrations of LAQ824 (P < 0.05; Fig. 2ACitation , Table 2Citation and data not shown).


View this table:
[in this window]
[in a new window]

 
Table 2 LAQ824- and/or imatinib-induced apoptosis of patient-derived CML-BC cellsa

 


View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Treatment with LAQ824 depletes Bcr-Abl and Bcl-xL levels and induces apoptosis of imatinib-refractory primary CML-BC but not CD34+ hematopoietic progenitor cells. A, purified samples of three imatinib mesylate-refractory primary CML-BC cells were exposed to 100 nM LAQ824 for 24 h. After this, the cell lysates were immunoblotted with anti-Abl, Bcl-xL, PARP, ß-actin, acetylated histone H3, or antihistone H3 antibody. The levels of ß-actin served as the loading control. B, CD34+ hematopoietic progenitor cells were treated with the indicated concentration (nM) of LAQ824 and/or imatinib for 48 h. After this, Wright-stained Cytospun preparation of the cells were examined by light microscopy to determine the percentage of apoptotic cells. Values (mean ± SE) represented by the bar graphs are derived from two experiments (on two samples) performed in triplicate.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present studies demonstrate that treatment with LAQ824 depletes Bcr-Abl levels by two mechanisms: (a) lowering the mRNA levels of bcr-abl; and (b) disrupting the chaperone association of hsp90 with Bcr-Abl, thereby promoting its degradation by the proteasome. LAQ824 lowered Bcr-Abl levels and, consequently, its TK activity. This correlated with reduced autotyrosine phosphorylation of Bcr-Abl and down-regulation of p-AKT and Bcl-xL levels. Collectively, inhibition of these mechanisms that confer resistance against apoptosis was associated with increased PARP cleavage activity of caspase-3 and apoptosis of CML-BC cells (42) . Similar to what has been reported in other leukemia cell-types after treatment with SAHA, treatment with LAQ824 induced the transcription of p21 because of increased association of its promoter with acetylated histones (33) . In contrast, p27 promoter is not associated with acetylated histones, and increased p27 levels after treatment with SAHA have been shown to be attributable to posttranscriptional up-regulation of p27 expression (33) . This also makes it unlikely that the difference in transcriptional regulation of p21 versus p27 is because of the methylation status of the promoter regions of the two genes (46) . Regardless of the underlying mechanisms, the inductions of p21 and p27 levels may be responsible for why treatment with LAQ824 alone or in combination with imatinib induced the accumulation of CML-BC cells in the G1 phase of the cell cycle (5) . Previous studies have demonstrated that agents that lower Bcr-Abl levels, e.g., arsenic trioxide, significantly enhance the antileukemia activity of imatinib against Bcr-Abl-expressing leukemia cells (47 , 48) . Our present findings are consistent with this, demonstrating that cotreatment with LAQ824 enhances imatinib-induced cell cycle arrest and apoptosis of CML-BC cells. Treatment with LAQ824 induced significantly more apoptosis of CML-BC than normal CD34+ hemopoietic progenitor cells. Because imatinib did not induce apoptosis of normal CD34+ hemopoietic progenitor cells, cotreatment with LAQ824 and imatinib was differentially more toxic against CML-BC cells. Recently, as alluded to above, PD180970 and related analogues were shown to potently inhibit not only Src but also Bcr-Abl TK and signal transducers and activators of transcription 5 signaling (41 , 42 , 49) . This resulted in down-regulation of the expression of several target genes, including Bcl-xL, Mcl-1, and cyclin D2 (42 , 49 , 50) . Consequently, exposure to PD180970 induced apoptosis of CML-BC but not the Bcr-Abl-negative HL-60 cells (49 , 50) . Consistent with these observations, present studies demonstrate that treatment with LAQ824 and/or PD180970 induced cell cycle G1-phase arrest and apoptosis of CML-BC cells (Table 1Citation and Fig. 5BCitation ). Collectively, these findings support additional studies to determine the in vivo antileukemia activity of LAQ824 with imatinib or PD180970 against CML-BC cells.

The mRNA transcript levels of bcr-abl declined markedly after short exposure intervals to LAQ824, as determined by Northern and the real-time RT-PCR analyses. LAQ824-mediated repression of bcr-abl message was similar to what was seen in CML-BC cells after treatment with SAHA (38) . It is noteworthy that treatment with a different hydroxamic acid analogue, i.e., TSA, has been reported to inhibit the mRNA synthesis of another oncogene, erbB2, as detected by a genomically integrated ErbB2 promoter cell screen (51) . Although exposure to TSA had no effect on the open chromatin configuration of this gene, as monitored by DNase I hypersensitivity, TSA selectively destabilized and enhanced the decay of the mature ErbB2 transcripts (51) . In the present studies, the results of the ChIP analyses clearly demonstrated that treatment with LAQ824 did not affect the association of the bcr-abl promoter with the acetylated histones. This raises the possibility that HDIs may repress bcr-abl indirectly through the induction of other regulatory proteins. This is supported by our finding that cotreatment with cycloheximide reversed the LAQ824-mediated repression of the bcr-abl message. In addition to acetylating the core nucleosomal histones, HDIs may induce acetylation and alteration of DNA binding and activity of transcription factors, e.g., p53, E2F, and GATA-1 (31 , 32 , 52 , 53) . Because this was not examined in the present studies, whether LAQ824 treatment induces the activity of a transcriptional repressor of bcr-abl by this mechanism remains to be established. However, the decline in Bcr-Abl levels because of LAQ824 treatment did not appear to be caused by the processing of Bcr-Abl during LAQ824-induced apoptosis. Cotreatment with the multicaspase inhibitor z-VAD-fmk abrogated the PARP cleavage activity of the caspases, without affecting LAQ824-mediated decline in Bcr-Abl levels in CML-BC cells (data not shown).

Although the specific nuclear and/or cytosolic HDAC(s) inhibited by LAQ824, which may be involved in the acetylation of hsp90, were not elucidated, the present studies demonstrate that treatment with LAQ824 increased the acetylation of lysine residues on hsp90. This reduced the binding of hsp90 to ATP, which was associated with the disruption of the chaperone association of hsp90 with Bcr-Abl and c-Raf-1. Another hsp90 inhibitor geldanamycin or its less toxic analogue 17-allylamino-demethoxy geldanamycin has been shown to have similar effects (40 , 54) . Although attenuating the association of Bcr-Abl with the stable multichaperone complex, including hsp90, LAQ824 treatment increased the association of Bcr-Abl with the less stable multichaperone complex with hsp70. This directed the accumulation of Bcr-Abl in the detergent-insoluble cellular fraction promoting its degradation by the proteasome because cotreatment with the proteasome inhibitor PS341 with LAQ824 increased the levels of Bcr-Abl in the detergent-insoluble cellular fraction. A similar outcome was previously reported to occur, after cotreatment of CML-BC cells with 17-allylamino-demethoxy geldanamycin and PS341 (40 , 55) .

Several novel therapeutic agents have shown promising activity against imatinib-refractory CM-BC cells (9) . These agents are either able to target and inhibit the TK activity of the mutant or amplified Bcr-Abl, e.g., PD180970, farnesyl transferase inhibitor, and flavopiridol, and/or abrogate the alternative growth promoting and survival mechanisms, e.g. Lyn or Erk1/2 kinases (55, 56, 57, 58, 59) . As noted above, geldanamycin analogues and arsenic trioxide lower the levels of not only wt but also mutant Bcr-Abl and have been shown to exert antileukemia effects against imatinib-refractory CML-BC cells (42 , 60) . Recent studies from our laboratory have also demonstrated that the HDI SAHA can lower Bcr-Abl levels and induce apoptosis of imatinib-refractory CML-BC cells (38) . Present studies clearly demonstrate that LAQ824 is especially promising because it improves the selective cytotoxic effects of imatinib against CML-BC versus normal CD34+ hemopoietic progenitor cells. LAQ824 is also able to deplete not only wt but also mutant Bcr-Abl levels in imatinib-refractory CML-BC cells at concentrations as low as 100 nM. In addition, the ability of LAQ824 to attenuate c-Raf-1, Src, and AKT levels by promoting their degradation through the proteasome additionally contributes to its activity against imatinib-refractory CML-BC cells. Taken together, these attributes strongly support the in vivo testing of LAQ824 against imatinib-sensitive and -refractory forms of CML-BC.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Moffitt Cancer Center & Research Institute, 12902 Magnolia Drive, MRC 3 East, Room 3056, Tampa, FL 33612. Phone: (813) 903-6861; Fax: (813) 903-6817; E-mail: bhallakn{at}moffitt.usf.edu Back

2 The abbreviations used are: CML, chronic myeloid leukemia; BC, blast crisis; TK, tyrosine kinase; PI3K, phosphatidylinositol-3-kinase; HDAC, histone deacetylase; HDI, HDAC inhibitor; hsp, heat shock protein; wt, wild-type; SAHA, suberoylanilide hydroxamic acid; PARP, poly(ADP-ribose) polymerase; PE, phycoerythrin; RT-PCR, reverse transcription-PCR; ChIP, chromatin immunoprecipitation; TSA, trichostatin A; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back

Received 2/19/03. Revised 5/22/03. Accepted 6/30/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Thijsen S. F. T., Schuurhuis G. J., van Oostveen J. W., Ossenkoppele G. J. Chronic myeloid leukemia from basic to bedside. Leukemia (Baltimore), 13: 1646-1674, 1999.[Medline]
  2. Deininger M., Goldman J., Melo J. The molecular biology of chronic myeloid leukemia. Blood, 96: 3343-3356, 2000.[Free Full Text]
  3. Skorski T., Bellacosa A., Nieborowska-Skorska M., Majewski M., Martinez R., Choi J., Trotta R., Wlodarski P., Perrito D., Chan T., Wasik M., Tsichlis P., Calabretta B. Transformation of hematopoietic cells by BCR/ABL requires activation of a PI-3k/Akt-dependent pathway. EMBO J., 16: 6151-6161, 1997.[Medline]
  4. Deininger M. W. N., Vieira S. A., Parada Y., Banerji L., Lam E. W., Peters G., Mahon F. X., Kohler T., Goldman J. M., Melo J. V. Direct relation between Bcr-Abl tyrosine kinase activity and cyclin D2 expression in lymphoblasts. Cancer Res., 61: 8005-8013, 2001.[Abstract/Free Full Text]
  5. Gesbert F., Sellers W., Signoretti S., Loda M., Griffin J. BCR/ABL regulates expression of the cyclin-dependent kinase inhibitor p27Kip1 through the phosphatidylinositol 3-kinase/AKT pathway. J. Biol. Chem., 275: 39223-39230, 2000.[Abstract/Free Full Text]
  6. Jonuleit T., Van der Kuip H., Miething C., Michels H., Hallek M., Duyster J., Aulitzky W. Bcr-Abl kinase down-regulates cyclin-dependent kinase inhibitor p27 in human and murine cell lines. Blood, 96: 1933-1939, 2000.[Abstract/Free Full Text]
  7. Bedi A., Barber J. P., Bedi G. C., el-Deiry W. S., Sidransky D., Vala M. S., Akhtar A. J., Hilton J., Jones J. R. BCR-ABL-mediated inhibition of apoptosis by delay of G2-M transition following DNA damage: a mechanism of resistance to multiple anticancer agents. Blood, 86: 1148-1158, 1995.[Abstract/Free Full Text]
  8. Amarante-Mendes G., Kim C., Liu L., Huang Y., Perkins C., Green D., Bhalla K. Bcr-Abl exerts its anti-apoptotic effect against diverse stimuli through blockage of mitochondrial release of cytochrome c and activation of caspase-3. Blood, 91: 1700-1705, 1998.[Abstract/Free Full Text]
  9. Nimmanapalli R., Bhalla K. Mechanisms of resistance to imatinib mesylate (Gleevec) in Bcr-Abl positive leukemias. Curr. Opin. Oncol., 6: 616-620, 2002.
  10. Nieborowska-Skorska M., Wasik M., Slupianek A., Salomoni P., Kitamura T., Calabretta B., Skorski T. Signal transducer and activator of transcription (STAT)5 activation by BCR/ABL is dependent on intact Src homology (SH)3 and SH2 domains of BCR/ABL is required for leukemogenesis. J. Exp. Med., 189: 1229-1242, 1999.[Abstract/Free Full Text]
  11. Sillaber C., Gesbert F., Frank D., Sattler M., Griffin J. STAT5 activation contributes to growth and viability in Bcr/Abl transformed cells. Blood, 95: 2118-2125, 2000.[Abstract/Free Full Text]
  12. Gesbert F., Griffin J. D. BCR-ABL activates transcription of the BCL-X gene through STAT5. Blood, 96: 2269-2276, 2000.[Abstract/Free Full Text]
  13. Hoover R. R., Gerlach M. J., Koh E. Y., Daley G. Q. Cooperative and redundant effects of STAT5 and Ras signaling in BCR/ABL-transformed hematopoietic cells. Oncogene, 20: 5826-5835, 2001.[Medline]
  14. Reuter J., Reuther G. W., Cortez D., Pendergast A. M. A requirement for NF-R B activation in Bcr-Abl-mediated transformation. Genes Dev., 12: 968-981, 1998.[Abstract/Free Full Text]
  15. Wang C. Y., Mayo M. W., Korneluk R. G., Goeddel D. V., Baldwin A. S., Jr. NF-R B anti-apoptosis: induction of TRAF1 and 2 and c-IAP1 and 2 to suppress caspase-8 activation. Science (Wash. DC), 281: 1680-1683, 1998.[Abstract/Free Full Text]
  16. Datta S. R., Brunet A., Greenberg M. E. Cellular survival: a play of three Akts. Genes Dev., 13: 2905-2927, 1999.[Free Full Text]
  17. Druker B. J. Perspectives on the development of a molecularly targeted agent. Cancer Cell, 1: 31-36, 2002.[Medline]
  18. Jahagirdar B. N., Miller J. S., Shet A., Verfaillie C. M. Novel therapies for chronic myelogenous leukemia. Exp. Hematol., 29: 543-556, 2001.[Medline]
  19. Buchdunger E., Zimmermann J., Mett H., Meyer T., Muller M., Druker B. J., Lydon N. B. Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative. Cancer Res., 56: 100-104, 1996.[Abstract/Free Full Text]
  20. Druker B. J., Tamura S., Buchdunger E., Ohno S., Segal G. M., Fanning S., Zimmermann J., Lydon N. B. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat. Med., 2: 561-566, 1996.[Medline]
  21. Deininger M. W. N., Goldman J. M., Lydon N., Melo J. V. The tyrosine kinase inhibitor CGP57148B selectively inhibits the growth of the BCR-ABL-positive cells. Blood, 90: 3691-3698, 1997.[Abstract/Free Full Text]
  22. Fang G., Kim C., Perkins C., Ramadevi N., Winton E., Wittman S., Bhalla K. CGP57148 (STI-571) induces differentiation and apoptosis and sensitizes Bcr-Abl positive human leukemia cells to apoptosis due to antileukemic drugs. Blood, 96: 2246-2256, 2000.[Abstract/Free Full Text]
  23. Le Coutre P., Malogni L., Cleris L., Marchesi E., Buchdunger E., Giardini R., Formelli F., Gambacorti-Passerini C. In vivo eradication of human BCR/ABL positive leukemia cells with an ABL kinase inhibitor. J. Natl. Cancer Inst. (Bethesda), 91: 163-168, 1999.[Abstract/Free Full Text]
  24. Savage D. G., Antman K. H. Imatinib mesylate: a new oral targeted therapy. N. Engl. J. Med., 28: 689-693, 2002.
  25. Kantarjian H., Sawyers C., Hochhaus A., Guihot F., Schiffer C., Gambacorti-Passerini C., Niederwieser D., Resta D., Capdeville R., Zoellner U., Talpaz M., Druker B., Goldman J., O’Brien S. G., Russell N., Fischer T., Ottmann O., Cony-Makhoul P., Facon T., Stone R., Miller C., Tallman M., Brown R., Schuster M., Loughran T., Gratwohl A., Mandelli F., Saglio G., Lazzarini M., Russo D., Baccarani M., Morra E. Hematologic and cytogenetic responses to imatinib mesylate in chronic myelogenous leukemia. N. Engl. J. Med., 346: 645-652, 2002.[Abstract/Free Full Text]
  26. Kantarjian H. M., Cortes J., O’Brien S., Giles F. J., Albitar M., Rios M. B., Shan J., Faderl S., Manero G. G., Thomas D. A., Resta D., Talpaz M. Imatinib mesylate (STI571) therapy for Philadelphia chromosome-positive chronic myelogenous leukemia in blast phase. Blood, 99: 3547-3553, 2002.[Abstract/Free Full Text]
  27. Talpaz M., Silver R. T., Druker B. J., Goldman J. M., Gambacorti-Passerini C., Guilhot F., Schiffer C. A., Fischer T., Deininger M. W., Lennard A. L., Hochhaus A., Ottmann O. G., Gratwohl A., Baccarani M., Stone R., Turam S., Mahon F. X., Fernandes-Reese S., Gathmann I., Capdeville R., Kantarjian H. M., Sawyers C. L. Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a Phase II study. Blood, 99: 1928-1937, 2002.[Abstract/Free Full Text]
  28. Gorre M. E., Mohammed M., Ellwood K., Hsu N., Paquette R., Rao P. N., Sawyers C. L. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science (Wash. DC), 293: 876-880, 2001.[Abstract/Free Full Text]
  29. Von Bubnoff N., Schneller F., Peschel C., Duyster J. BCR-ABL gene mutations in relation to clinical resistance of Philadelphia chromosome-positive leukaemia to STI571: a prospective study. Lancet, 359: 487-491, 2002.[Medline]
  30. Shah N. P., Nicoll J. M., Nagar B., Gorre M. E., Paquette R. L., Kuriyan J., Sawyers C. L. Multiple BCR-ABL kinase domain mutations confer polyclonal resistance to the tyrosine kinase inhibitor imatinib (STI571) in chronic phase and blast crisis chronic myeloid leukemia. Cancer Cell, 2: 117-125, 2002.[Medline]
  31. Cress W. D., Seto E. Histone deacetylase, transcriptional control and cancer. J. Cell. Physiol., 184: 1-16, 2000.[Medline]
  32. Marks P. A., Rifkind R. A., Richon V. M., Breslow R., Miller T., Kelly W. K. Histone deacetylases and cancer: causes and therapies. Nat. Rev. Cancer, 1: 194-202, 2001.[Medline]
  33. Richon V. M., Sandhoff T. W., Rifkind R. A., Marks P. A. Histone deacetylase inhibitor selectively induces p21WAF1 expression and gene-associated histone acetylation. Proc. Natl. Acad. Sci. USA, 97: 10014-10019, 2000.[Abstract/Free Full Text]
  34. Marks P. A., Richon V. M., Rifkind R. A. Histone deacetylase inhibitors: inducers of differentiation or apoptosis of transformed cells. J. Natl. Cancer Inst. (Bethesda), 92: 1210-1216, 2000.[Abstract/Free Full Text]
  35. Yu X., Guo Z. S., Marcu M. G., Neckers L., Nguyen D. M., Chen G. A., Schrump D. S. Modulation of p53, ErbB1, ErbB2, and Raf-1 expression in lung cancer cells of depsipeptide FR901228. J. Natl. Cancer Inst. (Bethesda), 94: 504-513, 2002.[Abstract/Free Full Text]
  36. Vrana J. A., Decker R. H., Johnson C. R., Wang Z., Jarvis W. D., Richon V. M., Ehinger M., Fisher P. B., Grant S. Induction of apoptosis in human myelomonocytic leukemia cells (U937) by the hybrid polar compound SAHA proceeds through pathways regulated by Bcl-2/Bcl-xL, p21CIPI, and c-Jun/AP1, but independent of p53. Oncogene, 18: 7016-7025, 1999.[Medline]
  37. He L-Z., Tolentino T., Grayson P., Zhong S., Warrell R. P., Jr., Rifkind R. A., Marks P. A., Richon V. M., Pandolfi P. P. Histone deacetylase inhibitors induce remission in transgenic models of therapy-resistant acute promyelocytic leukemia. J. Clin. Investig., 108: 1321-1330, 2001.[Medline]
  38. Nimmanapalli R., Fuino L., Stobaugh C., Richon V. M., Bhalla K. Co-treatment with the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) enhances Gleevec-induced apoptosis of Bcr-Abl-positive human acute leukemia cells. Blood, 101: 3236 2003.[Abstract/Free Full Text]
  39. Catley L., Weisberg E., Tai Y. T., Lin B., Mitsiades N., Hideshima T., LeBlanc R., Shringapure R., Burger R., Mitsiades C., Chauhan D., Schlossman R., Munshi N., Richardson P., Griffin J. LAQ824 is a novel histone deacetylase inhibitor with significant activity against multiple myeloma: results of a preclinical evaluation. Blood, 100: 391 2002.[Abstract/Free Full Text]
  40. Nimmanapalli R., O’Bryan E., Bhalla K. Geldanamycin and its analogue 17-allylamino-17-demethoxygeldanamycin lowers Bcr-Abl levels and induces apoptosis and differentiation of Bcr-Abl-positive human leukemic blasts. Cancer Res., 61: 1799-1804, 2001.[Abstract/Free Full Text]
  41. Kraker A. J., Hartl B. G., Amar A. M., Barvian M. R., Showalter H. D., Moore C. W. Biochemical and cellular effects of c-Src kinase-selective pyrido[2, 3-d]pyrimidine tyrosine kinase inhibitors. Biochem. Pharmacol., 60: 885-898, 2000.[Medline]
  42. Nimmanapalli R., O’Bryan E., Huang M., Bali P., Burnette P. K., Loughran T., Tepperberg J., Jove R., Bhalla K. Molecular characterization and sensitivity of STI-571 (Imatinib Mesylate, Gleevec)-resistant, Bcr-Abl-positive, human acute leukemia cells retain sensitivity to SRC kinase inhibitor PD180970 and 17-allylamino-17-demethoxygeldanamycin (17-AAG). Cancer Res., 62: 5761-5769, 2002.[Abstract/Free Full Text]
  43. Gentry T., Smith C. Retroviral vector gene transfer into CD34+CD38–33-umbilical cord blood cells. Exp. Hematol., 27: 1244-1254, 1999.[Medline]
  44. Mukhopadhyay A., Shishodia S., Suttles J., Brittingham K., Lamothe B., Nimmanapalli R., Bhalla K. N., Aggarwal B. B. Ectopic expression of protein tyrosine kinase Bcr-Abl suppresses TNF-induced NF-{kappa}B activation and I{kappa}B{alpha} phosphorylation: relationship with down-regulation of TNF receptors. J. Biol. Chem., 277: 30622-30628, 2002.[Abstract/Free Full Text]
  45. Preudhomme C., Revillon F., Merlat A., Hornez L., Roumier C., Duflos-Grardel N., Jouet J. P., Cosson A., Peyrat J. P., Fenaux P. Detection of Bcr-Abl transcripts in chronic myeloid leukemia (CML) using a "real time" quantitative RT-PCR assay. Leukemia (Baltimore), 13: 957-964, 1999.[Medline]
  46. Fahrner J. A., Eguchi S., Herman J. G., Baylin S. B. Dependence of histone modifications and gene expression on DNA hypermethylation in cancer. Cancer Res., 62: 7213-7218, 2002.[Abstract/Free Full Text]
  47. Porosnicu M., Ramadevi N., Nguyen D., Worthington E., Perkins C., Bhalla K. Co-treatment with As2O3 enhances selective cytotoxic effects of STI571 against Bcr-Abl-positive acute leukemia cells. Leukemia (Baltimore), 15: 772-778, 2001.[Medline]
  48. La Rosee P., Johnson K., O’Dwyer M. E., Druker B. J. In vitro studies of the combination of imatinib mesylate (Gleevec) and arsenic trixide (Trisenox) in chronic myelogenous leukemia. Exp. Hematol., 30: 729-737, 2002.[Medline]
  49. Dorsey J. F., Cunnick J. M., Lanehart R., Huang M., Kraker A. J., Bhalla K. N., Jove R., Wu J. Interleukin-3 protects Bcr-Abl-transformed hematopoietic progenitor cells from apoptosis induced by Bcr-Abl tyrosine kinase inhibitors. Leukemia (Baltimore), 16: 1589-1595, 2002.[Medline]
  50. Huang M., Dorsey J. F., Epling-Burnette P. K., Landowski T. H., Mora L., Niu G., Sinibaldi D., Nimmanapalli R., Bai F., Kraker A., Yu H., Moscinski L., Wei S., Djeu J., Dalton W. S., Bhalla K., Loughran T. P., Wu J., Jove R. Inhibition of Bcr-Abl kinase activity by PD180970 blocks constitutive activation of Stat5 and growth of CML cells. Oncogene, 21: 8804-8816, 2002.[Medline]
  51. Scott G. K., Marden C. M., Xu F., Kirk L., Benz C. C. Transcriptional repression of ErbB2 by histone deacetylase inhibitors detected by a genomically integrated ErbB2 promoter-reporting cell screen. Mol. Cancer Ther., 1: 385-392, 2000.
  52. Gu W., Roeder R. G. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell, 90: 595-606, 1997.[Medline]
  53. Boyes J., Byfield P., Nakatani Y., Ogryzko V. Regulation of activity of the transcription factor GATA-1 by acetylation. Nature (Lond.), 396: 594-598, 1998.[Medline]
  54. Grenert J. P., Sullivan W. P., Fadden P., Haystead T., Clark J., Mimnaugh E., Krutzsch H., Ochel H. J., Schulte T. W., Sausville E., Nechers L. M., Toft D. O. The amino-terminal domain of heat shock protein 90 (hsp90) that binds geldanamycin is an ATP/ADP switch domain that regulates hsp90 conformation. J. Biol. Chem., 272: 23843-23850, 1997.[Abstract/Free Full Text]
  55. An W. G., Schutte T. W., Neckers L. M. The heat shock protein 90 antagonist geldanamycin alters chaperone association with p210bcr-abl and v-src proteins before their degradation by proteasome. Cell Growth Differ., 11: 355-360, 2000.[Abstract/Free Full Text]
  56. La Rosee P., Corbin A. S., Stoffregen E. P., Deininger M. W., Duker B. J. Activity of the Bcr-Abl kinase inhibitor PD180970 against clinically relevant Bcr-Abl isoforms that cause resistance to imatinib mesylate (Gleevec, STI571). Cancer Res., 62: 7149-7153, 2002.[Abstract/Free Full Text]
  57. Hoover R. R., Mahon F. X., Melo J. V., Daley G. Q. Overcoming STI571 resistance with the farnesyl transferase inhibitor SCH66336. Blood, 100: 1068-1071, 2002.[Abstract/Free Full Text]
  58. Yu C., Krystal G., Varticovksi L., McKinstry R., Rahmani M., Dent P., Grant S. Pharmacologic mitogen-activated protein/extracellular signal-regulated kinase kinase/mitogen-activated protein kinase inhibitors interact synergistically with STI571 to induce apoptosis in Bcr-Abl-expressing human leukemic cells. Cancer Res., 62: 188-199, 2002.[Abstract/Free Full Text]
  59. Donato N. J., Yu J. Y., Stapley J., Gallick G., Lin H., Arlinghaus R., Talpaz M. BCR-ABL independence and LYN kinase overexpression in chronic myelogenous leukemia cells selected for resistance to STI571. Blood, 101: 690-698, 2003.[Abstract/Free Full Text]
  60. Gorre M. E., Ellwood-Yen K., Chiosis G., Rosen N., Sawyers C. L. BCR-ABL point mutants isolated from patients with imatinib mesylate-resistant chronic myeloid leukemia remain sensitive to inhibitors of the BCR-ABL chaperone heat shock protein 90. Blood, 100: 3041-3044, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
E. P. Jane, D. R. Premkumar, S. O. Addo-Yobo, and I. F. Pollack
Abrogation of Mitogen-Activated Protein Kinase and Akt Signaling by Vandetanib Synergistically Potentiates Histone Deacetylase Inhibitor-Induced Apoptosis in Human Glioma Cells
J. Pharmacol. Exp. Ther., October 1, 2009; 331(1): 327 - 337.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Muhlenberg, Y. Zhang, A. J. Wagner, F. Grabellus, J. Bradner, G. Taeger, H. Lang, T. Taguchi, M. Schuler, J. A. Fletcher, et al.
Inhibitors of Deacetylases Suppress Oncogenic KIT Signaling, Acetylate HSP90, and Induce Apoptosis in Gastrointestinal Stromal Tumors
Cancer Res., September 1, 2009; 69(17): 6941 - 6950.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Ellis, M. Bots, R. K. Lindemann, J. E. Bolden, A. Newbold, L. A. Cluse, C. L. Scott, A. Strasser, P. Atadja, S. W. Lowe, et al.
The histone deacetylase inhibitors LAQ824 and LBH589 do not require death receptor signaling or a functional apoptosome to mediate tumor cell death or therapeutic efficacy
Blood, July 9, 2009; 114(2): 380 - 393.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
X. Shi, Y. Jin, C. Cheng, H. Zhang, W. Zou, Q. Zheng, Z. Lu, Q. Chen, Y. Lai, and J. Pan
Triptolide Inhibits Bcr-Abl Transcription and Induces Apoptosis in STI571-resistant Chronic Myelogenous Leukemia Cells Harboring T315I Mutation
Clin. Cancer Res., March 1, 2009; 15(5): 1686 - 1697.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Bazzaro, Z. Lin, A. Santillan, M. K. Lee, M.-C. Wang, K. C. Chan, R. E. Bristow, R. Mazitschek, J. Bradner, and R. B.S. Roden
Ubiquitin Proteasome System Stress Underlies Synergistic Killing of Ovarian Cancer Cells by Bortezomib and a Novel HDAC6 Inhibitor
Clin. Cancer Res., November 15, 2008; 14(22): 7340 - 7347.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. Fiskus, Y. Wang, R. Joshi, R. Rao, Y. Yang, J. Chen, R. Kolhe, R. Balusu, K. Eaton, P. Lee, et al.
Cotreatment with Vorinostat Enhances Activity of MK-0457 (VX-680) against Acute and Chronic Myelogenous Leukemia Cells
Clin. Cancer Res., October 1, 2008; 14(19): 6106 - 6115.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Fiskus, R. Rao, P. Fernandez, B. Herger, Y. Yang, J. Chen, R. Kolhe, A. Mandawat, Y. Wang, R. Joshi, et al.
Molecular and biologic characterization and drug sensitivity of pan-histone deacetylase inhibitor-resistant acute myeloid leukemia cells
Blood, October 1, 2008; 112(7): 2896 - 2905.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Kurokawa, C. Zhao, T. Reya, and S. Kornbluth
Inhibition of Apoptosome Formation by Suppression of Hsp90{beta} Phosphorylation in Tyrosine Kinase-Induced Leukemias
Mol. Cell. Biol., September 1, 2008; 28(17): 5494 - 5506.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Rao, W. Fiskus, Y. Yang, P. Lee, R. Joshi, P. Fernandez, A. Mandawat, P. Atadja, J. E. Bradner, and K. Bhalla
HDAC6 inhibition enhances 17-AAG-mediated abrogation of hsp90 chaperone function in human leukemia cells
Blood, September 1, 2008; 112(5): 1886 - 1893.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Dai, S. Chen, C. A. Venditti, X.-Y. Pei, T. K. Nguyen, P. Dent, and S. Grant
Vorinostat synergistically potentiates MK-0457 lethality in chronic myelogenous leukemia cells sensitive and resistant to imatinib mesylate
Blood, August 1, 2008; 112(3): 793 - 804.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Quintas-Cardama and J. Cortes
Therapeutic Options Against BCR-ABL1 T315I-Positive Chronic Myelogenous Leukemia
Clin. Cancer Res., July 15, 2008; 14(14): 4392 - 4399.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Wandinger, K. Richter, and J. Buchner
The Hsp90 Chaperone Machinery
J. Biol. Chem., July 4, 2008; 283(27): 18473 - 18477.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W.-Y. Chen, F.-R. Chang, Z.-Y. Huang, J.-H. Chen, Y.-C. Wu, and C.-C. Wu
Tubocapsenolide A, a Novel Withanolide, Inhibits Proliferation and Induces Apoptosis in MDA-MB-231 Cells by Thiol Oxidation of Heat Shock Proteins
J. Biol. Chem., June 20, 2008; 283(25): 17184 - 17193.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. Egler, S. Korur, M. Failly, J.-L. Boulay, R. Imber, M. M. Lino, and A. Merlo
Histone Deacetylase Inhibition and Blockade of the Glycolytic Pathway Synergistically Induce Glioblastoma Cell Death
Clin. Cancer Res., May 15, 2008; 14(10): 3132 - 3140.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
Q. Zhou, A. T. Agoston, P. Atadja, W. G. Nelson, and N. E. Davidson
Inhibition of Histone Deacetylases Promotes Ubiquitin-Dependent Proteasomal Degradation of DNA Methyltransferase 1 in Human Breast Cancer Cells
Mol. Cancer Res., May 1, 2008; 6(5): 873 - 883.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Dasmahapatra, N. Yerram, Y. Dai, P. Dent, and S. Grant
Synergistic Interactions between Vorinostat and Sorafenib in Chronic Myelogenous Leukemia Cells Involve Mcl-1 and p21CIP1 Down-Regulation
Clin. Cancer Res., July 15, 2007; 13(14): 4280 - 4290.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Peng, J. Brain, Y. Hu, A. Goodrich, L. Kong, D. Grayzel, R. Pak, M. Read, and S. Li
Inhibition of heat shock protein 90 prolongs survival of mice with BCR-ABL-T315I-induced leukemia and suppresses leukemic stem cells
Blood, July 15, 2007; 110(2): 678 - 685.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. K. Nguyen, M. Rahmani, H. Harada, P. Dent, and S. Grant
MEK1/2 inhibitors sensitize Bcr/Abl+ human leukemia cells to the dual Abl/Src inhibitor BMS-354/825
Blood, May 1, 2007; 109(9): 4006 - 4015.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. D.-A. Tran, T. P. Marmo, A. A. Salam, S. Che, E. Finkelstein, R. Kabarriti, H. S. Xenias, R. Mazitschek, C. Hubbert, Y. Kawaguchi, et al.
HDAC6 deacetylation of tubulin modulates dynamics of cellular adhesions
J. Cell Sci., April 15, 2007; 120(8): 1469 - 1479.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
S. Soverini, I. Iacobucci, M. Baccarani, and G. Martinelli
Targeted therapy and the T315I mutation in Philadelphia-positive leukemias
Haematologica, April 1, 2007; 92(4): 437 - 439.
[Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
D. L. Marrocco, W. D. Tilley, T. Bianco-Miotto, A. Evdokiou, H. I. Scher, R. A. Rifkind, P. A. Marks, V. M. Richon, and L. M. Butler
Suberoylanilide hydroxamic acid (vorinostat) represses androgen receptor expression and acts synergistically with an androgen receptor antagonist to inhibit prostate cancer cell proliferation
Mol. Cancer Ther., January 1, 2007; 6(1): 51 - 60.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
W. Fiskus, M. Pranpat, M. Balasis, B. Herger, R. Rao, A. Chinnaiyan, P. Atadja, and K. Bhalla
Histone deacetylase inhibitors deplete enhancer of zeste 2 and associated polycomb repressive complex 2 proteins in human acute leukemia cells
Mol. Cancer Ther., December 1, 2006; 5(12): 3096 - 3104.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Catley, E. Weisberg, T. Kiziltepe, Y.-T. Tai, T. Hideshima, P. Neri, P. Tassone, P. Atadja, D. Chauhan, N. C. Munshi, et al.
Aggresome induction by proteasome inhibitor bortezomib and {alpha}-tubulin hyperacetylation by tubulin deacetylase (TDAC) inhibitor LBH589 are synergistic in myeloma cells
Blood, November 15, 2006; 108(10): 3441 - 3449.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. Fiskus, M. Pranpat, M. Balasis, P. Bali, V. Estrella, S. Kumaraswamy, R. Rao, K. Rocha, B. Herger, F. Lee, et al.
Cotreatment with Vorinostat (Suberoylanilide Hydroxamic Acid) Enhances Activity of Dasatinib (BMS-354825) against Imatinib Mesylate-Sensitive or Imatinib Mesylate-Resistant Chronic Myelogenous Leukemia Cells.
Clin. Cancer Res., October 1, 2006; 12(19): 5869 - 5878.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Baccarani, G. Saglio, J. Goldman, A. Hochhaus, B. Simonsson, F. Appelbaum, J. Apperley, F. Cervantes, J. Cortes, M. Deininger, et al.
Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet
Blood, September 15, 2006; 108(6): 1809 - 1820.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Fiskus, M. Pranpat, P. Bali, M. Balasis, S. Kumaraswamy, S. Boyapalle, K. Rocha, J. Wu, F. Giles, P. W. Manley, et al.
Combined effects of novel tyrosine kinase inhibitor AMN107 and histone deacetylase inhibitor LBH589 against Bcr-Abl-expressing human leukemia cells
Blood, July 15, 2006; 108(2): 645 - 652.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
A. Quintas-Cardama and J. E. Cortes
Chronic Myeloid Leukemia: Diagnosis and Treatment
Mayo Clin. Proc., July 1, 2006; 81(7): 973 - 988.
[Abstract] [Full Text] [PDF]


Home page
aacredbookHome page
K. Bhalla
Overview and Cytoplasmic Targets of HDAC Inhibitors
Am. Assoc. Cancer Res. Educ. Book, April 1, 2006; 2006(1): 309 - 312.
[Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Codony-Servat, M. A. Tapia, M. Bosch, C. Oliva, J. Domingo-Domenech, B. Mellado, M. Rolfe, J. S. Ross, P. Gascon, A. Rovira, et al.
Differential cellular and molecular effects of bortezomib, a proteasome inhibitor, in human breast cancer cells.
Mol. Cancer Ther., March 1, 2006; 5(3): 665 - 675.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Cai, Y. Wang, O. G. Ottmann, P. J. Barth, A. Neubauer, and A. Burchert
FLT3-ITD-, but not BCR/ABL-transformed cells require concurrent Akt/mTor blockage to undergo apoptosis after histone deacetylase inhibitor treatment
Blood, March 1, 2006; 107(5): 2094 - 2097.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Z. Qian, Y. Kato, S. Shabbeer, Y. Wei, H. M.W. Verheul, B. Salumbides, T. Sanni, P. Atadja, and R. Pili
Targeting Tumor Angiogenesis with Histone Deacetylase Inhibitors: the Hydroxamic Acid Derivative LBH589
Clin. Cancer Res., January 15, 2006; 12(2): 634 - 642.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. R. Rosato, S. C. Maggio, J. A. Almenara, S. G. Payne, P. Atadja, S. Spiegel, P. Dent, and S. Grant
The Histone Deacetylase Inhibitor LAQ824 Induces Human Leukemia Cell Death through a Process Involving XIAP Down-Regulation, Oxidative Injury, and the Acid Sphingomyelinase-Dependent Generation of Ceramide
Mol. Pharmacol., January 1, 2006; 69(1): 216 - 225.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Guo, K. Rocha, P. Bali, M. Pranpat, W. Fiskus, S. Boyapalle, S. Kumaraswamy, M. Balasis, B. Greedy, E. S. M. Armitage, et al.
Abrogation of Heat Shock Protein 70 Induction as a Strategy to Increase Antileukemia Activity of Heat Shock Protein 90 Inhibitor 17-Allylamino-Demethoxy Geldanamycin
Cancer Res., November 15, 2005; 65(22): 10536 - 10544.
[Abstract] [Full Text] [PDF]


Home page
Annals of Clinical & Laboratory ScienceHome page
E. J. Chung, S. Lee, E. A. Sausville, Q. Ryan, J. E. Karp, I. Gojo, W. G. Telford, M.-J. Lee, H. S. Kong, and J. B. Trepel
Histone Deacetylase Inhibitor Pharmacodynamic Analysis by Multiparameter Flow Cytometry
Ann. Clin. Lab. Sci., October 1, 2005; 35(4): 397 - 406.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. R. Acharya, A. Sparreboom, J. Venitz, and W. D. Figg
Rational Development of Histone Deacetylase Inhibitors as Anticancer Agents: A Review
Mol. Pharmacol., October 1, 2005; 68(4): 917 - 932.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. Cortes and H. Kantarjian
New Targeted Approaches in Chronic Myeloid Leukemia
J. Clin. Oncol., September 10, 2005; 23(26): 6316 - 6324.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
L. Chen, S. Meng, H. Wang, P. Bali, W. Bai, B. Li, P. Atadja, K. N. Bhalla, and J. Wu
Chemical ablation of androgen receptor in prostate cancer cells by the histone deacetylase inhibitor LAQ824
Mol. Cancer Ther., September 1, 2005; 4(9): 1311 - 1319.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. Bali, M. Pranpat, R. Swaby, W. Fiskus, H. Yamaguchi, M. Balasis, K. Rocha, H.-G. Wang, V. Richon, and K. Bhalla
Activity of Suberoylanilide Hydroxamic Acid Against Human Breast Cancer Cells with Amplification of Her-2
Clin. Cancer Res., September 1, 2005; 11(17): 6382 - 6389.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Bali, M. Pranpat, J. Bradner, M. Balasis, W. Fiskus, F. Guo, K. Rocha, S. Kumaraswamy, S. Boyapalle, P. Atadja, et al.
Inhibition of Histone Deacetylase 6 Acetylates and Disrupts the Chaperone Function of Heat Shock Protein 90: A NOVEL BASIS FOR ANTILEUKEMIA ACTIVITY OF HISTONE DEACETYLASE INHIBITORS
J. Biol. Chem., July 22, 2005; 280(29): 26729 - 26734.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. M. Melnick, K. Adelson, and J. D. Licht
The Theoretical Basis of Transcriptional Therapy of Cancer: Can It Be Put Into Practice?
J. Clin. Oncol., June 10, 2005; 23(17): 3957 - 3970.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
K. N. Bhalla
Epigenetic and Chromatin Modifiers As Targeted Therapy of Hematologic Malignancies
J. Clin. Oncol., June 10, 2005; 23(17): 3971 - 3993.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. C. Drummond, C. Marx, Z. Guo, G. Scott, C. Noble, D. Wang, M. Pallavicini, D. B. Kirpotin, and C. C. Benz
Enhanced Pharmacodynamic and Antitumor Properties of a Histone Deacetylase Inhibitor Encapsulated in Liposomes or ErbB2-Targeted Immunoliposomes
Clin. Cancer Res., May 1, 2005; 11(9): 3392 - 3401.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Rahmani, E. Reese, Y. Dai, C. Bauer, L. B. Kramer, M. Huang, R. Jove, P. Dent, and S. Grant
Cotreatment with Suberanoylanilide Hydroxamic Acid and 17-Allylamino 17-demethoxygeldanamycin Synergistically Induces Apoptosis in Bcr-Abl+ Cells Sensitive and Resistant to STI571 (Imatinib Mesylate) in Association with Down-Regulation of Bcr-Abl, Abrogation of Signal Transducer and Activator of Transcription 5 Activity, and Bax Conformational Change
Mol. Pharmacol., April 1, 2005; 67(4): 1166 - 1176.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Deininger, E. Buchdunger, and B. J. Druker
The development of imatinib as a therapeutic agent for chronic myeloid leukemia
Blood, April 1, 2005; 105(7): 2640 - 2653.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. George, P. Bali, S. Annavarapu, A. Scuto, W. Fiskus, F. Guo, C. Sigua, G. Sondarva, L. Moscinski, P. Atadja, et al.
Combination of the histone deacetylase inhibitor LBH589 and the hsp90 inhibitor 17-AAG is highly active against human CML-BC cells and AML cells with activating mutation of FLT-3
Blood, February 15, 2005; 105(4): 1768 - 1776.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Guo, C. Sigua, P. Bali, P. George, W. Fiskus, A. Scuto, S. Annavarapu, A. Mouttaki, G. Sondarva, S. Wei, et al.
Mechanistic role of heat shock protein 70 in Bcr-Abl-mediated resistance to apoptosis in human acute leukemia cells
Blood, February 1, 2005; 105(3): 1246 - 1255.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Z. Qian, X. Wang, S. K. Kachhap, Y. Kato, Y. Wei, L. Zhang, P. Atadja, and R. Pili
The Histone Deacetylase Inhibitor NVP-LAQ824 Inhibits Angiogenesis and Has a Greater Antitumor Effect in Combination with the Vascular Endothelial Growth Factor Receptor Tyrosine Kinase Inhibitor PTK787/ZK222584
Cancer Res., September 15, 2004; 64(18): 6626 - 6634.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Dai, M. Rahmani, S. J. Corey, P. Dent, and S. Grant
A Bcr/Abl-independent, Lyn-dependent Form of Imatinib Mesylate (STI-571) Resistance Is Associated with Altered Expression of Bcl-2
J. Biol. Chem., August 13, 2004; 279(33): 34227 - 34239.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. Bali, P. George, P. Cohen, J. Tao, F. Guo, C. Sigua, A. Vishvanath, A. Scuto, S. Annavarapu, W. Fiskus, et al.
Superior Activity of the Combination of Histone Deacetylase Inhibitor LAQ824 and the FLT-3 Kinase Inhibitor PKC412 against Human Acute Myelogenous Leukemia Cells with Mutant FLT-3
Clin. Cancer Res., August 1, 2004; 10(15): 4991 - 4997.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Dai, M. Rahmani, X.-Y. Pei, P. Dent, and S. Grant
Bortezomib and flavopiridol interact synergistically to induce apoptosis in chronic myeloid leukemia cells resistant to imatinib mesylate through both Bcr/Abl-dependent and -independent mechanisms
Blood, July 15, 2004; 104(2): 509 - 518.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
X.-Y. Pei, Y. Dai, and S. Grant
Synergistic Induction of Oxidative Injury and Apoptosis in Human Multiple Myeloma Cells by the Proteasome Inhibitor Bortezomib and Histone Deacetylase Inhibitors
Clin. Cancer Res., June 1, 2004; 10(11): 3839 - 3852.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. George, P. Bali, P. Cohen, J. Tao, F. Guo, C. Sigua, A. Vishvanath, W. Fiskus, A. Scuto, S. Annavarapu, et al.
Cotreatment with 17-Allylamino-Demethoxygeldanamycin and FLT-3 Kinase Inhibitor PKC412 Is Highly Effective against Human Acute Myelogenous Leukemia Cells with Mutant FLT-3
Cancer Res., May 15, 2004; 64(10): 3645 - 3652.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Guo, C. Sigua, J. Tao, P. Bali, P. George, Y. Li, S. Wittmann, L. Moscinski, P. Atadja, and K. Bhalla
Cotreatment with Histone Deacetylase Inhibitor LAQ824 Enhances Apo-2L/Tumor Necrosis Factor-Related Apoptosis Inducing Ligand-Induced Death Inducing Signaling Complex Activity and Apoptosis of Human Acute Leukemia Cells
Cancer Res., April 1, 2004; 64(7): 2580 - 2589.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Rahmani, C. Yu, Y. Dai, E. Reese, W. Ahmed, P. Dent, and S. Grant
Coadministration of the Heat Shock Protein 90 Antagonist 17-Allylamino- 17-demethoxygeldanamycin with Suberoylanilide Hydroxamic Acid or Sodium Butyrate Synergistically Induces Apoptosis in Human Leukemia Cells
Cancer Res., December 1, 2003; 63(23): 8420 - 8427.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nimmanapalli, R.
Right arrow Articles by Bhalla, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nimmanapalli, R.
Right arrow Articles by Bhalla, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online