| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
during Thyroid Carcinogenesis
Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland 20892-4264 [H. Y., H. S., L. Z., S-Y. C.]; National Human Genome Research Institute, NIH, Bethesda, Maryland 20892-4264 [P. M.]; and Department of Pathology, Wake Forest University School of Medicine, Winston-Salem, North Carolina 27157-1072 [M. C. W.]
| ABSTRACT |
|---|
|
|
|---|
(PPAR
) fusion gene in human thyroid follicular carcinoma suggests a tumor suppressor role of PPAR
in thyroid carcinogenesis. Mice harboring a knockin mutant thyroid hormone ß receptor (TRßPV) spontaneously develop thyroid follicular carcinoma through pathological progression of hyperplasia, capsular invasion, vascular invasion, anaplasia, and eventually, distant organ metastasis. This mutant mouse (TRßPV/PV mouse) provides an unusual opportunity to ascertain the role of PPAR
in thyroid carcinogenesis. Here, we show that the expression of PPAR
mRNA was repressed in the thyroid gland of mutant mice during carcinogenesis. In addition, TRßPV acted to abolish the ligand (troglitazone)-mediated transcriptional activity of PPAR
. These results indicate that repression of PPAR
expression and its transcriptional activity are associated with thyroid carcinogenesis and raise the possibility that PPAR
could be tested as a therapeutic target in thyroid follicular carcinoma. | INTRODUCTION |
|---|
|
|
|---|
Accumulated evidence indicates that follicular carcinomas arise through an oncogenic pathway distinct from that of papillary carcinoma, probably from the point of clonal initiation (2)
. The major differences in the molecular genetics between these two types of carcinomas are a higher prevalence of activating mutations of all three RAS genes and a greater disposition to develop DNA copy abnormalities (2
, 6)
. Recently, however, Kroll et al. (7)
reported the identification of a chromosomal rearrangement t(2:3)(q13;p25), yielding a PAX8-PPAR
12
fusion gene in 5 of 8 human follicular carcinomas but not in 10 papillary carcinomas. This unique genetic rearrangement in follicular carcinoma was further confirmed by subsequent analyses using a larger number of samples (8)
. When fused to PAX8, PPAR
1 not only loses its capability to stimulate thiazolidinedione-induced transcription but also acts to inhibit PPAR
1 transcriptional activity (7)
. However, how the loss of PPAR
1 transcriptional activity impacts the normal functions of thyroid follicular cells is unclear.
We have recently created a mutant mouse by targeting a mutation (PV) to the TRß gene locus (TRßPV mice; Ref. 9 ). TRßPV was derived from a patient (PV) with RTH (10) . RTH patients manifest the symptoms of dysfunction of the pituitary-thyroid axis with high circulating levels of thyroid-stimulating hormone in the face of high circulating levels of thyroid hormones (T3 and T4; Ref. 10 ). There is only one reported homozygous RTH patient who died at an early age (11) . Patient PV has one mutant TRß gene allele and manifests severe RTH characterized by attention-deficit hyperactivity disorder, short stature, low weight, goiter, and tachycardia (12) . PV has a unique mutation in exon 10, a C-insertion at codon 448, which produces a frameshift of the COOH-terminal 14 amino acids of TRß1. PV has lost T3 binding completely and exhibits potent dominant negative activity (13) .
Remarkably, as TRßPV/PV mice aged, they spontaneously developed thyroid carcinoma (14)
. Histological evaluation of thyroids of 514-month-old mice showed capsular invasion (91%), vascular invasion (74%), anaplasia (35%), and metastasis to the lung and heart (30%). Thus, as previously reported, the TRßPV/PV mouse is a unique mouse model of human thyroid carcinoma (14)
. Additional analyses in the present study indicate that the thyroid carcinoma was of the follicular type. The availability of a mouse model of thyroid follicular carcinoma provides an unusual opportunity to ask the question whether the loss of ligand-dependent PPAR
transcriptional activity is associated with thyroid follicular carcinoma. Here, we show that during thyroid carcinogenesis, the expression of PPAR
mRNA became repressed. Moreover, troglitazone-activated PPAR
transcriptional activity was repressed by mutant PV. These findings suggest a critical role of PPAR
in the development of thyroid follicular carcinoma.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Northern Blot Analysis.
Total RNA was isolated from thyroids using Trizol Reagent (Invitrogen, Carlsbad, CA). Total RNA (5 µg) was used for Northern blot analysis. The probes were cDNA for TRß1 or PPAR
, labeled with [
-32P]dCTP using a random primer hexamer protocol. For normalization, the blots were stripped and rehybridized with a [
-32P]dCTP-labeled GAPDH cDNA. After quantification by NIH image 1.61, the intensities of the mRNA bands were normalized against the intensities of GAPDH mRNA.
Determination of the Expression of PV Mutant RNA in Tissues by RT-PCR.
RT-PCR was carried out using total RNA (3 µg) as a template and using ploy (dT) as a primer for cDNA synthesis by SuperScript II reverse transcriptase (Invitrogen). The DNA fragments for the wild-type TRß or mutant PV were amplified in the presence of 5'-primer (primer N), 5'-ATGGGGAAATGGCAGTGACACGAG and 3'-primer (primer C), 5'-TGGGAGCTGGTGATGACTTCGTGC using Tag DNA polymerase (Takara, Madison, WI). The mutant PV sequence contained a BamHI site that was not present in the mouse endogenous TRß gene. PCR products were digested with BamHI to yield two 380- and 309-bp fragments for mutant PV, as analyzed by gel electrophoresis.
Quantitative Real-Time RT-PCR.
LightCycler-RNA Amplification kit Sybr Green I was used according to the manufacturers protocols (Roche, Mannheim, Germany). A typical reaction mixture contained 5.2 µl of H2O, 2.4 µl of MgCl2 stock solution, 4 µl of LightCycler-RT-PCR Reaction Mix Sybr, 2 µl of resolution solution, 0.4 µl of LightCycler-RT-PCR Enzyme Mix, 2.5 µl of forward primer (2 µM), 2.5 µl of reverse primer (2 µM), and 1 µl of total RNA (200 ng). The cycles were: 55°C for 30 min; 95°C for 30 s; 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s; and 65°C to
95°C with a heating rate of 0.1°C/sec and cooling step to 40°C. The primers used are as follows: PPAR
, forward primer 5'-TCTGGCCCACCAACTTCGGA-3', reverse primer 5'-CTTCACAAGCATGAACTCCA-3'; LpL, forward primer 5'-TGCCATGACAAGTCTCTGAAG-3', reverse primer 5'-ATGGGCCATTAGATTCCTCA-3'; and GAPDH, forward primer 5'-CCCTTCATTGACCTCAACTACAT-3', reverse primer 5'-ACAATGCCAAAGTTGTCATGGAT-3'.
Preparation of Primary Mouse-cultured Thyroid Cells.
Mouse primary thyrocytes were prepared with modifications from Jeker et al. (15)
. Briefly, pieces of thyroid lobes were washed by HBSS and digested with type 2 collagenase (0.2% in HBSS containing 1% BSA, 3 mM CaCl2, and 50 ng/ml gentamicin) at 37°C for 30 min. After digestion, cells were collected by centrifuged for 3 min at 500 x g, which were subsequently resuspended in 1 ml of 6H culture medium (F-12 medium with 5% calf serum, 10 µg/ml insulin, 1 nM hydrocortisone, 2 ng/ml glycyl-histidyl-L-lysine acetate, 5 µg/ml transferrin, 10 ng/ml somatostatin, and 1 mU/ml thyroid-stimulating hormone). The medium was changed every third day.
Transfection.
Mouse primary thyroid cultured cells prepared as shown above or PC cells (16
, 17)
were transfected with 1 µg of reporter plasmid (pPPRE-TK-Luc) and 100 to
300 ng of expression vector for TRß1 (pCLC51), PV (pCLC51PV), or PPAR
1 (pSG5-mPPAR
1) using FuGENE6 (Roche) according to the manufacturers protocols. Five h after transfection, cells were cultured 6H medium containing 5% calf serum or serum deficient in thyroid hormone (Td serum). After 24 h, 100 nM T3 or 20 µM Troglitazone were added and incubated for an additional 24 h. Cells were lysed, and the luciferase activity was determined. The values were normalized against the protein concentrations that were determined by the BCA protein assay kit (Pierce, Rockford, IL).
EMSA.
The double-stranded oligonucleotide containing the PPRE (PPRE-5', GAACGTGACCTTTGTCCTGGTCCCCTTTGCT and PPRE-3', GGGACCAGGACAAAGGTCACGTTCGGGAAAGG) was labeled with [32P]dCTP similarly as described by Zhu et al. (18)
. PPAR
1, TRß1, and PV were synthesized in vitro by using the TNT-quick-coupled transcription/translation system (Promega, Madison, WI). About 0.2 ng of probe (35 x 104 cpm) were incubated with in vitro translated PPAR
1, TRß1, or PV with or without +RXRß (2 µl) in the binding buffer for 30 min at room temperature. DNA bound complexes were resolved on a 5.2% polyacrylamide gel. After electrophoresis for 2.5 h at 250 V, the DNA bound complexes were detected by autoradiography.
Histological and Immunohistochemical Methods.
Tissues (thyroid and lung) were removed from mice and fixed in formaldehyde followed by paraffin embedding. For histology, sections were stained with H&E for microscopic examination. For immunohistochemistry, sections prepared from these paraffin blocks were deparaffinized, then treated with 0.3% hydrogen peroxide for 10 min at room temperature, followed by treatment with Antigen Unmasking Solution (Vector Labs, Burlingame, CA) at 97°C for 1 h. The sections were then blocked in 10% normal goat serum in PBS, followed by incubation in primary antibodies (rabbit anti-Tg antibody, 1:1000 in 1%BSA-PBS or rabbit anti-NIS antibody, 1:1000; Ref. 19
) at 4°C overnight. The rabbit anti-Tg antibody was a generous gift from Dr. Roberto Dilauro, and the rabbit anti-NIS antibody was a generous gift from Dr. Nancy Carrasco, Albert Einstein College of Medicine. After the primary antibody step, the sections were washed and incubated in affinity-purified goat antirabbit IgG conjugated to horseradish peroxidase (Jackson ImmunoResearch, West Groove, PA) at 25 µg/ml in BSA-PBS for 30 min at room temperature. The sections were then routinely processed using diaminobenzidine-peroxide substrate solution and counterstained with hematoxylin. Images were captured using a Zeiss Axioplan 2 microscope equipped with an Axiocam camera and assembled using Adobe PhotoShop (version 7.0).
| RESULTS |
|---|
|
|
|---|
6.1-kb band with similar intensity was detected for TRß (Fig. 1B
|
2 months of age, as reported previously (14)
. Histologically, these glands show extensive hyperplasia in a papillary pattern but none of the nuclear changes associated with papillary carcinoma. Some of these glands also develop foci of spindle cell anaplasia. At >10 months of age, some of these mice develop pulmonary metastases, the morphology of which are mostly in a pattern consistent with follicular carcinoma of the thyroid, as shown in Fig. 2
|
|
during Thyroid Carcinogenesis.
fusion protein was detected mainly in human follicular carcinomas, rarely in follicular adenomas, but not in other thyroid carcinomas. Although it is not clear how the expression of the PAX8-PPAR
fusion protein leads to follicular carcinoma, it was shown that PAX8-PPAR
failed to respond to ligand-dependent transcriptional activity of PPAR
(7)
. The findings that TRßPV/PV mice developed thyroid follicular carcinoma prompted us to examine the expression of the PPAR
gene expression in the thyroid of TRßPV/PV mice. We first examined the expression of PPAR
mRNA in the thyroid of TRßPV/PV mice at the age of 5 months by Northern blot analysis (Fig. 4A)
mRNA was lower than that of the wild-type siblings. After quantification and normalization against GAPDH, Fig. 4B
mRNA was repressed in the thyroid of TRßPV/PV mice by 50% as compared with the wild-type siblings.
|
mRNA during carcinogenesis by comparing pairs of age-matched wild-type and of TRßPV/PV mice at the ages of 4 months (Fig. 5A
mRNA in the wild-type mice (Fig. 5A
mRNA was repressed in TRßPV/PV mice at each time point (Fig. 5A
mRNA became repressed (
5060%) during the time when the thyroid is undergoing carcinogenesis (14)
.
|
.
inactivates the ligand-dependent transcriptional activity of PPAR
, suggesting that the loss of its transcriptional activity could play a role in the development of follicular carcinoma. We therefore tested the hypothesis that in addition to the repression in the expression of PPAR
mRNA, PV could also act to interfere with the ligand-dependent transcriptional activity of PPAR
in the thyroid of TRßPV/PV mice. The luciferase reporter containing PPAR
response element (AGGTACXAGGTCA; DR1) was cotransfected with or without TRß1 or PV into cultured thyroid PC cells (Fig. 6A)
in normal nontransfected cells. Cotransfection of TRß1 in the absence of T3 led to 50% repression of the basal activity (Fig. 6A
, troglitazone (Fig. 6A
was activated by troglitazone (Fig 6A
|
with TRß1 is illustrated in bars Fig. 6A
and TRß1 in the absence of both ligands led to repression (Fig. 6A
were cotransfected into PC cells (Fig. 6A
transcriptional activity (Fig. 6A
pathways. More importantly, this cross-signaling could be blocked by the dominant negative action of PV. Thus, these data provide a functional link of PV action to the transcriptional activity of PPAR
.
We further demonstrated the repression of the transcriptional activity of PPAR
by PV in primary thyrocytes of wild-type mice. As shown in Fig. 6B
, bar 2, cotransfection of PPRE-containing reporter with PPAR
led to 3.5-fold activation of the transcriptional activity. Consistent with the results shown in the cultured thyrocytes, the transfected PV abolished the troglitazone-induced transcriptional activity to the basal level (Fig. 6B
, bar 3). These findings additionally support the notion that the expression of PV in the thyroid of TRßPV/PV mice repressed the transcriptional activity of PPAR
.
Mutant PV Binds to PPRE.
It is known that PV binds to thyroid hormone response elements with the half-site binding motifs in three different arrangements (palindromic, inverted repeats, and direct repeats separated by four nucleotides; Refs. 21
, 22
). Similar to TRß1, PV binds to these thyroid hormone response elements as a homodimer and as a heterodimer with the RXR. The results described above in Fig. 6
suggested that TRß1 as well as PV could bind to PPRE. We, therefore, evaluated the binding of TRß1 and PV to PPRE (DR1) by EMSA. Consistent with other studies (23)
, binding of PPAR
to PPRE as homodimers was too weak to be detected by EMSA (Fig. 7
, Lane 2). However, PPAR
bound to PPRE-DR1 as heterodimers with RXR (Fig. 7
, Lane 3). Similarly, neither TRß1 nor PV bound to PPRE as homodimers, but TRß1 and PV bound to PPRE each as heterodimers with RXR, albeit weaker than that of PPAR
/RXR heterodimers (Fig. 7
, compare Lanes 5 or 7 with Lane 3). These results indicate that PV could compete with TRß1 or PPAR
for binding to PPRE as PV/RXR heterodimers on the PPAR
target genes.
|
by PV shown above is functionally relevant, we evaluated the expression of a known PPAR
downstream direct target gene, LpL. LpL is the primary enzyme responsible for conversion of lipoprotein triglycerides into free fatty acids and monoglycerides (24)
. A typical PPRE, -169 TGCCCTTTCCCCC -157 (DR1), was identified in the promoter of the LpL gene (23)
. Furthermore, the transcriptional activation of the LpL gene by thiazolidinediones was shown mediated by PPAR/RXR heterodimers (23)
. We, therefore, compared the expression of LpL in the thyroids of TRßPV/PV mice and their wild-type siblings at the time the expression of PPAR
was repressed (Fig. 5)
direct downstream target gene supports the notion that PV-induced repression in the expression, and the transcriptional activity of PPAR
is functionally significant. Importantly, these data indicate that during carcinogenesis, transcriptional activity of PPAR
became repressed.
|
| DISCUSSION |
|---|
|
|
|---|
fusion gene in thyroid follicular carcinoma ushers in a new paradigm to study the molecular genetic events underscoring the development of follicular carcinoma. At present, how the rearranged product, PAX8-PPAR
fusion gene, is involved in tumorigenesis is unclear. It is known, however, that the fusion of PPAR
1 to PAX8 inactivates the ligand-transcriptional activity of PPAR
1, suggesting that the loss of the ligand-transcriptional activity of PPAR
1 could contribute to the tumorigenesis. The availability of TRßPV/PV mice with follicular thyroid carcinoma provides an unusual opportunity to test this hypothesis. We found that, indeed, during carcinogenesis and progression in the thyroids of TRßPV/PV mice, the expression of PPAR
mRNA became repressed. Importantly, PV was further shown to inhibit the ligand-dependent transcriptional of PPAR
. These dual actions of PV keep PPAR
repressed both on its expression and activity. These findings suggest a critical role of PPAR
in maintaining the normal phenotype of the thyroid.
A close association of somatic mutations of TRß with several human cancers has been reported (25, 26, 27)
. In these studies, how TRß mutants could be involved in the carcinogenesis in vivo has not been addressed. PV has been shown to act dominant negatively to interfere with the transcriptional activity of TRß in vitro and in vivo, resulting in abnormal expression patterns of T3 target genes (9
, 13
, 28)
. The present study shows TRß1 bound to PPRE, albeit weaker than PPAR
. However, in the presence of both T3 and troglitazone, a synergistic PPRE-mediated transactivation activity was detected (Fig. 6A)
, suggesting that TRß1 could function to enhance the transcriptional activities of PPAR
in vivo. Similar to TRß1, PV also bound to PPRE, but because PV cannot bind T3, PV acts to interfere with the enhancing functions of TRß1 on PPAR
. It is possible that for some PPAR
target genes, the enhancing action of T3-bound TRß1 is obligatory for their functions. For these genes, the dominant negative action of PV acts to obliterate their functions, leading to deleterious consequences.
Increasing evidence supports the belief that tumorigenesis occurs as a result of accumulative abnormal genetic events (29) . Cross-signaling of these genetic pathways makes dissecting the genetic events underlying carcinogenesis a challenge (30) . In many cases, where the abnormal genes are identified, little is known about how the interplay of their molecular pathways contributes to tumorigenesis. The present study highlights how the mutation of a nuclear transcription factor could silence the activity of another nuclear transcription factor, leading to pathogenic consequences.
Emerging evidence suggests that the loss of PPAR
expression could be an important risk factor in the development of carcinoma. Recent animal studies have shown that reduced expression of the PPAR
gene enhances carcinogenesis; PPAR
+/- mice are at markedly enhanced risk for azoxymethane-induced colon carcinogenesis (31)
. Furthermore, Akiyama et al. (32)
also showed that PPAR
+/- mice were more susceptible than wild-type controls to the development of 7,12-dimethylbenz(a)anthracene-induced skin papillomas, mammary tumors, and ovarian tumors, suggesting that PPAR
might have a protective role against tumor development.
It is unclear how the loss of the PPAR
gene and/or the repression of ligand-dependent transcriptional activity of PPAR
are involved in thyroid carcinogenesis. The findings that its downstream direct target gene, LpL, was concurrently repressed indicate that the repression of PPAR
led to functional consequences. Therefore, PPAR
could act via downstream pathways to inhibit the proliferation of cell growth and to induce apoptosis. The loss of these activities of PPAR
results in uncontrolled cell growth. This notion is supported by recent studies showing that PPAR
agonists and PPAR
overexpression leads to a drastic reduction of cell growth and an increase in apoptotic cell death of PPAR
overexpressing thyroid carcinoma cells (33
, 34)
. These human thyroid carcinoma cells express PPAR
(33
, 34)
. In addition, troglitazone was found to significantly inhibit tumor growth and prevent distant metastasis of tumors induced by human papillary thyroid cancer BHP1821 cells in nude mice in vivo (34)
. The genes and signaling pathways affected by PPAR
and its ligands that lead to growth inhibition and apoptosis await future studies. However, these studies raise the possibility that PPAR
could be an important potential therapeutic target and TRßPV/PV mice could be used to test PPAR
ligands as chemopreventive agents in thyroid follicular carcinoma.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 To whom requests for reprints should be addressed, at Laboratory of Molecular Biology, National Cancer Institute, 37 Convent Drive, Room 5128, Bethesda, MD 20892-4264. Phone: (301) 496-4280; Fax: (301) 402-1344; E-mail: sycheng{at}helix.nih.gov ![]()
2 The abbreviations used are: PPAR
, peroxisome proliferator activated receptor
; EMSA, electrophoretic mobility gel shift assay; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LpL, lipoprotein lipase; NIS, sodium iodide symporter; PPRE, peroxisome proliferator-activated receptor response element; RTH, thyroid hormone resistance syndrome; RT-PCR, reverse transcription-PCR; RXR, the retinoid X receptor; Tg, thyroglobulin; TRß, thyroid hormone ß receptor. ![]()
Received 3/14/03. Revised 5/15/03. Accepted 5/30/03.
| REFERENCES |
|---|
|
|
|---|
1 fusion oncogene in human thyroid carcinoma. Science (Wash. DC), 289: 1357-1360, 2000.
rearrangement in thyroid tumors: RT-PCR and immunohistochemical analyses. Am. J. Surg. Pathol., 26: 1016-1023, 2002.[Medline]
and PPAR
activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J., 15: 5336-5348, 1996.[Medline]
. Proc. Natl. Acad. Sci. USA, 99: 13771-13776, 2002.
on thyroid carcinoma cell growth. J. Clin. Endocrinol. Metab., 87: 4728-4735, 2002.
inhibit growth and induce apoptosis of human papillary thyroid carcinoma cells. J. Clin. Endocrinol. Metab., 86: 2170-2177, 2001.This article has been cited by other articles:
![]() |
C. J. Guigon, L. Zhao, C. Lu, M. C. Willingham, and S.-y. Cheng Regulation of {beta}-Catenin by a Novel Nongenomic Action of Thyroid Hormone {beta} Receptor Mol. Cell. Biol., July 15, 2008; 28(14): 4598 - 4608. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y Liu, H. Morreau, J. Kievit, J. A Romijn, N. Carrasco, and J. W Smit Combined immunostaining with galectin-3, fibronectin-1, CITED-1, Hector Battifora mesothelial-1, cytokeratin-19, peroxisome proliferator-activated receptor-{gamma}, and sodium/iodide symporter antibodies for the differential diagnosis of non-medullary thyroid carcinoma Eur. J. Endocrinol., March 1, 2008; 158(3): 375 - 384. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. O'Shea, C. J. Guigon, G. R. Williams, and S.-y. Cheng Regulation of Fibroblast Growth Factor Receptor-1 (Fgfr1) by Thyroid Hormone: Identification of a Thyroid Hormone Response Element in the Murine Fgfr1 Promoter Endocrinology, December 1, 2007; 148(12): 5966 - 5976. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, C. Lu, M. C. Willingham, and S.-y. Cheng Inhibition of phosphatidylinositol 3-kinase delays tumor progression and blocks metastatic spread in a mouse model of thyroid cancer Carcinogenesis, December 1, 2007; 28(12): 2451 - 2458. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Y. Liu, R. S. Heymann, F. Moatamed, J. J. Schultz, D. Sobel, and G. A. Brent A Mutant Thyroid Hormone Receptor {alpha} Antagonizes Peroxisome Proliferator-Activated Receptor {alpha} Signaling in Vivo and Impairs Fatty Acid Oxidation Endocrinology, March 1, 2007; 148(3): 1206 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Kim, F. Furuya, H. Ying, Y. Kato, J. A. Hanover, and S.-y. Cheng Gelsolin: A Novel Thyroid Hormone Receptor-{beta} Interacting Protein that Modulates Tumor Progression in a Mouse Model of Follicular Thyroid Cancer Endocrinology, March 1, 2007; 148(3): 1306 - 1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Rocha, R. Marques, I. Bento, R. Soares, J. Magalhaes, I. V. de Castro, and P. Soares Thyroid hormone receptor {beta} mutations in the 'hot-spot region' are rare events in thyroid carcinomas J. Endocrinol., January 1, 2007; 192(1): 83 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, J. A. Hanover, and S.-y. Cheng Activation of phosphatidylinositol 3-kinase signaling by a mutant thyroid hormone beta receptor PNAS, February 7, 2006; 103(6): 1780 - 1785. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Araki, H. Ying, F. Furuya, X. Zhu, and S.-y. Cheng Thyroid hormone receptor {beta} mutants: Dominant negative regulators of peroxisome proliferator-activated receptor {gamma} action PNAS, November 8, 2005; 102(45): 16251 - 16256. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lacroix, V. Lazar, S. Michiels, H. Ripoche, P. Dessen, M. Talbot, B. Caillou, J.-P. Levillain, M. Schlumberger, and J.-M. Bidart Follicular Thyroid Tumors with the PAX8-PPAR{gamma}1 Rearrangement Display Characteristic Genetic Alterations Am. J. Pathol., July 1, 2005; 167(1): 223 - 231. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kohrle Guard Your Master: Thyroid Hormone Receptors Protect Their Gland of Origin from Thyroid Cancer Endocrinology, October 1, 2004; 145(10): 4427 - 4429. [Full Text] [PDF] |
||||
![]() |
Y. Kato, H. Ying, M. C. Willingham, and S.-Y. Cheng A Tumor Suppressor Role for Thyroid Hormone {beta} Receptor in a Mouse Model of Thyroid Carcinogenesis Endocrinology, October 1, 2004; 145(10): 4430 - 4438. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Burman A New Paradigm in the Treatment of Carcinoma: Specific Molecular Targeting Endocrinology, March 1, 2004; 145(3): 1027 - 1030. [Full Text] [PDF] |
||||
![]() |
A. L. Lovering, J. P. Ride, C. M. Bunce, J. C. Desmond, S. M. Cummings, and S. A. White Crystal Structures of Prostaglandin D2 11-Ketoreductase (AKR1C3) in Complex with the Nonsteroidal Anti-Inflammatory Drugs Flufenamic Acid and Indomethacin Cancer Res., March 1, 2004; 64(5): 1802 - 1810. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |