| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Department of Pathology and Laboratory Medicine, Medical University of South Carolina, Charleston, South Carolina 29425 [A. M., Y. W., D. Z.], and Division of Hematology and Oncology, Markey Cancer Center, University of Kentucky Medical Center, Lexington, Kentucky 40536 [G. V. Z.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
There is indirect evidence suggesting that IR may damage HSCs by inducing apoptosis. First, IR is a potent inducer of apoptosis in a variety of cells, including normal and malignant hematopoietic cells (3, 4, 5, 6, 7) . Secondly, overexpression of an antiapoptotic or down-regulation of a proapoptotic protein confers a certain degree of protection against IR-induced myelosuppression (8, 9, 10, 11, 12) . Similarly, it was reported that incubation of myeloid and lymphoid leukemia cells with BU induced apoptosis (13 , 14) . However, no increase in apoptotic cell death was observed in BM biopsies from chronic myelogenous leukemia patients undergoing chemotherapy with BU (15) . Therefore, it is not known to what extent we can extrapolate the apoptotic response of malignant cells to normal HSCs in their response to BU treatment.
The damage to HSCs by IR and BU may not be limited to the induction of apoptosis, as exposure of human normal diploid fibroblasts and other types of cells to IR and various chemotherapeutic agents also causes clonogenic cell deletion by induction of premature senescence (16, 17, 18, 19, 20) . Cells undergoing premature senescence exhibit some of the same characteristics as these of replicative senescent cells, such as permanent cell cycle arrest, enlarged and flattened cell morphology, increased acidic or SA-ß-gal activity, and elevated expression of the proteins encoded by the Ink4a-Arf locus (17 , 18 , 21) . Two major pathways have been implicated in the induction of premature senescence. These include the p53-p21Cip1/Waf1 or p19Arf-Mdm2-p53-p21Cip1/Waf1 pathway, triggered by DNA damage, and the p16Ink4a-Rb pathway, activated by the Ras-mitogen-activated protein kinase cascade (17 , 18 , 21) . Activation of either pathway is sufficient to induce senescence. However, extensive cross-talk exists at multiple levels between these two pathways. Frequently, the two pathways work in concert to induce premature senescence.
Induction of either apoptosis or premature senescence, or both, in HSCs and progenitors can result in inhibition of their hematopoietic function. However, it is not known if IR and chemotherapeutic agents, such as BU, are capable of inducing premature senescence in BM hematopoietic cells, and to what degree that HSC and progenitor apoptosis and/or senescence may contribute to IR- and chemotherapy-induced myelosuppression. Therefore, the present study was designed to determine whether IR and BU induce apoptosis and/or premature senescence in murine BM hematopoietic cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
receptor blocker; rat IgG2b); and FITC-conjugated streptavidin were purchased from BD-PharMingen (San Diego, CA). Rabbit anti-p21Cip1/Waf1 (M-19), anti-p53 (CM5), anti-p16Ink4a, and anti-p19ARF antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz Biotechnology, Santa Cruz, CA), Novocastra (Newcastle-upon-Tyne, United Kingdom), and Abcam (Cambridge, United Kingdom), respectively. Biotinylated goat anti-rabbit IgG (H+L) was purchased from Vector (Burlingame, CA). BU was obtained from Sigma (St. Louis, MO).
Mice.
Male C57BL/6 mice were purchased from the National Cancer Institute and housed 4 to a cage at the Medical University of South Carolina Association for Assessment and Accreditation of Laboratory Animal Care certified animal facility. They received food and water ad libitum. All of the mice were used at approximately 810 weeks of age. The Institutional Animal Care and Use Committee of Medical University of South Carolina approved all of the experimental procedures used in this study.
Isolation of BM-MNCs and Lin- Cells.
The femora and tibiae were harvested from the mice immediately after they were euthanized with CO2. BM cells were flushed from the bones into HBSS containing 2% FCS using a 21-gauge needle and syringe. Cells from 310 mice were pooled and centrifuged through Histopaque 1083 (Sigma) to isolate BM-MNCs. For the isolation of Lin- cells (22)
, BM-MNCs were incubated with biotin-conjugated rat antibodies specific for murine CD5, Mac-1, CD45R/B220, Ter-119, and Gr-1. The labeled mature lymphoid and myeloid cells were depleted twice by incubation with goat antirat IgG paramagnetic beads (Dynal Inc., Lake Success, NY) at a bead:cell ratio of
4:1. Cells binding the paramagnetic beads were removed with a magnetic field. The negatively isolated Lin- cells were washed twice with 2% FCS/HBSS and resuspended in complete medium (RPMI 1640 supplemented with 10% FCS, 2 mM L-glutamine, 10 µM HEPES buffer, 100 units/ml penicillin, and 100 µg/ml streptomycin) at 1 x 106/ml.
Treatment of BM-MNCs or Lin- Cells with IR or BU.
BM-MNCs or Lin- cells (1 x 106/ml) suspended in complete medium were exposed to 4 Gy IR generated in a Mark IV 137Cesium
-irradiator (JL Shepherd, Glendale, CA) at a dose rate of 1.21 Gy/min, or incubated with BU (30 µM) or 0.2% DMSO (vehicle used as control). Cells were incubated in wells of a 24-well plate at 37°C, 5% CO2, and 100% humidity for various times as indicated in individual experiments.
CAFC Assay.
Feeder cell stromal layers were prepared by seeding 103/well FBMD-1 stromal cells in each well of flat-bottomed 96-well plates (Falcon, Lincoln Park, NJ). One week later, BM-MNCs resuspended in CAFC medium (Iscoves MDM supplemented with 20% horse serum, 10-5 M hydrocortisone, 10-5 M 2-mercaptoethanol, 100 units/ml penicillin, and 100 µg/ml streptomycin) after various treatments described above were overlaid on these stromal layers in six dilutions and 3-fold apart. Twenty wells were plated for each dilution to allow limiting dilution analysis of the precursor cells forming hemopoietic clones under the stromal layer. Cultures were fed weekly by changing one-half of the medium. The frequencies of CAFC were determined at weekly intervals (on days 7, 14, 21, 28, and 35). Wells were scored positive if at least one phase-dark hematopoietic clone (containing 5 or more cells) was seen. The frequency of CAFC was then calculated by using Poisson statistics as described previously (22
, 23)
.
Apoptosis Assay.
Lin- cells were incubated with anti-CD16/32 at 4°C for 15 min to block the Fc
receptors, and then stained with Sca-1-PE and c-kit-APC antibodies for 20 min at 4°C in the dark. These cells were washed twice with 0.1% BSA/PBS (1 ml) by centrifuging them at room temperature for 5 min at 350 x g before annexin V staining. For annexin V staining, 1x binding buffer (100 µl containing 10 mM HEPES (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl2) was added to the pellet of Lin- cells along with 3 µl of annexin V-FITC (PharMingen). The cell suspension was gently mixed and incubated for 15 min at room temperature. The cells were diluted in 1x binding buffer (400 µl) immediately before fluorescence-activated cell sorter analysis. In all of the experiments, PE and APC isotype controls, and FITC positive and negative controls were included as appropriate. Flow cytometric analysis was performed for the determination of apoptosis in different populations of Lin- cells using a fluorescence-activated cell sorter Caliber (Becton Dickinson, San Jose, CA).
LTBMC.
LTBMC was performed according to the method of Dexter et al. (24)
, with modifications as described previously (25
, 26)
. Briefly, BM cells at 3 x 106/ml were exposed to 4 Gy IR, or incubated with 30 µM BU or vehicle (0.2% DMSO) in a 60-mm dish at 37°C, 5% CO2, and 100% humidity for 6 h. After the incubation, the cells were washed once to remove BU and resuspended in CAFC medium. These cells were reseeded in a 60-mm dish (3 x 107 in 8 ml of CAFC medium/dish), and two of the dishes were placed inside a covered 150-mm Petri dish with an additional uncovered 35-mm dish containing 4 ml of sterile distilled water. These dishes were incubated at 33°C in a humidified incubator with 5% CO2. The cells were fed weekly by removal of one-half the supernatant medium and cells, and replacement with fresh medium. After 2 or 5 weeks of culture, nonadherent hematopoietic cells were collected from supernatant, and adherent cells were harvested after digestion of stromal cell layer with trypsin and removal of stromal cells by brief adherence of the cells to plastic for 1 h at 37°C. The nonadherent and adherent hematopoietic cells were analyzed for CFU-GM, SA-ß-gal activity, and expression of p53, p21Cip1/Waf1, p16Ink4a, and p19Arf by immunostaining and RT-PCR as described below.
Clonogenic Assays.
CFU-GM was analyzed using MethoCult M3534 medium (StemCell Technologies). Nonadherent and adherent hematopoietic cells harvested from 5-week LTBMC as described above were suspended in Methocult M 3534 medium at 2 x 104 or 1 x 105 viable cells/ml and seeded in wells of 24-well plates. The plates were incubated at 37°C in a humidified incubator with 5% CO2 in air for 7 days. Colonies of
50 cells were scored under an inverted microscope, and results are expressed as the number of CFU-GM per 105 cells.
SA-ß-Gal Activity Analysis.
SA-ß-gal activity was determined using a SA-ß-gal staining kit from Cell Signaling Technology (Beverly, MA) according to the manufacturers instruction. Briefly, nonadherent and adherent hematopoietic cells harvested from 2- or 5-week LTBMC were cytospun onto slides. Cells were fixed in 2% (v/v) formaldehyde and 0.2% glutaraldehyde, and then incubated in SA-ß-gal staining solution (1 mg/ml 5-bromo-4-chloro-3-indolyl ß-D-galactosidase; 40 mM citric acid (pH 6.0), 40 mM sodium phosphate (pH 6.0), 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM sodium chloride, and 2 mM magnesium chloride) at 37°C for 10 h. Senescent cells were identified as blue-stained cells by standard light microscopy, and a total of 1000 cells were counted in five random fields on a slide to determine the percentage of SA-ß-gal-positive cells.
Immunolabeling for Fluorescence Microscopy.
Cells were cytospun onto slides, air dried, and then fixed in ice-cold methanol for 5 min. They were permeabilized with 0.2% Triton X-100 and blocked with 5% goat serum before incubation with the anti-p53, anti-p21Cip1/Waf1, anti-p16Ink4a, or anti-p19Arf antibodies. Cells were incubated with biotinylated-goat antirabbit antibody (Vector) and then with streptavidin-PE (PharMingen) after extensive washing between each staining. DNA was then labeled with Hoechst 33342 (Molecular Probes). Slides were finally mounted in Gel/Mount (Biomeda Corp, Forster, CA). Cells were viewed and photographed using an Axioplan research microscope (Carl Zeiss Inc., Jena, Germany) equipped with a 100 W mercury light source and a 25x plan-neofluar na1.3 objective. The images were captured with a Dage CCD100 integrating camera (Dage-MTI, MI) and a Flashpoint 128 capture board (Integral Technologies, IN). The captured images were processed using Image Pro Plus software (Media Cybernetics, MD) and displayed with Adobe Photoshop V6.0.
Semiquantitative RT-PCR.
Total RNA was isolated from the hematopoietic cells harvested from 2- or 5-week LTBMC using TRIzol reagent (Invitrogen) after the manufacturers protocol. RNA yield and quality were determined by measuring absorbencies at 260 nm and 280 nm, respectively. First-strand cDNA was synthesized from 5 µg of total RNA using SuperScript II first-strand synthesis system (Invitrogen) according to the manufacturers manual. Two µl of cDNA was used for the PCR amplification using 2 units of Pfx DNA polymerase (Invitrogen) and 200 nmol of targeting primers. The housekeeping gene GAPDH cDNA was amplified simultaneously as an internal quantitative control, and all of the samples were normalized to the PCR signal of GAPDH. The sequences of primers used in this study were: p16ink4a, TCCGCTGCAGACAGACTGGCCAG (sense) and CATCGCGCACATCCAGCCGAGC (anti-sense); p19Arf, AAGAAGTCTGCGTCGGCGAC (sense) and AGTACCGGAGGCATCTTGGACA (anti-sense); p21Cip1/Waf1, AATCCTGGTGATGTCCGACC (sense) and AAAGTTCCACCGTTCTCGG (anti-sense); p53, CACGTACTCTCCTCCCCTCAA (sense) and GGCTCATAAGGTACCACCACG (anti-sense); and GAPDH, TGAAGGTCGGTGTGAACGGATTTGGC (sense) and CATGTAGGCCATGAGGTCCACCAC (anti-sense). PCR amplification was carried out using an Eppendorf Mastercycler Gradient Thermocycler. PCR conditions include denaturation of the reaction mixtures at 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 58 or 60°C for 40 s, and 72°C for 50 s. For amplification of GAPDH cDNA, the number of cycles was 23. The amplified PCR products were separated by 1.5% agarose gel electrophoresis at 100 V for 1 h, stained with ethidium bromide, visualized with UV light, and finally photographed to record the results.
Statistical Analysis.
The data were analyzed by ANOVA. If ANOVA justified post hoc comparisons between group means, these were conducted using the Student-Newman-Keuls test for multiple comparisons. For experiments in which only single experimental and control groups were used, group differences were examined by unpaired Students t test. Differences were considered significant at P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
Effects of IR and BU on LTBMC.
After 5 weeks of LTBMC, an average of 0.93 x 106 viable hematopoietic cells were recovered from control LTBMC, which represents
3% of the input test cell inoculum (3 x 107 BM cells) for the culture. The number of the cells (0.32 x 106) recovered from the LTBMC for irradiated cells was significantly reduced (
66% reduction) as compared with control (P < 0.001). In contrast, a moderate but still significant reduction (
28%) in the number of the cells (0.67 x 106) recovered from LTBMC for BU-treated cells was observed (P < 0.001 versus control). Next, the effects of IR and BU on the function of these hematopoietic cells harvested from a 5-week LTBMC were examined using a clonogenic assay for CFU-GM. As shown in Fig. 2B
, the hematopoietic cells harvested from the 5-week LTBMC for control cells had the ability to form CFU-GM, whereas the cells from the LTBMC for both irradiated and BU-treated cells exhibited a diminished ability to form CFU-GM. This result suggests that although some of BM hematopoietic cells might have survived IR- and BU-induced damage, these cells had been permanently arrested and probably became senescent.
|
|
|
|
After 2- and 5-week LTBMT, the expression of p16Ink4a in control cells was minimal (<6%). However,
37.2% of the irradiated cells and 45.5% of the BU-treated cells harvested from the week-2 LTBMC became p16Ink4a-positive cells, respectively (Fig. 4)
. Correspondingly, p16Ink4a mRNA was also barely detectable in control cells after 2 weeks of LTBMC (Fig. 5)
. The expression of p16Ink4a mRNA was increased in both irradiated and BU-treated cells harvested from a 2-week LTBMC in a comparable level. The expression of p19Arf was undetectable in all of the cells harvested from a 2-week LTBMC using both immunostaining with an antibody specific against p19Arf and RT-PCR (Fig. 5
; data not shown). However, the expression of p19Arf was increased in irradiated and BU-treated cells after 5 weeks of LTBMC. About 21% of the irradiated cells and 42% of the BU-treated cells were stained positive for p19Arf as compared with 7% of control cells (Fig. 4)
. The increased expression of p19Arf in irradiated and BU-treated cells was also confirmed at mRNA level by RT-PCR (Fig. 5)
. These results suggest that the induction of BM hematopoietic cell senescence by IR and BU is associated with an increased expression of p16Ink4a and p19Arf in a time-dependent manner.
| DISCUSSION |
|---|
|
|
|---|
Interestingly, incubation of BM-MNCs and/or Lin- cells with BU, a potent chemotherapeutic agent widely used for the treatment of certain leukemia and BMT preconditioning, failed to induce apoptosis in HSC alike cells and progenitors, whereas it significantly inhibited their hematopoietic function. The lack of induction of HSC alike cell and progenitor apoptosis by BU was neither time- nor dose-dependent, because in a preliminary study, incubation of BM-MNCs with a higher dose of BU (up to 200 µM) for a longer period (48 or 72 h) did not induce hematopoietic cell apoptosis (data not shown). The inability of BU to induce apoptosis in HSC alike cells and their normal progeny is a novel and unexpected finding, because previous studies showed that incubation of myeloid and lymphoid leukemia cells with BU induced apoptosis (13 , 14) . Similarly, we found that treatment of MO7e cells, a growth factor-dependent myeloid leukemia cell line, with BU causes MO7e cell apoptosis (data not shown). These results suggest that normal and malignant hematopoietic cells may respond differently to BU treatment. However, the mechanisms instigating the differential response of normal and malignant hematopoietic cells to BU have yet to be elucidated. The lack of induction of apoptosis in HSC alike cells and their normal progeny by BU suggests that BU inhibits hematopoietic function via an apoptotic-independent mechanism. This suggestion is additionally supported by the finding that z-VAD had no effect on BU-induced inhibition of HSC alike cell and progenitor hematopoietic function.4 In addition, this suggestion is in agreement with the finding that no significant increase in apoptosis was detected in BM biopsies from chronic myelogenous leukemia patients receiving BU chemotherapy (15) .
The finding that the majority (72% of control) of BM hematopoietic cells survived BU treatment whereas only a small fraction (34% of control) of the cells survived exposure to IR after 5 weeks of LTBMC provides additional evidence to support the supposition that IR and BU inhibit hematopoietic function via apoptosis-dependent and -independent mechanism, respectively. Interestingly, almost all of these surviving hematopoietic cells failed to form CFU-GM. This suggests that although some of these BM hematopoietic cells may have survived IR- and BU-induced damage, they lose their proliferative potential and hematopoietic function, probably because of induction of permanent growth arrest or senescence. This suggestion is supported by the findings that surviving hematopoietic cells had an increased SA-ß-gal activity, a biomarker for senescent cells (28) . In addition, surviving hematopoietic cells recovered from LTBMC with irradiated cells showed increases in the expression of p53, p21Cip1/Waf1, p16Ink4a, and p19Arf, that from LTBMC with BU-treated cells also exhibited elevations in p16Ink4a and p19Arf expression. Increases in the expression of these proteins have been implicated in induction and maintenance of permanent cell cycle arrest by direct inhibition of various cyclin-dependent kinases (17 , 29 , 30) . Therefore, for the first time to our knowledge, we demonstrated that BM hematopoietic cells underwent premature senescence after exposure to IR or treatment with BU. The induction of premature senescence in BM hematopoietic cells is likely responsible for BU-induced inhibition of BM hematopoietic function and can also contribute to IR-induced suppression of BM hematopoietic function. Furthermore, the induction of hematopoietic cell premature senescence may represent a novel underlying mechanism for radiation and chemotherapy to cause myelosuppression in cancer patients.
| FOOTNOTES |
|---|
1 Supported in part by NIH Grants (R01-CA78688 and R01-CA86688; to D. Z.). ![]()
2 To whom requests for reprints should be addressed, at Department of Pathology, Medical University of South Carolina, 165 Ashley Avenue, Suite 309, Charleston, SC 29425. Phone: (843) 792-7532; Fax: (843) 792-0368; E-mail: zhoud{at}musc.edu ![]()
3 The abbreviations used are: BM, bone marrow; IR, ionizing radiation; BU, busulfan; HSC, hematopoietic stem cell; CFU-GM, colony forming units-granulocyte macrophage; SA-ß-gal, senescence-associated ß-galactosidase; BMT, bone marrow transplantation; CAFC, cobblestone area-forming cell; BM-MNC, bone marrow mononuclear cell; Lin- cells, lineage-negative hematopoietic cell; LTBMC, long-term bone marrow culture; APC, allophycocyanin; PE, phycoerythrin; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehydes-3-phosphate dehydrogenase. ![]()
Received 4/10/03. Revised 6/ 4/03. Accepted 6/16/03.
| REFERENCES |
|---|
|
|
|---|
-irradiation or N-phosphoacetyl-L-aspartate treatment. Carcinogenesis (Lond.), 21: 2203-2210, 2000.This article has been cited by other articles:
![]() |
K. Nakade, J. Pan, T. Yamasaki, T. Murata, B. Wasylyk, and K. K. Yokoyama JDP2 (Jun Dimerization Protein 2)-deficient Mouse Embryonic Fibroblasts Are Resistant to Replicative Senescence J. Biol. Chem., April 17, 2009; 284(16): 10808 - 10817. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ma, M. Shi, J. Li, B. Chen, H. Wang, B. Li, J. Hu, Y. Cao, B. Fang, and R. C. Zhao Senescence-unrelated impediment of osteogenesis from Flk1+ bone marrow mesenchymal stem cells induced by total body irradiation and its contribution to long-term bone and hematopoietic injury Haematologica, July 1, 2007; 92(7): 889 - 896. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Probin, Y. Wang, A. Bai, and D. Zhou Busulfan Selectively Induces Cellular Senescence but Not Apoptosis in WI38 Fibroblasts via a p53-Independent but Extracellular Signal-Regulated Kinase-p38 Mitogen-Activated Protein Kinase-Dependent Mechanism J. Pharmacol. Exp. Ther., November 1, 2006; 319(2): 551 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Jordan, M. L. Guzman, and M. Noble Cancer stem cells. N. Engl. J. Med., September 21, 2006; 355(12): 1253 - 1261. [Full Text] [PDF] |
||||
![]() |
Y. Wang, B. A. Schulte, A. C. LaRue, M. Ogawa, and D. Zhou Total body irradiation selectively induces murine hematopoietic stem cell senescence Blood, January 1, 2006; 107(1): 358 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen Animal Models for Acquired Bone Marrow Failure Syndromes Clin. Med. Res., May 1, 2005; 3(2): 102 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, A. Meng, H. Lang, S. A. Brown, J. L. Konopa, M. S. Kindy, R. A. Schmiedt, J. S. Thompson, and D. Zhou Activation of Nuclear Factor {kappa}B In vivo Selectively Protects the Murine Small Intestine against Ionizing Radiation-Induced Damage Cancer Res., September 1, 2004; 64(17): 6240 - 6246. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |