| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Surgery and Sealy Center of Cancer Cell Biology, University of Texas Medical Branch, Galveston, Texas 77555 [J. S., H. G., M. B. E., H. S.] and National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, Maryland 20892 [S. B. L.]
| ABSTRACT |
|---|
|
|
|---|
or K-Ras oncogene, synergistically induced AR expression and activated receptor tyrosine kinase-dependent signaling pathways. Our results provide novel mechanisms for cyclooxygenase-2 pro-oncogenic activity and suggest that PGE2 may act with major oncogenic pathways in a synergistic fashion to activate the epidermal growth factor receptor signaling system through a ligand-dependent autocrine pathway. | Introduction |
|---|
|
|
|---|
The EGF family and their cognate receptors (EGFRs), now referred to as the ErbB family, play critical roles in intestinal epithelial growth and transformation (7) . Binding of the ligand to the EGFR leads to activation of RTKs that phosphorylate tyrosine residues of cellular signaling proteins and activate signaling pathways that are essential for intestinal epithelial proliferation (8) . EGFR cross-communicates with GPCRs and can be transactivated by GPCR agonists (9) . In a recent study, Pai et al. (4) reported that PGE2 transactivates EGFR, triggers extracellular signaling-regulated kinase activation, and stimulates the proliferation of colorectal carcinoma cells. These studies demonstrate clearly that PGE2 growth stimulation in colon cancer cells involves activation of the EGFR signaling system. We have reported previously that treatment with PGE2 increases PI3K/Akt activity that is critical for the transformation of intestinal epithelial cells and that is required for the growth stimulation of PGE2 in human colon cancer LS-174 cells (6) . To better understand the mechanism(s) by which PGE2 activates RTK-dependent signaling pathways and stimulates colon cancer cell growth, we investigated the regulation and functional role of a PGE2 target gene, AR, in PGE2 trophic activity. PGE2 signaled through Gs-coupled receptors and activated PKA which, in turn, induced the expression of AR, a member of the EGF family, through transcriptional activation of a CRE in the AR promoter. AR exerted a mitogenic effect on LS-174 cells and mediated the trophic effect of PGE2 in human colon cancer cells. Moreover, PGE2, in cooperation with major oncogenic pathways, synergistically induced AR transcription. These results provide additional mechanisms mediating COX-2/PGE2 pro-oncogenic actions in colorectal carcinogenesis.
| Materials and Methods |
|---|
|
|
|---|
PKA Assay.
cAMP-dependent PKA activity was measured by determining the transfer of the phosphate group of ATP to a synthetic peptide, which is a substrate for PKA (Calbiochem). The experiment was carried out according to the manufacturers instructions.
GeneChip Hybridization.
This experiment was performed in the University of Iowa DNA Facility (10)
. Briefly, cRNA preparations from PGE2 or vehicle-treated LS-174 cells were used to inoculate human GeneChip (U95A) expression arrays (Affymetrix, Inc.) based on a recommended protocol. Three replicate hybridizations were performed using PGE2 or vehicle-treated RNA samples. Alterations in RNA transcript levels were analyzed using Affymetrix Analysis Suit 4.0 software. The fold change in expression between groups was calculated from the mean average difference scores.
RNA Extraction and Northern Blot Analysis.
The extraction of total cellular RNA was carried out as described previously (11)
. RNA samples (20 µg/lane) were separated on formaldehyde-agarose gels and blotted onto nitrocellulose membranes. The blots were hybridized with cDNA probes labeled with [
-32P]dCTP by random primer extension (Stratagene, La Jolla, CA). After hybridization and washes, the blots were subjected to autoradiography.
Transient Transfection and Luciferase Assay.
The assays to determine the activity of the AR promoter were described previously (11)
. Reporter constructs pGL2-A, pGL2-B, pGL2-B
CRE, pGL2-C, and pGL2-C
CRE containing the 5'-flanking region of the human AR gene were described previously (12)
. For transient transfections, cells were cotransfected with 0.5 µg of one of the AR firefly luciferase plasmid constructs and 3 ng of the pRL-SV40 plasmid, containing the Renilla luciferase gene (Promega Corp., Madison, WI), using the FuGENE 6 procedure (Roche, Indianapolis, IN) as described in the manufacturers protocol. Transfected cells were lysed at the indicated times for luciferase assay. Firefly and Renilla luciferase activities were measured using a Dual-Luciferase Reporter assay system (Promega) and a luminometer. Firefly luciferase values were standardized to Renilla values.
Immunoblot Analysis.
Immunoblot analysis was performed as described previously (11)
. The anti-phosphorylated Akt antibody and anti-pCREB antibody were purchased from Cell Signaling (Beverly, MA).
Real-Time RT-PCR.
AR expression was quantified using real-time quantitative PCR or TaqMan technique (Applied Biosystems, Foster City, CA). The sequence of the primer/probe set was based on AR mRNA sequence (GenBank NM_001657) and includes: probe, AGTCCAGCTTAGAAGAC; forward primer, GCCTTTATGTCTGCTGTGATCCT; and reverse primer, CCTCAGCTTCTCCTTCATATTTCCT. 18S rRNA TaqMan assay reagent was used for internal control. One-step RT-PCR was performed with 40 ng of RNA for both target gene and endogenous controls. Duplicate CT values were analyzed in Microsoft Excel using the comparative CT (
CT) method as described by the manufacturer (Applied Biosystems). The amount of target (2-
CT) was obtained as normalized to 18 S and relative to a calibrator.
Data Analysis.
All statistical analyses were performed on a personal computer with the StatView 5.0.1 software (SAS Institute, Inc., Cary, NC). Analyses between multiple groups were determined by ANOVA. Analyses between two groups were determined using the unpaired Student t test. Differences of P < 0.05 were considered statistically significant.
| RESULTS |
|---|
|
|
|---|
7-fold in LS-174 cells. A selective PKA inhibitor, H-89, at 10 µM completely blocked the PGE2-induced PKA activity. Similar results were observed in LS-174 cells that were treated with dibutyryl cAMP (0.1 mM), suggesting that PGE2 signaled through Gs protein-coupled receptors and increased the levels of cAMP in LS-174 cells. In agreement with previous studies (13)
that inhibition of PKA activity with antisense oligodeoxynucleotide impairs the growth of LS-174 cells, 10 µM H-89 significantly inhibited LS-174 cell growth in Matrigel (Fig. 1B)
4-fold. Addition of H-89 blocked the PGE2 stimulation of LS-174 cell growth in Matrigel. Thus, PKA activation appeared to be critical for PGE2 stimulation of LS-174 cell growth.
|
|
7-fold increase in luciferase activity (Fig. 2B)
Roles of the CRE in PGE2 Activation of the AR Promoter.
cAMP stimulates the expression of target genes through a conserved CRE. A CRE site has been identified previously in the AR promoter (15)
. The 155-bp sequence immediately upstream of the 5' end of the mRNA start site includes a consensus TATA box (-238 to -233) and a CRE (-274 to -267). To elucidate the role of the CRE site in PGE2-induced AR transcription, LS-174 cells were transfected with pGL2-B, which contains 136 nucleotides (-328 to -192) including the Wilms tumor suppressor WT1 responsive element, the CRE, and the TATA box. Luciferase activity was increased (
5-fold) by PGE2 stimulation compared with vehicle-treated cells (Fig. 3A)
. Mutation of the CRE site from GACGTCA to GACGTAC (pGL2-B
CRE) resulted in a significant reduction of AR promoter activity and almost completely attenuated PGE2-induced AR transcription. Using pGL2-C and pGL2-C
CRE report vectors, which contain only 83 nucleotides (-275 to -192) including the CRE and the TATA box, we confirmed the critical role of the CRE in PGE2-induced AR transcription (Fig. 3B)
. Transcriptional activation of the CRE requires activated transcription factors of the CREB protein, which is phosphorylated at Ser-133 by the PKA catalytic subunit and interacts with the CRE. PGE2 treatment significantly increased the phosphorylation of CREB protein at Ser-133 in LS-174 cells (Fig. 3C)
.
|
|
Synergy between PGE2 and Major Oncogenic Pathways.
Malignant transformation of cells is an extremely complex process and involves a number of oncogenic signaling pathways, where cross-communication often occurs. TGF-
plays critical roles in colorectal carcinogenesis and often acts through an autocrine loop (16)
. Because both PGE2 and TGF-
may exert tumor-promoting effects to colon cancer cells, we sought to determine whether PGE2 and TGF-
act in a cooperative manner. As demonstrated in Fig. 5A
, both PGE2 and TGF-
induced the levels of pAkt and pCREB; however, combined treatment with PGE2 and TGF-
resulted in a marked induction of PI3K activity and CREB activation. Next, we investigated whether PGE2 and TGF-
cooperatively induced AR transcription. LS-174 cells were transfected with pGL2-A and then treated with TGF-
or PGE2 plus TGF-
. TGF-
increased only luciferase activity
2-fold; PGE2 increased AR promoter activity
7-fold. However, the combination of PGE2 and TGF-
increased luciferase activity
17-fold, suggesting that PGE2 and TGF-
synergistically activated the AR promoter. To demonstrate that the synergistic transcription of AR resulted from PGE2 and TGF-
treatment produced transcripts, we used real-time PCR to determine the expression of AR mRNA. PGE2 and TGF-
synergistically increased the levels of AR mRNA (Fig. 5C)
. Interestingly, a stronger synergy was observed at 24 h after PGE2 and TGF-
treatment, although PGE2 alone had no significant effect on AR expression at this time point.
|
slightly increased the expression of AR mRNA in human kidney 293 cells; however, in combination, PGE2 and TGF-
synergistically induced the expression of AR mRNA (Fig. 5D)
The K-Ras oncogene plays a key role during the adenoma-to-carcinoma sequence of events involved in the neoplastic transformation of colonic epithelial cells. We found that PGE2 and K-Ras also induced AR transcription in a synergistic manner (Fig. 5E)
. Ectopic expression of K-RasVal12 increased AR promoter activity
6-fold compared with empty vector-transfected LS-174 cells. PGE2 treatment increased luciferase activity
7-fold in vector-transfected cells; however, a 27-fold increase was observed in K-RasVal12-transfected cells that were treated with PGE2.
| Discussion |
|---|
|
|
|---|
regulatory subunit (RI
) has been correlated to the growth of an array of tumor cells including colon cancer cells (13)
. The ratio of RI to RII is significantly elevated in human colorectal carcinomas (18)
. The LS-174 cell line contains mainly type I PKA and is an excellent model for investigation of pro-oncogenic roles of the cAMP/PKA pathway (19)
. Treatment with RI
antisense oligonucleotide inhibits the growth of LS-174 cells (13)
. Results from this study demonstrated that PGE2 signaled through the Gs-coupled EP receptor and increased the activity of the cAMP/PKA pathway, which was essential for PGE2 growth-stimulatory activity. We show that AR, an EGFR ligand, was up-regulated by PGE2-induced cAMP/PKA activity and was a mediator for the PGE2 growth-stimulatory effect in LS-174 cells. Thus, our results establish a link between three crucial proneoplastic signaling systems, the COX-2/PGE2 pathway, the cAMP/PKA pathway, and the EGFR signaling system, where AR plays a central role. In this model, COX-2-generated PGE2 stimulates PKA activation through RI
; increased PKA activity induces the transcription of AR, which then activates RTK signaling pathways and stimulates proliferation and growth of colorectal carcinoma cells. Previous studies show that genetic disruption of either COX-2 or EP2 receptor decreases the number and size of intestinal polyps in Apc
716 mice (20)
. Tumor cell proliferation is significantly inhibited in adenomas of COX-2-deficient Apc
716 mice. These findings indicate the potential link between COX-2, PKA, and tumor cell proliferation in vivo. COX-2/PGE2-promoted tumor angiogenesis is thought to be one of the underlying mechanisms. Additional experiments are required to determine the roles of RTK in these animal models. Our studies demonstrate that in response to PGE2 treatment, the expression of AR is significantly increased in LS-174 cells. Cumulative evidence suggests that AR exerts tumor-promoting effects on colorectal carcinomas. AR mRNA is expressed in 6070% of primary and metastatic human colorectal carcinomas but in only 27% of normal human colonic mucosa (21) . AR plays critical roles in colon cancer cell proliferation and transformation that are required for the growth of human colon carcinoma xenografts (14) . In agreement with these studies, we found that AR stimulated the proliferation and growth of LS-174 cells and mediated the PGE2-induced growth stimulation of colon cancer cells.
The CRE consists of an 8-bp palindrome (TGACGTCA) and is typically found within 100 nucleotides of the TATA box. Although the CRE is conserved in the AR promoter, thus far, the role of the CRE in the regulation of AR transcription is not completely understood (15) . Wilms tumor suppressor transcription factor (WT1) activates the CRE in the AR promoter through an undefined mechanism in human osteosarcoma cells (12) . Here, we show that the CRE is critical for the PGE2-induced transcriptional activation of AR in LS-174 cells. CRE sites are frequently located adjacent to other regulatory elements, such as Sp1. Several Sp1 sequences are found adjacent to the CRE of the AR promoter, and their functional roles are under investigation. These results suggest that genes that contain an active CRE site in their promoter may be potentially regulated by PGE2. Further identifying PGE2/PKA target genes and their functional roles will contribute to the understanding of the molecular pathway of colorectal carcinogenesis.
The mechanisms by which GPCR transactivates RTK signaling pathways are complex. It was shown that PGE2-mediated transactivation of EGFR and downstream signaling involves TGF-
, an EGFR ligand, which is likely released by the c-Src-activated matrix metalloproteinase pathway (4)
. In the present study, we demonstrate that PGE2 activated EGFR through induction of AR expression. Apparently, PGE2 may target multiple EGF family members through different mechanisms in colon cancer cells. The PI3K/Akt pathway acts as a transducer of input initiated by growth factor receptors and plays critical roles in the growth and transformation of colorectal carcinoma cells (22)
. We have reported that the PGE2 growth-stimulatory effect on LS-174 cells is dependent on PI3K activity (6)
. Results from this study demonstrate that PGE2-induced PI3K activation was dependent on EGFR tyrosine kinase activity, which was likely activated by PGE2-induced autocrine AR.
Although it is now clear that COX-2 plays an important role in the promotion of colorectal cancer (1)
, COX-2 is not defined as an oncogene. In previous studies (5
, 6)
, we have demonstrated that PGE2 activates oncogenic signaling pathways and enhances transformed phenotypes including cell proliferation, motility, and morphogenesis. In the present study, we show that PGE2, in conjunction with TGF-
and the K-Ras oncogene, synergistically induced AR transcription and stimulated the activation of PKA and PI3K. These results suggest that PGE2 alone may exert temporary effects on tumor cells; however, in combination with other oncogenic signaling pathways, PGE2 may play a key role in neoplastic transformation. To our knowledge, this study is the first to demonstrate that PGE2 acts with major oncogenic signaling pathways in a synergistic manner, thus providing additional insight into the mechanisms by which COX-2/PGE2 promotes colorectal carcinogenesis.
In conclusion, our results link the COX-2/PGE2 pathway to the pro-oncogenic cAMP/PKA pathway and the oncogenic EGFR signaling system, where an EGFR ligand, AR, serves as a central mediator. AR is up-regulated by the PGE2/cAMP/PKA pathway and, in turn, activates EGFR tyrosine kinases that transduce mitogenic signals and stimulate the growth of colorectal carcinoma cells. Future studies are aimed at the transcriptional regulation of gene expression through the PGE2/PKA/CRE pathway and the synergistic cooperation between PGE2 and major oncogenic pathways, which will be critical for the understanding of COX-2 proneoplastic activity in colorectal carcinogenesis.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by the John Sealy Memorial Endowment Fund for Biomedical Research and the Gastrointestinal Research Interdisciplinary Program (both to H. S.). ![]()
2 To whom requests for reprints should be addressed, at Department of Surgery, The University of Texas Medical Branch, Galveston, TX 77555. Phone: (409) 772-6661; E-mail: hosheng{at}utmb.edu ![]()
3 The abbreviations used are: COX, cyclooxygenase; PG, prostaglandin; GPCR, G protein-coupled receptor; Gs, stimulatory G; cAMP, cyclic AMP; EGF, epidermal growth factor; EGFR, EGF receptor; RTK, receptor tyrosine kinase; PI3K, phosphatidylinositol 3-kinase; AR, amphiregulin; PKA, protein kinase A; CRE, cAMP-responsive element; CREB, CRE binding; RT-PCR, reverse transcription-PCR; TGF, transforming growth factor. ![]()
Received 3/18/03. Revised 6/26/03. Accepted 7/11/03.
| REFERENCES |
|---|
|
|
|---|
subunit of cyclic AMP-dependent protein kinase induces growth inhibition in human cancer cells. Cancer Res., 53: 868-872, 1993.
716) knockout mice. Nat. Med., 7: 1048-1051, 2001.[Medline]
This article has been cited by other articles:
![]() |
A. E. Moore, A. Greenhough, H. R. Roberts, D. J. Hicks, H. A. Patsos, A. C. Williams, and C. Paraskeva HGF/Met signalling promotes PGE2 biogenesis via regulation of COX-2 and 15-PGDH expression in colorectal cancer cells Carcinogenesis, October 1, 2009; 30(10): 1796 - 1804. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, D. G. de Matos, H.-Y. Fan, M. Shimada, S. Palmer, and J. S. Richards Interleukin-6: An Autocrine Regulator of the Mouse Cumulus Cell-Oocyte Complex Expansion Process Endocrinology, July 1, 2009; 150(7): 3360 - 3368. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Berasain, M. J. Perugorria, M. U. Latasa, J. Castillo, S. Goni, M. Santamaria, J. Prieto, and M. A. Avila The Epidermal Growth Factor Receptor: A Link Between Inflammation and Liver Cancer Experimental Biology and Medicine, July 1, 2009; 234(7): 713 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Rodriguez, J. C. Tapia, J. G. Fernandez, V. A. Torres, N. Munoz, D. Galleguillos, L. Leyton, and A. F. G. Quest Caveolin-1-mediated Suppression of Cyclooxygenase-2 via a {beta}-catenin-Tcf/Lef-dependent Transcriptional Mechanism Reduced Prostaglandin E2 Production and Survivin Expression Mol. Biol. Cell, April 15, 2009; 20(8): 2297 - 2310. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Subbaramaiah, R. Benezra, C. Hudis, and A. J. Dannenberg Cyclooxygenase-2-derived Prostaglandin E2 Stimulates Id-1 Transcription J. Biol. Chem., December 5, 2008; 283(49): 33955 - 33968. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ning, H. Ouyang, S. Wang, X. Chen, B. Xu, J. Yang, H. Zhang, M. Zhang, and G. Xia 3',5'-Cyclic Adenosine Monophosphate Response Element Binding Protein Up-Regulated Cytochrome P450 Lanosterol 14{alpha}-Demethylase Expression Involved in Follicle-Stimulating Hormone-Induced Mouse Oocyte Maturation Mol. Endocrinol., July 1, 2008; 22(7): 1682 - 1694. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chinnappan, X. Qu, D. Xiao, A. Ratnasari, and H. C. Weber Human gastrin-releasing peptide receptor gene regulation requires transcription factor binding at two distinct CRE sites Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G153 - G162. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Merchant, I. Voskresensky, C. M. Rogers, B. LaFleur, P. J. Dempsey, R. Graves-Deal, F. Revetta, A. C. Foutch, M. L. Rothenberg, M. K. Washington, et al. TACE/ADAM-17: A Component of the Epidermal Growth Factor Receptor Axis and a Promising Therapeutic Target in Colorectal Cancer Clin. Cancer Res., February 15, 2008; 14(4): 1182 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Leone, A. di Palma, P. Ricchi, F. Acquaviva, M. Giannouli, A. M. Di Prisco, F. Iuliano, and A. M. Acquaviva PGE2 inhibits apoptosis in human adenocarcinoma Caco-2 cell line through Ras-PI3K association and cAMP-dependent kinase A activation Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G673 - G681. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Wayne, H.-Y. Fan, X. Cheng, and J. S. Richards Follicle-Stimulating Hormone Induces Multiple Signaling Cascades: Evidence that Activation of Rous Sarcoma Oncogene, RAS, and the Epidermal Growth Factor Receptor Are Critical for Granulosa Cell Differentiation Mol. Endocrinol., August 1, 2007; 21(8): 1940 - 1957. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shao and H. Sheng Prostaglandin E2 Induces the Expression of IL-1{alpha} in Colon Cancer Cells J. Immunol., April 1, 2007; 178(7): 4097 - 4103. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Castellone, H. Teramoto, and J. S. Gutkind Cyclooxygenase-2 and Colorectal Cancer Chemoprevention: The {beta}-Catenin Connection Cancer Res., December 1, 2006; 66(23): 11085 - 11088. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tammali, K. V. Ramana, S. S. Singhal, S. Awasthi, and S. K. Srivastava Aldose Reductase Regulates Growth Factor-Induced Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Colon Cancer Cells Cancer Res., October 1, 2006; 66(19): 9705 - 9713. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Castillo, E. Erroba, M. J. Perugorria, M. Santamaria, D. C. Lee, J. Prieto, M. A. Avila, and C. Berasain Amphiregulin contributes to the transformed phenotype of human hepatocellular carcinoma cells. Cancer Res., June 15, 2006; 66(12): 6129 - 6138. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Kelloff, S. M. Lippman, A. J. Dannenberg, C. C. Sigman, H. L. Pearce, B. J. Reid, E. Szabo, V. C. Jordan, M. R. Spitz, G. B. Mills, et al. Progress in Chemoprevention Drug Development: The Promise of Molecular Biomarkers for Prevention of Intraepithelial Neoplasia and Cancer--A Plan to Move Forward Clin. Cancer Res., June 15, 2006; 12(12): 3661 - 3697. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimada, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, and J. S. Richards Paracrine and Autocrine Regulation of Epidermal Growth Factor-Like Factors in Cumulus Oocyte Complexes and Granulosa Cells: Key Roles for Prostaglandin Synthase 2 and Progesterone Receptor Mol. Endocrinol., June 1, 2006; 20(6): 1352 - 1365. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Lippman and J. J. Lee Reducing the "Risk" of Chemoprevention: Defining and Targeting High Risk--2005 AACR Cancer Research and Prevention Foundation Award Lecture. Cancer Res., March 15, 2006; 66(6): 2893 - 2903. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Otani, K. Yamaguchi, E. Scherl, B. Du, H.-H. Tai, M. Greifer, L. Petrovic, T. Daikoku, S. K. Dey, K. Subbaramaiah, et al. Levels of NAD+-dependent 15-hydroxyprostaglandin dehydrogenase are reduced in inflammatory bowel disease: evidence for involvement of TNF-{alpha} Am J Physiol Gastrointest Liver Physiol, February 1, 2006; 290(2): G361 - G368. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. O'Reilly, M. O. Leonard, N. Kieran, K. M. Comerford, E. Cummins, M. Pouliot, S. B. Lee, and C. T. Taylor Hypoxia induces epithelial amphiregulin gene expression in a CREB-dependent manner Am J Physiol Cell Physiol, February 1, 2006; 290(2): C592 - C600. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shao, G. G. Sheng, R. C. Mifflin, D. W. Powell, and H. Sheng Roles of Myofibroblasts in Prostaglandin E2-Stimulated Intestinal Epithelial Proliferation and Angiogenesis Cancer Res., January 15, 2006; 66(2): 846 - 855. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Melisi, R. Caputo, V. Damiano, R. Bianco, B. M. Veneziani, A R. Bianco, S. De Placido, F. Ciardiello, and G. Tortora Zoledronic acid cooperates with a cyclooxygenase-2 inhibitor and gefitinib in inhibiting breast and prostate cancer Endocr. Relat. Cancer, December 1, 2005; 12(4): 1051 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Wirth, R. I. Haddad, N. I. Lindeman, X. Zhao, J. C. Lee, V. A. Joshi, C. M. Norris Jr, and M. R. Posner Phase I Study of Gefitinib Plus Celecoxib in Recurrent or Metastatic Squamous Cell Carcinoma of the Head and Neck J. Clin. Oncol., October 1, 2005; 23(28): 6976 - 6981. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Choe, X. Zhang, H. J. C. Shin, D. M. Shin, and Z. Chen Interaction between epidermal growth factor receptor- and cyclooxygenase 2-mediated pathways and its implications for the chemoprevention of head and neck cancer Mol. Cancer Ther., September 1, 2005; 4(9): 1448 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Lippman, N. Gibson, K. Subbaramaiah, and A. J. Dannenberg Combined Targeting of the Epidermal Growth Factor Receptor and Cyclooxygenase-2 Pathways Clin. Cancer Res., September 1, 2005; 11(17): 6097 - 6099. [Full Text] [PDF] |
||||
![]() |
R. Wu, A. L. Abramson, M. J. Shikowitz, A. J. Dannenberg, and B. M. Steinberg Epidermal Growth Factor-Induced Cyclooxygenase-2 Expression Is Mediated through Phosphatidylinositol-3 Kinase, Not Mitogen-Activated Protein/Extracellular Signal-Regulated Kinase Kinase, in Recurrent Respiratory Papillomas Clin. Cancer Res., September 1, 2005; 11(17): 6155 - 6161. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shao, C. Jung, C. Liu, and H. Sheng Prostaglandin E2 Stimulates the {beta}-Catenin/T Cell Factor-dependent Transcription in Colon Cancer J. Biol. Chem., July 15, 2005; 280(28): 26565 - 26572. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Du, N. K. Altorki, L. Kopelovich, K. Subbaramaiah, and A. J. Dannenberg Tobacco Smoke Stimulates the Transcription of Amphiregulin in Human Oral Epithelial Cells: Evidence of a Cyclic AMP-Responsive Element Binding Protein-Dependent Mechanism Cancer Res., July 1, 2005; 65(13): 5982 - 5988. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tuccillo, M. Romano, T. Troiani, E. Martinelli, F. Morgillo, F. De Vita, R. Bianco, G. Fontanini, R. A. Bianco, G. Tortora, et al. Antitumor Activity of ZD6474, a Vascular Endothelial Growth Factor-2 and Epidermal Growth Factor Receptor Small Molecule Tyrosine Kinase Inhibitor, in Combination with SC-236, a Cyclooxygenase-2 Inhibitor Clin. Cancer Res., February 1, 2005; 11(3): 1268 - 1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Moraitis, B. Du, M. S. De Lorenzo, J. O. Boyle, B. B. Weksler, E. G. Cohen, J. F. Carew, N. K. Altorki, L. Kopelovich, K. Subbaramaiah, et al. Levels of Cyclooxygenase-2 Are Increased in the Oral Mucosa of Smokers: Evidence for the Role of Epidermal Growth Factor Receptor and Its Ligands Cancer Res., January 15, 2005; 65(2): 664 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Dannenberg, S. M. Lippman, J. R. Mann, K. Subbaramaiah, and R. N. DuBois Cyclooxygenase-2 and Epidermal Growth Factor Receptor: Pharmacologic Targets for Chemoprevention J. Clin. Oncol., January 10, 2005; 23(2): 254 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Johansson, A. Yndestad, J. M. Enserink, A. H. Ree, P. Aukrust, and K. Tasken The Epidermal Growth Factor-Like Growth Factor Amphiregulin Is Strongly Induced by the Adenosine 3',5'-Monophosphate Pathway in Various Cell Types Endocrinology, November 1, 2004; 145(11): 5177 - 5184. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Little, M. Kurkela, J. Sonka, S. Jantti, R. Ketola, S. Bratton, M. Finel, and A. Radominska-Pandya Glucuronidation of oxidized fatty acids and prostaglandins B1 and E2 by human hepatic and recombinant UDP-glucuronosyltransferases J. Lipid Res., September 1, 2004; 45(9): 1694 - 1703. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Hull, S. C.W. Ko, and G. Hawcroft Prostaglandin EP receptors: Targets for treatment and prevention of colorectal cancer? Mol. Cancer Ther., August 1, 2004; 3(8): 1031 - 1039. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shao, B. M. Evers, and H. Sheng Prostaglandin E2 Synergistically Enhances Receptor Tyrosine Kinase-dependent Signaling System in Colon Cancer Cells J. Biol. Chem., April 2, 2004; 279(14): 14287 - 14293. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |