This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Shao, J. Articles by Sheng, H. Search for Related Content PubMed PubMed Citation Articles by Shao, J. Articles by Sheng, H.

Prostaglandin E₂ Stimulates the Growth of Colon Cancer Cells via Induction of Amphiregulin¹

Department of Surgery and Sealy Center of Cancer Cell Biology, University of Texas Medical Branch, Galveston, Texas 77555 [J. S., H. G., M. B. E., H. S.] and National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, Maryland 20892 [S. B. L.]

	ABSTRACT

Top ABSTRACT Introduction Materials and Methods RESULTS Discussion REFERENCES

 
Prostaglandin E₂ (PGE₂), a major product of cyclooxygenase enzymes, is implicated in colorectal carcinogenesis and has been shown to stimulate the growth of human colorectal carcinoma cells. Here, we show that PGE₂ activated the cyclic AMP/protein kinase A pathway, which induced the expression of amphiregulin (AR), an epidermal growth factor family member, through activation of a cyclic AMP-responsive element in the AR promoter. AR exerted a mitogenic effect on LS-174 cells and partially mediated the PGE₂-induced growth stimulation. In addition, PGE₂, in collaboration with transforming growth factor- or K-Ras oncogene, synergistically induced AR expression and activated receptor tyrosine kinase-dependent signaling pathways. Our results provide novel mechanisms for cyclooxygenase-2 pro-oncogenic activity and suggest that PGE₂ may act with major oncogenic pathways in a synergistic fashion to activate the epidermal growth factor receptor signaling system through a ligand-dependent autocrine pathway.

	Introduction

Top ABSTRACT Introduction Materials and Methods RESULTS Discussion REFERENCES

 
It is now clear that COX³ -2 plays a role in the promotion of colorectal cancer (1) . However, the effects of PGs generated by COX-2 have largely been unexplored. PGE₂, a major product of COX enzymes, acts via specific transmembrane GPCRs (2) . Four PGE receptor (EP) subtypes have been identified. EP₁ receptor signals via generation of inositol 1,4,5-triphosphate and increased intracellular Ca²⁺. EP₂ and EP₄ receptors are coupled to Gs proteins and signal through increased cAMP, whereas the EP₃ receptor is coupled to inhibitory G proteins, which inhibit the generation of cAMP. It has been known for quite some time that short-term administration of PGE₂ causes significant stimulation of DNA synthesis; prolonged PGE₂ treatment markedly increases the weight, DNA, and RNA content of intestinal mucosa in rats (3) . PGE₂ stimulates proliferation and growth of human colorectal cancer cells (4, 5, 6) . These in vivo and in vitro findings suggest that COX-2-generated PGE₂ may provide a growth advantage to colorectal carcinomas.

The EGF family and their cognate receptors (EGFRs), now referred to as the ErbB family, play critical roles in intestinal epithelial growth and transformation (7) . Binding of the ligand to the EGFR leads to activation of RTKs that phosphorylate tyrosine residues of cellular signaling proteins and activate signaling pathways that are essential for intestinal epithelial proliferation (8) . EGFR cross-communicates with GPCRs and can be transactivated by GPCR agonists (9) . In a recent study, Pai et al. (4) reported that PGE₂ transactivates EGFR, triggers extracellular signaling-regulated kinase activation, and stimulates the proliferation of colorectal carcinoma cells. These studies demonstrate clearly that PGE₂ growth stimulation in colon cancer cells involves activation of the EGFR signaling system. We have reported previously that treatment with PGE₂ increases PI3K/Akt activity that is critical for the transformation of intestinal epithelial cells and that is required for the growth stimulation of PGE₂ in human colon cancer LS-174 cells (6) . To better understand the mechanism(s) by which PGE₂ activates RTK-dependent signaling pathways and stimulates colon cancer cell growth, we investigated the regulation and functional role of a PGE₂ target gene, AR, in PGE₂ trophic activity. PGE₂ signaled through Gs-coupled receptors and activated PKA which, in turn, induced the expression of AR, a member of the EGF family, through transcriptional activation of a CRE in the AR promoter. AR exerted a mitogenic effect on LS-174 cells and mediated the trophic effect of PGE₂ in human colon cancer cells. Moreover, PGE₂, in cooperation with major oncogenic pathways, synergistically induced AR transcription. These results provide additional mechanisms mediating COX-2/PGE₂ pro-oncogenic actions in colorectal carcinogenesis.

	Materials and Methods

Top ABSTRACT Introduction Materials and Methods RESULTS Discussion REFERENCES

 
Cell Culture.
LS-174 cells were purchased from American Type Culture Collection (Manassas, VA) and were maintained in McCoy’s 5A medium containing 10% fetal bovine serum. The growth of cells in Matrigel (Collaborative Biomedical, Bedford, MA) was carried out as described previously (6) . PGE₂ was purchased from Cayman Chemical (Ann Arbor, MI). H-89, LY-294002, and PD-153035 were purchased from Calbiochem (San Diego, CA). Dibutyryl cAMP was purchased from Sigma (St. Louis, MO). Amphiregulin, goat normal IgG, and anti-AR antibody were purchased from Research and Development Systems (Minneapolis, MN).

PKA Assay.
cAMP-dependent PKA activity was measured by determining the transfer of the phosphate group of ATP to a synthetic peptide, which is a substrate for PKA (Calbiochem). The experiment was carried out according to the manufacturer’s instructions.

GeneChip Hybridization.
This experiment was performed in the University of Iowa DNA Facility (10) . Briefly, cRNA preparations from PGE₂ or vehicle-treated LS-174 cells were used to inoculate human GeneChip (U95A) expression arrays (Affymetrix, Inc.) based on a recommended protocol. Three replicate hybridizations were performed using PGE₂ or vehicle-treated RNA samples. Alterations in RNA transcript levels were analyzed using Affymetrix Analysis Suit 4.0 software. The fold change in expression between groups was calculated from the mean average difference scores.

RNA Extraction and Northern Blot Analysis.
The extraction of total cellular RNA was carried out as described previously (11) . RNA samples (20 µg/lane) were separated on formaldehyde-agarose gels and blotted onto nitrocellulose membranes. The blots were hybridized with cDNA probes labeled with [-³²P]dCTP by random primer extension (Stratagene, La Jolla, CA). After hybridization and washes, the blots were subjected to autoradiography.

Transient Transfection and Luciferase Assay.
The assays to determine the activity of the AR promoter were described previously (11) . Reporter constructs pGL2-A, pGL2-B, pGL2-BCRE, pGL2-C, and pGL2-CCRE containing the 5'-flanking region of the human AR gene were described previously (12) . For transient transfections, cells were cotransfected with 0.5 µg of one of the AR firefly luciferase plasmid constructs and 3 ng of the pRL-SV40 plasmid, containing the Renilla luciferase gene (Promega Corp., Madison, WI), using the FuGENE 6 procedure (Roche, Indianapolis, IN) as described in the manufacturer’s protocol. Transfected cells were lysed at the indicated times for luciferase assay. Firefly and Renilla luciferase activities were measured using a Dual-Luciferase Reporter assay system (Promega) and a luminometer. Firefly luciferase values were standardized to Renilla values.

Immunoblot Analysis.
Immunoblot analysis was performed as described previously (11) . The anti-phosphorylated Akt antibody and anti-pCREB antibody were purchased from Cell Signaling (Beverly, MA).

Real-Time RT-PCR.
AR expression was quantified using real-time quantitative PCR or TaqMan technique (Applied Biosystems, Foster City, CA). The sequence of the primer/probe set was based on AR mRNA sequence (GenBank NM_001657) and includes: probe, AGTCCAGCTTAGAAGAC; forward primer, GCCTTTATGTCTGCTGTGATCCT; and reverse primer, CCTCAGCTTCTCCTTCATATTTCCT. 18S rRNA TaqMan assay reagent was used for internal control. One-step RT-PCR was performed with 40 ng of RNA for both target gene and endogenous controls. Duplicate C_T values were analyzed in Microsoft Excel using the comparative C_T (C_T) method as described by the manufacturer (Applied Biosystems). The amount of target (2^-CT) was obtained as normalized to 18 S and relative to a calibrator.

Data Analysis.
All statistical analyses were performed on a personal computer with the StatView 5.0.1 software (SAS Institute, Inc., Cary, NC). Analyses between multiple groups were determined by ANOVA. Analyses between two groups were determined using the unpaired Student t test. Differences of P < 0.05 were considered statistically significant.

	RESULTS

Top ABSTRACT Introduction Materials and Methods RESULTS Discussion REFERENCES

 
PGE₂ Stimulated LS-174 Cell Growth through the cAMP/PKA Pathway. PGE₂ may signal through four EP receptor subtypes, which act through different signaling pathways (2) . By using single-cell [Ca²⁺]_i imaging, we found that PGE₂ treatment did not alter intracellular Ca²⁺ levels in LS-174 cells (data not shown). In contrast, PGE₂ activated the cAMP/PKA signaling pathway (Fig. 1A) . Stimulation with PGE₂ rapidly increased PKA activity by 7-fold in LS-174 cells. A selective PKA inhibitor, H-89, at 10 µM completely blocked the PGE₂-induced PKA activity. Similar results were observed in LS-174 cells that were treated with dibutyryl cAMP (0.1 mM), suggesting that PGE₂ signaled through Gs protein-coupled receptors and increased the levels of cAMP in LS-174 cells. In agreement with previous studies (13) that inhibition of PKA activity with antisense oligodeoxynucleotide impairs the growth of LS-174 cells, 10 µM H-89 significantly inhibited LS-174 cell growth in Matrigel (Fig. 1B) . LS-174 cells formed colonies in Matrigel, and PGE₂ treatment increased the volume of colonies 4-fold. Addition of H-89 blocked the PGE₂ stimulation of LS-174 cell growth in Matrigel. Thus, PKA activation appeared to be critical for PGE₂ stimulation of LS-174 cell growth.

View larger version (34K): [in this window] [in a new window]   Fig. 1. PGE2 activation of the cAMP/PKA pathway. A, PGE2 induction of PKA. LS-174 cells were serum deprived for 48 h and then treated with PGE2 (0.1 µM) or dibutyryl cAMP (0.1 mM) for 10 min in the presence or absence of H-89 at the indicated concentrations. PKA activity was measured by determining the transfer of the phosphate group of ATP to a synthetic peptide, which is a substrate for PKA. Results were normalized by the controls and expressed as relative PKA activity. Plotted is the means of assays performed in triplicate of two independent experiments; bars, SD. *, P < 0.05. B, PKA activity and LS-174 cell growth in Matrigel. LS-174 cells were grown in Matrigel with indicated treatment for 10 days (V, vehicle; E2, 0.1 µM PGE2; H-89, 10 µM H-89). Colonies were photographed (x40), and the size of 60 colonies from each group was measured. Relative colony size to the control group is plotted. *, P < 0.05. This experiment was repeated three times.

View larger version (25K): [in this window] [in a new window]   Fig. 2. PGE2 induction of AR expression. A, Northern analysis of AR mRNA. LS-174 cells were serum deprived for 48 h and then treated with 0.1 µM PGE2 for the indicated times. Total RNA was extracted, and levels of AR were detected using Northern blot analysis. The results were densitometrically analyzed using Image J software and standardized by the control values (0 h). Plotted is the mean of three independent experiments; bars, SD. *, P < 0.05. B, PGE2 induction of AR promoter activity. LS-174 cells were transiently transfected with pGL2-A containing the nucleotide sequence of 763 bp (-850 to -87) of AR 5'-flanking region. Nucleotide numbers refer to promoter sequence (12 , 15) . Cells were serum deprived for 24 h before vehicle (V), H-89, PGE2 (E2), or PGE2 plus H-89 (E2 + H-89) treatment. Firefly and Renilla luciferase activities were measured, and firefly luciferase values were standardized to Renilla values. Renilla Adjusted RLU, Renilla-adjusted luciferase values standardized to the controls. Plotted is the mean of assays performed in quadruplicate, based on three independent experiments; bars, SD. *, P < 0.05.

Roles of the CRE in PGE₂ Activation of the AR Promoter.
cAMP stimulates the expression of target genes through a conserved CRE. A CRE site has been identified previously in the AR promoter (15) . The 155-bp sequence immediately upstream of the 5' end of the mRNA start site includes a consensus TATA box (-238 to -233) and a CRE (-274 to -267). To elucidate the role of the CRE site in PGE₂-induced AR transcription, LS-174 cells were transfected with pGL2-B, which contains 136 nucleotides (-328 to -192) including the Wilms’ tumor suppressor WT1 responsive element, the CRE, and the TATA box. Luciferase activity was increased (5-fold) by PGE₂ stimulation compared with vehicle-treated cells (Fig. 3A) . Mutation of the CRE site from GACGTCA to GACGTAC (pGL2-BCRE) resulted in a significant reduction of AR promoter activity and almost completely attenuated PGE₂-induced AR transcription. Using pGL2-C and pGL2-CCRE report vectors, which contain only 83 nucleotides (-275 to -192) including the CRE and the TATA box, we confirmed the critical role of the CRE in PGE₂-induced AR transcription (Fig. 3B) . Transcriptional activation of the CRE requires activated transcription factors of the CREB protein, which is phosphorylated at Ser-133 by the PKA catalytic subunit and interacts with the CRE. PGE₂ treatment significantly increased the phosphorylation of CREB protein at Ser-133 in LS-174 cells (Fig. 3C) .

View larger version (31K): [in this window] [in a new window]   Fig. 3. PGE2 activation of the CRE in the AR promoter. A, the role of the CRE in PGE2 activation of AR transcription. LS-174 cells were transiently transfected with pGL2-B or pGL2-BCRE (pGL2-B). Cells were then treated with vehicle (V) or PGE2 (0.1 µM; E2) for 6 h. Firefly and Renilla luciferase activities were measured and standardized. Plotted is the mean of assays performed in quadruplicate; bars, SD. *, P < 0.05. Results shown are representative of five separate experiments. B, LS-174 cells were transiently transfected with pGL2-C or pGL2-CCRE (pGL2-C). Cells were then treated with vehicle (V) or PGE2 (0.1 µM; E2) for 6 h. Firefly and Renilla luciferase activities were measured and standardized. Plotted is the mean of assays performed in quadruplicate; bars, SD. *, P < 0.05. Results shown are representative of five separate experiments. C, PGE2 induction of pCREB. LS-174 cells were serum deprived for 48 h before PGE2 treatment. Cellular protein was collected at the indicated time points for detection of phosphorylated CREB (Ser-133). This experiment was repeated three times.

View larger version (39K): [in this window] [in a new window]   Fig. 4. AR in PGE2 trophic action. A, AR stimulation of LS-174 cell growth. Left panel, 104 LS-174 cells were seeded in 12-well plates and treated with vehicle (V), AR (100 ng/ml), or AR plus PD-153035 (1 µM) for 4 days. *, P < 0.05. Middle panel, LS-174 cells were seeded in 24-well plates and treated with vehicle (V), AR (100 ng/ml), or AR plus anti-AR antibody (20 µg/ml) for 24 h. [3H]]Thymidine incorporation was measured. *, P < 0.05. Right panel, LS-174 cells were grown in Matrigel and treated with vehicle (V), AR (100 ng/ml), or AR plus PD-153035 (1 µM) for 10 days. Relative colony size was determined. *, P < 0.05. All growth studies in A were repeated three times. B, AR and PGE2 induction of PI3K activity. LS-174 cells were serum deprived for 48 h before the indicated treatments (AR, 100 ng/ml; PGE2, 0.1 µM; PD153035, 1 µM). Protein lysates were extracted at the indicated time points and subjected to Western analysis. Results were similar in two independent experiments. C, inhibition of RTK and PGE2 growth stimulation. Left panel, 2.5 x 104 LS-174 cells were seeded in 12-well plates and grown in serum-deprived medium with the indicated treatments for 4 days. V, vehicle; E2, PGE2 (0.1 µM); PD, PD-153035 (1 µM). Cell numbers were counted, and values are means from triplicate wells; bars, SD. *, P < 0.05. Results were similar in three independent experiments. Middle panel, serum-deprived LS-174 cells were treated with vehicle (V) or PGE2 (0.1 µM) in the presence of normal IgG or anti-AR antibody (AR) for 24 h. [3H]]Thymidine incorporation was measured. *, P < 0.05. Results were similar in two independent experiments. Right panel, LS-174 cells were grown in Matrigel with the indicated treatment for 10 days. V, vehicle; E2, PGE2 (0.1 µM); PD, PD-153035 (1 µM). Colonies were photographed, and the size of 60 colonies from each group was measured. Relative colony size to the control group is shown. *, P < 0.05. Results were similar in two independent experiments.

Synergy between PGE₂ and Major Oncogenic Pathways.
Malignant transformation of cells is an extremely complex process and involves a number of oncogenic signaling pathways, where cross-communication often occurs. TGF- plays critical roles in colorectal carcinogenesis and often acts through an autocrine loop (16) . Because both PGE₂ and TGF- may exert tumor-promoting effects to colon cancer cells, we sought to determine whether PGE₂ and TGF- act in a cooperative manner. As demonstrated in Fig. 5A , both PGE₂ and TGF- induced the levels of pAkt and pCREB; however, combined treatment with PGE₂ and TGF- resulted in a marked induction of PI3K activity and CREB activation. Next, we investigated whether PGE₂ and TGF- cooperatively induced AR transcription. LS-174 cells were transfected with pGL2-A and then treated with TGF- or PGE₂ plus TGF-. TGF- increased only luciferase activity 2-fold; PGE₂ increased AR promoter activity 7-fold. However, the combination of PGE₂ and TGF- increased luciferase activity 17-fold, suggesting that PGE₂ and TGF- synergistically activated the AR promoter. To demonstrate that the synergistic transcription of AR resulted from PGE₂ and TGF- treatment produced transcripts, we used real-time PCR to determine the expression of AR mRNA. PGE₂ and TGF- synergistically increased the levels of AR mRNA (Fig. 5C) . Interestingly, a stronger synergy was observed at 24 h after PGE₂ and TGF- treatment, although PGE₂ alone had no significant effect on AR expression at this time point.

View larger version (27K): [in this window] [in a new window]   Fig. 5. Synergy between PGE2 and oncogenic pathways. A, PGE2 and TGF- induction of pCREB and pAkt. LS-174 cells were serum deprived for 48 h before the indicated treatment. E2, PGE2 (0.1 µM); , TGF- (100 ng/ml). Protein lysates were extracted after a 2-h incubation and subjected to Western analysis for pAkt and pCREB. Results shown are representative of three separate experiments. B, synergistic induction of AR transcription by PGE2 and TGF-. LS-174 cells were transiently transfected with pGL2-A and treated with vehicle (V), PGE2 (E2), TGF- (), or both PGE2 and TGF-. Firefly and Renilla luciferase activities were measured, and firefly luciferase values were standardized to Renilla values. Plotted is the mean of assays performed in quadruplicate; bars, SD. *, P < 0.05. Results were similar in five independent experiments. C, synergistic induction of AR mRNA by PGE2 and TGF- in LS-174 cells. LS-174 cells were subjected to the indicated treatment (V, vehicle; E2, 0.1 µM PGE2; , 100 ng/ml TGF-). mRNA was used as a template for a real-time RT-PCR assay to measure relative levels of AR expression. *, P < 0.05. Results were similar in two independent experiments. D, synergistic induction of AR mRNA by PGE2 and TGF- in 293 cells. Human 293 cells were subjected to the indicated treatment (V, vehicle; E2, 0.1 µM PGE2; , 100 ng/ml TGF-). mRNA was used as a template for a real-time RT-PCR assay to measure relative levels of AR expression. *, P < 0.05. Results were similar in two independent experiments. E, synergistic induction of AR transcription by PGE2 and K-Ras. LS-174 cells were cotransfected with pGL2-A and pcDNA-3/K-RasVal12 (K) or pGL2-A and empty pcDNA-3 vector (V). Cells were serum deprived for 24 h before a 6-h PGE2 treatment. Firefly and Renilla luciferase activities were measured, and firefly luciferase values were standardized to Renilla values. Plotted is the mean of assays performed in quadruplicate; bars, SD. *, P < 0.05. Results were similar in four independent experiments.

The K-Ras oncogene plays a key role during the adenoma-to-carcinoma sequence of events involved in the neoplastic transformation of colonic epithelial cells. We found that PGE₂ and K-Ras also induced AR transcription in a synergistic manner (Fig. 5E) . Ectopic expression of K-Ras^Val12 increased AR promoter activity 6-fold compared with empty vector-transfected LS-174 cells. PGE₂ treatment increased luciferase activity 7-fold in vector-transfected cells; however, a 27-fold increase was observed in K-Ras^Val12-transfected cells that were treated with PGE₂.

	Discussion

Top ABSTRACT Introduction Materials and Methods RESULTS Discussion REFERENCES

 
cAMP-dependent PKA consists of two isozymes, type I and type II, which are distinguished by their regulatory subunits (RI and RII). Increased expression of the type I regulatory subunit (RI) has been correlated to the growth of an array of tumor cells including colon cancer cells (13) . The ratio of RI to RII is significantly elevated in human colorectal carcinomas (18) . The LS-174 cell line contains mainly type I PKA and is an excellent model for investigation of pro-oncogenic roles of the cAMP/PKA pathway (19) . Treatment with RI antisense oligonucleotide inhibits the growth of LS-174 cells (13) . Results from this study demonstrated that PGE₂ signaled through the Gs-coupled EP receptor and increased the activity of the cAMP/PKA pathway, which was essential for PGE₂ growth-stimulatory activity. We show that AR, an EGFR ligand, was up-regulated by PGE₂-induced cAMP/PKA activity and was a mediator for the PGE₂ growth-stimulatory effect in LS-174 cells. Thus, our results establish a link between three crucial proneoplastic signaling systems, the COX-2/PGE₂ pathway, the cAMP/PKA pathway, and the EGFR signaling system, where AR plays a central role. In this model, COX-2-generated PGE₂ stimulates PKA activation through RI; increased PKA activity induces the transcription of AR, which then activates RTK signaling pathways and stimulates proliferation and growth of colorectal carcinoma cells. Previous studies show that genetic disruption of either COX-2 or EP₂ receptor decreases the number and size of intestinal polyps in Apc716 mice (20) . Tumor cell proliferation is significantly inhibited in adenomas of COX-2-deficient Apc716 mice. These findings indicate the potential link between COX-2, PKA, and tumor cell proliferation in vivo. COX-2/PGE₂-promoted tumor angiogenesis is thought to be one of the underlying mechanisms. Additional experiments are required to determine the roles of RTK in these animal models.

Our studies demonstrate that in response to PGE₂ treatment, the expression of AR is significantly increased in LS-174 cells. Cumulative evidence suggests that AR exerts tumor-promoting effects on colorectal carcinomas. AR mRNA is expressed in 60–70% of primary and metastatic human colorectal carcinomas but in only 2–7% of normal human colonic mucosa (21) . AR plays critical roles in colon cancer cell proliferation and transformation that are required for the growth of human colon carcinoma xenografts (14) . In agreement with these studies, we found that AR stimulated the proliferation and growth of LS-174 cells and mediated the PGE₂-induced growth stimulation of colon cancer cells.

The CRE consists of an 8-bp palindrome (TGACGTCA) and is typically found within 100 nucleotides of the TATA box. Although the CRE is conserved in the AR promoter, thus far, the role of the CRE in the regulation of AR transcription is not completely understood (15) . Wilms tumor suppressor transcription factor (WT1) activates the CRE in the AR promoter through an undefined mechanism in human osteosarcoma cells (12) . Here, we show that the CRE is critical for the PGE₂-induced transcriptional activation of AR in LS-174 cells. CRE sites are frequently located adjacent to other regulatory elements, such as Sp1. Several Sp1 sequences are found adjacent to the CRE of the AR promoter, and their functional roles are under investigation. These results suggest that genes that contain an active CRE site in their promoter may be potentially regulated by PGE₂. Further identifying PGE₂/PKA target genes and their functional roles will contribute to the understanding of the molecular pathway of colorectal carcinogenesis.

The mechanisms by which GPCR transactivates RTK signaling pathways are complex. It was shown that PGE₂-mediated transactivation of EGFR and downstream signaling involves TGF-, an EGFR ligand, which is likely released by the c-Src-activated matrix metalloproteinase pathway (4) . In the present study, we demonstrate that PGE₂ activated EGFR through induction of AR expression. Apparently, PGE₂ may target multiple EGF family members through different mechanisms in colon cancer cells. The PI3K/Akt pathway acts as a transducer of input initiated by growth factor receptors and plays critical roles in the growth and transformation of colorectal carcinoma cells (22) . We have reported that the PGE₂ growth-stimulatory effect on LS-174 cells is dependent on PI3K activity (6) . Results from this study demonstrate that PGE₂-induced PI3K activation was dependent on EGFR tyrosine kinase activity, which was likely activated by PGE₂-induced autocrine AR.

Although it is now clear that COX-2 plays an important role in the promotion of colorectal cancer (1) , COX-2 is not defined as an oncogene. In previous studies (5 , 6) , we have demonstrated that PGE₂ activates oncogenic signaling pathways and enhances transformed phenotypes including cell proliferation, motility, and morphogenesis. In the present study, we show that PGE₂, in conjunction with TGF- and the K-Ras oncogene, synergistically induced AR transcription and stimulated the activation of PKA and PI3K. These results suggest that PGE₂ alone may exert temporary effects on tumor cells; however, in combination with other oncogenic signaling pathways, PGE₂ may play a key role in neoplastic transformation. To our knowledge, this study is the first to demonstrate that PGE₂ acts with major oncogenic signaling pathways in a synergistic manner, thus providing additional insight into the mechanisms by which COX-2/PGE₂ promotes colorectal carcinogenesis.

In conclusion, our results link the COX-2/PGE₂ pathway to the pro-oncogenic cAMP/PKA pathway and the oncogenic EGFR signaling system, where an EGFR ligand, AR, serves as a central mediator. AR is up-regulated by the PGE₂/cAMP/PKA pathway and, in turn, activates EGFR tyrosine kinases that transduce mitogenic signals and stimulate the growth of colorectal carcinoma cells. Future studies are aimed at the transcriptional regulation of gene expression through the PGE₂/PKA/CRE pathway and the synergistic cooperation between PGE₂ and major oncogenic pathways, which will be critical for the understanding of COX-2 proneoplastic activity in colorectal carcinogenesis.

	ACKNOWLEDGMENTS

 
We thank Dr. Raymond N. DuBois for valuable comments on the manuscript and Dr. Kevin Knudtson (University of Iowa) for performing Affymetrix GeneChip Assays.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Supported by the John Sealy Memorial Endowment Fund for Biomedical Research and the Gastrointestinal Research Interdisciplinary Program (both to H. S.).

² To whom requests for reprints should be addressed, at Department of Surgery, The University of Texas Medical Branch, Galveston, TX 77555. Phone: (409) 772-6661; E-mail: hosheng{at}utmb.edu

³ The abbreviations used are: COX, cyclooxygenase; PG, prostaglandin; GPCR, G protein-coupled receptor; Gs, stimulatory G; cAMP, cyclic AMP; EGF, epidermal growth factor; EGFR, EGF receptor; RTK, receptor tyrosine kinase; PI3K, phosphatidylinositol 3-kinase; AR, amphiregulin; PKA, protein kinase A; CRE, cAMP-responsive element; CREB, CRE binding; RT-PCR, reverse transcription-PCR; TGF, transforming growth factor.

Received 3/18/03. Revised 6/26/03. Accepted 7/11/03.

	REFERENCES

Top ABSTRACT Introduction Materials and Methods RESULTS Discussion REFERENCES

 

1. Williams C. S., Mann M., DuBois R. N. The role of cyclooxygenases in inflammation, cancer, and development. Oncogene, 18: 7908-7916, 1999.[Medline]
2. Breyer M. D., Breyer R. M. Prostaglandin receptors: their role in regulating renal function. Curr. Opin. Nephrol. Hypertens., 9: 23-29, 2000.[Medline]
3. Reinhart W. H., Muller O., Halter F. Influence of long-term 16,16-dimethyl prostaglandin E2 treatment on the rat gastrointestinal mucosa. Gastroenterology, 85: 1003-1010, 1983.[Medline]
4. Pai R., Soreghan B., Szabo I. L., Pavelka M., Baatar D., Tarnawski A. S. Prostaglandin E2 transactivates EGF receptor: a novel mechanism for promoting colon cancer growth and gastrointestinal hypertrophy. Nat. Med., 8: 289-293, 2002.[Medline]
5. Sheng H., Shao J., Morrow J. D., Beauchamp R. D., DuBois R. N. Modulation of apoptosis and Bcl-2 expression by prostaglandin E₂ in human colon cancer cells. Cancer Res., 58: 362-366, 1998.[Abstract/Free Full Text]
6. Sheng H., Shao J., Washington M. K., DuBois R. N. Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J. Biol. Chem., 276: 18075-18081, 2001.[Abstract/Free Full Text]
7. Oldham S. M., Cox A. D., Reynolds E. R., Sizemore N. S., Coffey R. J. J., Der C. J. Ras, but not Src, transformation of RIE-1 epithelial cells is dependent on activation of the mitogen-activated protein kinase cascade. Oncogene, 16: 2565-2573, 1998.[Medline]
8. Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell, 103: 211-225, 2000.[Medline]
9. Luttrell L. M., Daaka Y., Lefkowitz R. J. Regulation of tyrosine kinase cascades by G-protein-coupled receptors. Curr. Opin. Cell Biol., 11: 177-183, 1999.[Medline]
10. Reese J., Das S. K., Paria B. C., Lim H., Song H., Matsumoto H., Knudtson K. L., DuBois R. N., Dey S. K. Global gene expression analysis to identify molecular markers of uterine receptivity and embryo implantation. J. Biol. Chem., 276: 44137-44145, 2001.[Abstract/Free Full Text]
11. Shao J., Sheng H., Inoue H., Morrow J. D., DuBois R. N. Regulation of constitutive cyclooxygenase-2 expression in colon carcinoma cells. J. Biol. Chem., 275: 33951-33956, 2000.[Abstract/Free Full Text]
12. Lee S. B., Huang K., Palmer R., Truong V. B., Herzlinger D., Kolquist K. A., Wong J., Paulding C., Yoon S. K., Gerald W., Oliner J. D., Haber D. A. The Wilms tumor suppressor WT1 encodes a transcriptional activator of amphiregulin. Cell, 98: 663-673, 1999.[Medline]
13. Yokozaki H., Budillon A., Tortora G., Meissner S., Beaucage S. L., Miki K., Cho-Chung Y. S. An antisense oligodeoxynucleotide that depletes RI subunit of cyclic AMP-dependent protein kinase induces growth inhibition in human cancer cells. Cancer Res., 53: 868-872, 1993.[Abstract/Free Full Text]
14. De Luca A., Arra C., D’Antonio A., Casamassimi A., Losito S., Ferraro P., Ciardiello F., Salomon D. S., Normanno N. Simultaneous blockage of different EGF-like growth factors results in efficient growth inhibition of human colon carcinoma xenografts. Oncogene, 19: 5863-5871, 2000.[Medline]
15. Plowman G. D., Green J. M., McDonald V. L., Neubauer M. G., Disteche C. M., Todaro G. J., Shoyab M. The amphiregulin gene encodes a novel epidermal growth factor-related protein with tumor-inhibitory activity. Mol. Cell. Biol., 10: 1969-1981, 1990.[Abstract/Free Full Text]
16. Gangarosa L. M., Sizemore N., Graves-Deal R., Oldham S. M., Der C. J., Coffey R. J. A raf-independent epidermal growth factor receptor autocrine loop is necessary for Ras transformation of rat intestinal epithelial cells. J. Biol. Chem., 272: 18926-18931, 1997.[Abstract/Free Full Text]
17. Turini M. E., DuBois R. N. Cyclooxygenase-2: a therapeutic target. Annu. Rev. Med., 53: 35-57, 2002.[Medline]
18. Bradbury A. W., Carter D. C., Miller W. R., Cho-Chung Y. S., Clair T. Protein kinase A (PK-A) regulatory subunit expression in colorectal cancer and related mucosa. Br. J. Cancer, 69: 738-742, 1994.[Medline]
19. Ally S., Tortora G., Clair T., Grieco D., Merlo G., Katsaros D., Ogreid D., Doskeland S. O., Jahnsen T., Cho-Chung Y. S. Selective modulation of protein kinase isozymes by the site-selective analog 8-chloroadenosine 3',5'-cyclic monophosphate provides a biological means for control of human colon cancer cell growth. Proc. Natl. Acad. Sci. USA, 85: 6319-6322, 1988.[Abstract/Free Full Text]
20. Sonoshita M., Takaku K., Sasaki N., Sugimoto Y., Ushikubi F., Narumiya S., Oshima M., Taketo M. M. Acceleration of intestinal polyposis through prostaglandin receptor EP2 in Apc(716) knockout mice. Nat. Med., 7: 1048-1051, 2001.[Medline]
21. Ciardiello F., Kim N., Saeki T., Dono R., Persico M. G., Plowman G. D., Garrigues J., Radke S., Todaro G. J., Salomon D. S. Differential expression of epidermal growth factor-related proteins in human colorectal tumors. Proc. Natl. Acad. Sci. USA, 88: 7792-7796, 1991.[Abstract/Free Full Text]
22. Nguyen K. T., Wang W. J., Chan J. L., Wang L. H. Differential requirements of the MAP kinase and PI3 kinase signaling pathways in Src versus insulin and IGF-1 receptors-induced growth and transformation of rat intestinal epithelial cells. Oncogene, 19: 5385-5397, 2000.[Medline]

This article has been cited by other articles:

				G. Ning, H. Ouyang, S. Wang, X. Chen, B. Xu, J. Yang, H. Zhang, M. Zhang, and G. Xia 3',5'-Cyclic Adenosine Monophosphate Response Element Binding Protein Up-Regulated Cytochrome P450 Lanosterol 14{alpha}-Demethylase Expression Involved in Follicle-Stimulating Hormone-Induced Mouse Oocyte Maturation Mol. Endocrinol., July 1, 2008; 22(7): 1682 - 1694. [Abstract] [Full Text] [PDF]

				D. Chinnappan, X. Qu, D. Xiao, A. Ratnasari, and H. C. Weber Human gastrin-releasing peptide receptor gene regulation requires transcription factor binding at two distinct CRE sites Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G153 - G162. [Abstract] [Full Text] [PDF]

				N. B. Merchant, I. Voskresensky, C. M. Rogers, B. LaFleur, P. J. Dempsey, R. Graves-Deal, F. Revetta, A. C. Foutch, M. L. Rothenberg, M. K. Washington, et al. TACE/ADAM-17: A Component of the Epidermal Growth Factor Receptor Axis and a Promising Therapeutic Target in Colorectal Cancer Clin. Cancer Res., February 15, 2008; 14(4): 1182 - 1191. [Abstract] [Full Text] [PDF]

				V. Leone, A. di Palma, P. Ricchi, F. Acquaviva, M. Giannouli, A. M. Di Prisco, F. Iuliano, and A. M. Acquaviva PGE2 inhibits apoptosis in human adenocarcinoma Caco-2 cell line through Ras-PI3K association and cAMP-dependent kinase A activation Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G673 - G681. [Abstract] [Full Text] [PDF]

				C. M. Wayne, H.-Y. Fan, X. Cheng, and J. S. Richards Follicle-Stimulating Hormone Induces Multiple Signaling Cascades: Evidence that Activation of Rous Sarcoma Oncogene, RAS, and the Epidermal Growth Factor Receptor Are Critical for Granulosa Cell Differentiation Mol. Endocrinol., August 1, 2007; 21(8): 1940 - 1957. [Abstract] [Full Text] [PDF]

				J. Shao and H. Sheng Prostaglandin E2 Induces the Expression of IL-1{alpha} in Colon Cancer Cells J. Immunol., April 1, 2007; 178(7): 4097 - 4103. [Abstract] [Full Text] [PDF]

				M. D. Castellone, H. Teramoto, and J. S. Gutkind Cyclooxygenase-2 and Colorectal Cancer Chemoprevention: The {beta}-Catenin Connection Cancer Res., December 1, 2006; 66(23): 11085 - 11088. [Abstract] [Full Text] [PDF]

				R. Tammali, K. V. Ramana, S. S. Singhal, S. Awasthi, and S. K. Srivastava Aldose Reductase Regulates Growth Factor-Induced Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Colon Cancer Cells Cancer Res., October 1, 2006; 66(19): 9705 - 9713. [Abstract] [Full Text] [PDF]

				J. Castillo, E. Erroba, M. J. Perugorria, M. Santamaria, D. C. Lee, J. Prieto, M. A. Avila, and C. Berasain Amphiregulin contributes to the transformed phenotype of human hepatocellular carcinoma cells. Cancer Res., June 15, 2006; 66(12): 6129 - 6138. [Abstract] [Full Text] [PDF]

				G. J. Kelloff, S. M. Lippman, A. J. Dannenberg, C. C. Sigman, H. L. Pearce, B. J. Reid, E. Szabo, V. C. Jordan, M. R. Spitz, G. B. Mills, et al. Progress in Chemoprevention Drug Development: The Promise of Molecular Biomarkers for Prevention of Intraepithelial Neoplasia and Cancer--A Plan to Move Forward Clin. Cancer Res., June 15, 2006; 12(12): 3661 - 3697. [Abstract] [Full Text] [PDF]

				M. Shimada, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, and J. S. Richards Paracrine and Autocrine Regulation of Epidermal Growth Factor-Like Factors in Cumulus Oocyte Complexes and Granulosa Cells: Key Roles for Prostaglandin Synthase 2 and Progesterone Receptor Mol. Endocrinol., June 1, 2006; 20(6): 1352 - 1365. [Abstract] [Full Text] [PDF]

				S. M. Lippman and J. J. Lee Reducing the "Risk" of Chemoprevention: Defining and Targeting High Risk--2005 AACR Cancer Research and Prevention Foundation Award Lecture. Cancer Res., March 15, 2006; 66(6): 2893 - 2903. [Abstract] [Full Text] [PDF]

				T. Otani, K. Yamaguchi, E. Scherl, B. Du, H.-H. Tai, M. Greifer, L. Petrovic, T. Daikoku, S. K. Dey, K. Subbaramaiah, et al. Levels of NAD+-dependent 15-hydroxyprostaglandin dehydrogenase are reduced in inflammatory bowel disease: evidence for involvement of TNF-{alpha} Am J Physiol Gastrointest Liver Physiol, February 1, 2006; 290(2): G361 - G368. [Abstract] [Full Text] [PDF]

				S. M. O'Reilly, M. O. Leonard, N. Kieran, K. M. Comerford, E. Cummins, M. Pouliot, S. B. Lee, and C. T. Taylor Hypoxia induces epithelial amphiregulin gene expression in a CREB-dependent manner Am J Physiol Cell Physiol, February 1, 2006; 290(2): C592 - C600. [Abstract] [Full Text] [PDF]

				J. Shao, G. G. Sheng, R. C. Mifflin, D. W. Powell, and H. Sheng Roles of Myofibroblasts in Prostaglandin E2-Stimulated Intestinal Epithelial Proliferation and Angiogenesis Cancer Res., January 15, 2006; 66(2): 846 - 855. [Abstract] [Full Text] [PDF]

				D. Melisi, R. Caputo, V. Damiano, R. Bianco, B. M. Veneziani, A R. Bianco, S. De Placido, F. Ciardiello, and G. Tortora Zoledronic acid cooperates with a cyclooxygenase-2 inhibitor and gefitinib in inhibiting breast and prostate cancer Endocr. Relat. Cancer, December 1, 2005; 12(4): 1051 - 1058. [Abstract] [Full Text] [PDF]

				L. J. Wirth, R. I. Haddad, N. I. Lindeman, X. Zhao, J. C. Lee, V. A. Joshi, C. M. Norris Jr, and M. R. Posner Phase I Study of Gefitinib Plus Celecoxib in Recurrent or Metastatic Squamous Cell Carcinoma of the Head and Neck J. Clin. Oncol., October 1, 2005; 23(28): 6976 - 6981. [Abstract] [Full Text] [PDF]

				M. S. Choe, X. Zhang, H. J. C. Shin, D. M. Shin, and Z. Chen Interaction between epidermal growth factor receptor- and cyclooxygenase 2-mediated pathways and its implications for the chemoprevention of head and neck cancer Mol. Cancer Ther., September 1, 2005; 4(9): 1448 - 1455. [Abstract] [Full Text] [PDF]

				S. M. Lippman, N. Gibson, K. Subbaramaiah, and A. J. Dannenberg Combined Targeting of the Epidermal Growth Factor Receptor and Cyclooxygenase-2 Pathways Clin. Cancer Res., September 1, 2005; 11(17): 6097 - 6099. [Full Text] [PDF]

				R. Wu, A. L. Abramson, M. J. Shikowitz, A. J. Dannenberg, and B. M. Steinberg Epidermal Growth Factor-Induced Cyclooxygenase-2 Expression Is Mediated through Phosphatidylinositol-3 Kinase, Not Mitogen-Activated Protein/Extracellular Signal-Regulated Kinase Kinase, in Recurrent Respiratory Papillomas Clin. Cancer Res., September 1, 2005; 11(17): 6155 - 6161. [Abstract] [Full Text] [PDF]

				J. Shao, C. Jung, C. Liu, and H. Sheng Prostaglandin E2 Stimulates the {beta}-Catenin/T Cell Factor-dependent Transcription in Colon Cancer J. Biol. Chem., July 15, 2005; 280(28): 26565 - 26572. [Abstract] [Full Text] [PDF]

				B. Du, N. K. Altorki, L. Kopelovich, K. Subbaramaiah, and A. J. Dannenberg Tobacco Smoke Stimulates the Transcription of Amphiregulin in Human Oral Epithelial Cells: Evidence of a Cyclic AMP-Responsive Element Binding Protein-Dependent Mechanism Cancer Res., July 1, 2005; 65(13): 5982 - 5988. [Abstract] [Full Text] [PDF]