| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Department of Medical Oncology, Erasmus MCDaniel den Hoed Cancer Center, 3000 DR Rotterdam, the Netherlands [H. H. v. O.]; Immunotherapy Laboratory and Department of Immunology, University Medical Center Utrecht, 3584 EA Utrecht, the Netherlands [H. H. v. O., L. B., A. B., M. J. H. J., M. J. v. V., J. G. J. v. d. W.]; Genmab, 3584 CK Utrecht, the Netherlands [M. J. v. V., J. G. J. v. d. W.]; and The Holden Comprehensive Cancer Center and Department of Internal Medicine, University of Iowa, Iowa City, Iowa 52242 [C. E. D., G. J. W.]
| ABSTRACT |
|---|
|
|
|---|
receptor I (Fc
RI)-expressing transgenic (Tg) mouse model was used to explore the role of Fc
RI in therapy with mAb and CpG ODN. CpG B induced up-regulation of Fc
RI in hFc
RI Tg mice, whereas CpG A did not. In vitro CpG B also enhanced ADCC of HER-2/neu-expressing tumor cells by the Fc
RI-directed bispecific antibody MDX-H210 using hFc
RI-positive effector cells. In a solid tumor model, tumor growth was inhibited in Tg mice treated with a combination of MDX-H210 and CpG B. These data suggest that CpG A enhance ADCC largely by activating NK cells. In contrast, other effector cell populations, including granulocytes, contribute to the antitumor activity of CpG B and mAbs. Fc
RI plays an important role in this activity. | INTRODUCTION |
|---|
|
|
|---|
R; Ref. 9
). Three classes of Fc
R are currently recognized: Fc
RI (CD64), Fc
RII (CD32), and Fc
RIII (CD16; Refs. 10
, 11
). Fc
RI represents the only receptor class capable of binding monomeric IgG. It has a limited cell distribution and exhibits potent immune-activating activities. Because of these characteristics, this receptor has been considered an optimal trigger molecule for Ab therapy (12)
. Although granulocytes are not often considered primary mediators of ADCC, they are among the most common leukocytes, can be induced to express Fc
RI (13)
, and can mediate ADCC via Fc
RI (14)
.
Whereas the acceptance of cancer immunotherapy as part of standard clinical practice is relatively new, immunotherapy of cancer is an old concept. At the end of the 19th century, Coley (15
, 16) observed therapeutic effects in cancer patients treated with a crude bacterial extract. At that time, the role of the immune system in combating disease was poorly understood, and Coleys results were neither reproducible nor understood from a mechanistic point of view. The past 20 years have seen striking advances in the field of immunology. Some of these advances reflect back on Coleys observations. In particular, we now know that specific sequences within bacterial DNA contain unmethylated CpG dinucleotides that are potent immunostimulatory motifs (17
, 18)
. Synthetic ODNs containing such unmethylated CpG motifs mediate similar effects (19)
. In particular, CpG ODNs are able to activate immune effector cells and enhance cytotoxicity against tumor targets (20)
. In animal models, CpG ODNs have potent antitumor effects when administered in vivo either alone or in combination with mAb (21, 22, 23)
. Interestingly, the effect of CpG ODNs on various effector cells varies depending on the sequence of the CpG ODNs (20
, 24)
. CpG ODNs with a chimeric backbone in combination with poly-G tails are known as CpG A (also known as "D" type ODNs; Ref. 24
). These CpG ODNs are potent inducers of IFN-
production and NK lytic activity, but have little effect on secretion of Th1-type cytokines or B-cell proliferation. In contrast, CpG B (also known as "K" type ODNs) are potent activators of B cells and induce production of Th1-type cytokines. CpG A can induce regression of established NK-sensitive melanomas in mice (22)
whereas CpG B does not. In contrast, CpG B is effective at inducing regression of the EL4 murine lymphoma where both NK cells and T cells contribute to the antitumor effect. CpG A is not as active in this model.
Use of the combination of Abs and immunostimulatory agents, such as CpG ODNs, should allow us to combine the specificity of Abs with the potency of the innate immune system. However, doing so in a rational fashion requires an understanding of the potential interaction between these different but interactive arms of the immune system. In the murine studies outlined below, we explore the cellular effectors responsible for the antitumor effects of mAbs when administered either alone or in combination with immunostimulatory CpG ODNs of the A or B class. The results of these studies demonstrate that different types of effector cells can contribute to ADCC, and point to the potentially potent activity of granulocytes and other Fc
RI-expressing cells in the antitumor effect of mAbs alone and Abs plus CpG B in vivo. Perhaps most importantly, they highlight the concept that a growing understanding of the cellular mechanisms responsible for the antitumor effects of mAbs should allow us to develop rationally designed combination immunotherapeutic approaches.
| MATERIALS AND METHODS |
|---|
|
|
|---|
CpG ODN.
CpG ODN 1585 (sequence GGGGTCAACGTTGAGGGGGG; Ref. 22
) and CpG ODN 1826 (TCCATGACGTTCCTGACGTT; Ref. 29
) were used as prototypic CpG A and CpG B, respectively, as we have done previously (22)
. ODN 1982 (TCCAGGACTTCTCTCAGGTT) was used as a control sequence. All of the ODNs were supplied by Coley Pharmaceutical Group (Wellesley, MA). CpG ODNs were tested and proved to contain <12.5 ng/mg of lipopolysaccharides levels by Limulus assays (LAL-assay; BioWhittaker, Walkersville, MD). ODNs were injected i.p. at a dose of 100 µg in 0.2 ml PBS unless otherwise stated.
Flow Cytometry.
Whole mouse blood, WBCs, or tumor cells were incubated for 30 min with either labeled or unlabeled mAb. Labeled cells were washed three times in PBS supplemented with 1% bovine serum albumen and 0.01% azide. When unlabeled primary mAbs were used, indirect staining, using FITC- or r-phycoerythrin-labeled F(ab')2 fragments of a goat
-mouse mAb as a labeled second Ab was performed. Whole blood samples were lysed and fixed by using FACS lysing solution (Becton Dickinson, San Jose, CA). All of the samples were analyzed on a FACSCalibur flow cytometer (Becton Dickinson). A panel of antimouse mAb, labeled with either FITC or r-phycoerythrin, was used to detect the different mouse effector cell populations. Unconjugated murine mAbs against HER-2/neu (520C9; mouse IgG1) were provided by Medarex (Medarex Inc., Annandale, NJ).
ADCC Assay.
A 51Cr release assay, slightly modified from Valerius et al. (13)
was used. Mouse whole blood was used as the source of effector cells. Mice were treated for 3 days with 150 µg of mG-CSF s.c., kindly provide by Dr. Jeff Andresen (Amgen, Thousand Oaks, CA), to increase circulating numbers of leukocytes before blood collection via orbital puncture. Briefly, tumor cells were incubated with 200 µCi 51Cr for 2 h. After washing three times with culture medium, 5 x 103 target cells were added to round-bottomed microtiter plates containing 50 µl of whole blood, CpG ODNs, and sensitizing mAbs. The final volume was 200 µl, and the E:T cell ratio was
80:1. After incubation overnight at 37°C, assays were stopped by centrifugation. 51Cr-release was measured in supernatants from triplicate wells. Percentage of cellular cytotoxity was calculated using the formula:
![]() |
with maximal 51Cr release determined by adding Zap-oglobin (Coulter Electronics LTD, Luton, England; 10% final concentration) to target cells, and basal release measured in the absence of sensitizing mAb and effector cells. Only very low levels of Ab-mediated noncellular cytotoxicity (without effector cells) and Ab-independent killing were observed under these conditions (<5% specific lysis).
38C13 Murine Lymphoma Model.
The 38C13 murine lymphoma tumor model has been described previously (30, 31, 32)
. Female C3H or C6B3F1 (C3H x C57Bl6 F1) mice were purchased from Harlan Biosciences, (Indianapolis, IN), housed in the University of Iowa Animal Care Facility, and used when they were 69 weeks old. For in vivo experiments, 5 x 103 cells growing in log phase were injected i.p. into immunocompetent mice. Day 0 was defined as the day of tumor inoculation. The therapeutic murine mAb MS11G6 (IgG2a) and MS5A10 (IgG1; Ref. 25
) were obtained from tissue culture supernatant by protein A (MS11G6) or protein G (MS5A10) affinity chromatography. Mice were treated with doses of 0.1 mg therapeutic mAb in 0.2 ml PBS i.p. as indicated. The University of Iowa or University of Utrecht animal care and use committees approved all of the mice experiments.
NK and Granulocyte Depletion.
NK cells were depleted in vivo by i.p. injection of 0.1 mg of the anti-NK1.1 mAb PK136 (ATCC HB191) on days -2, 0, 3, 5, 7, and 10. C6B3F1 mice were used for deletion studies, because NK cells from C3H/HeN mice do not express the NK1.1 antigen. Preliminary studies demonstrated that NK cells from C6B3F1 express NK1.1 and are depleted after PK136 therapy as determined by flow cytometry and functional assays for NK activity (lysis of YAC-1 cells). In addition, the in vivo development of lymphoma and survival after inoculation with 38C13 cells in C6B3F1 mice is indistinguishable from that in homozygous mice C3H/HeN mice, and the antilymphoma effect of MS11G6 is similar in homozygous C3H/HeN and C6B3F1 mice (data not shown). Granulocytes were depleted by i.p. injection of 0.1 mg of mAb RB6-8C5 (Anti Ly-6G; Kindly supplied by Dr. J. Harty, University of Iowa) on days -2, 3, 5, and 10. Depletion of granulocytes from the peripheral blood for up to 10 days after tumor inoculation was confirmed by examination of peripheral blood smears.
Human Fc
RI Tg Mice.
FVB/N mice Tg for hFc
RI (CD64) were crossed back into BALB/c (33
, 34)
. In all of the experiments with hFc
RI animals, the Tg mice were matched with their NTg littermates. Mice were bred and maintained in the Tg Mouse Facility of the Central Laboratory Animal Facility (Utrecht, the Netherlands) and were used at 816 weeks of age.
Solid Tumor Model.
Tumor cells were tested for stable HER-2/neu expression after in vivo passage by FACS analyses. CMS7HE cells (2 x 106) were injected s.c. in the right flank of male F12 Tg-hFc
RI and NTg mice (27)
. These tumors grew quickly and could easily be measured using calipers. Tumor diameter was reported as length x width x height (mm3). BsAb MDX-H210 (hFc
RIa x HER-2/neu), produced by chemically cross-linking F(ab') fragments of the target Abs H22 (hFc
RI), and 520C9 (HER-2/neu) was supplied by Medarex (35)
. MDX-H210 was injected i.p. and CpG ODN s.c. in the vicinity of the tumor as indicated. Mice were checked three times a week for signs of toxicity and discomfort, including level of activity, ruffled fur, diarrhea, and general appearance.
Statistical Analysis.
Group data were reported as mean ± SE. Differences between groups were analyzed by unpaired (or, when appropriate, paired) Students t tests. Levels of significance are indicated, with significance accepted at the P < 0.05 level. Statistical analyses on survival curves were performed using Prism 3.02 software (GraphPad Software, Inc., San Diego, CA).
| RESULTS |
|---|
|
|
|---|
|
RIII (CD16) and Fc
RI (CD64), whereas mAb of the murine IgG1 isotype have lower affinity for Fc
RI (37)
, particularly when the mAb is in its monomeric form. Thus, one would expect the antitumor IgG2a mAb to be capable of mediating ADCC via a variety of effector cell types, whereas the antitumor IgG1 of the same specificity would signal as well, but would not mediate ADCC as well. Therefore, we evaluated therapy of tumor-bearing mice with antitumor IgG1 combined with CpG A or CpG B. Neither CpG A nor CpG B had a detectable effect on the efficacy of antitumor IgG1 mAb using conditions where both CpG A and CpG B enhance the efficacy of IgG2a mAb (Table 1)
|
|
RI and can mediate ADCC (38)
. Therefore, we evaluated the importance of granulocytes, both alone and in combination with NK cells, in mediating the antitumor activity of mAb and CpG B in the 38C13 lymphoma model. Depletion of granulocytes alone had little impact on efficacy of mAb alone (Table 1)
|
RI is Up-Regulated by CpG B.
RI mediate the enhanced antitumor activity observed when CpG B is added to mAb. Furthermore, granulocytes can play an important role in the antitumor effects observed with this therapy. Therefore, we evaluated the effect of CpG ODN on Fc
RI expression. Because Abs against murine Fc
RI were not yet available, we used an hFc
RI Tg mouse model to assess Fc
RI expression and function. This model has been described previously (33)
. Tg hFc
RI mice express hFc
RI under control of the endogenous human Fc
RI promotor. Human Fc
RI Tg mice constitutively express hFc
RI on monocytes, macrophages, immature DCs, and in low numbers on resting granulocytes (34)
as would expected for Fc
RI. In addition, expression of hFc
RI on granulocytes in this model is up-regulated in vivo upon stimulation with IFN-
or granulocyte colony-stimulating factor (34
, 39
, 40) . Human Fc
RI expression was determined at various time points after a single s.c. dose of CpG ODN. As illustrated in Fig. 4
RI expression by granulocytes was seen in Tg mice treated in vivo with CpG B. In contrast, little if any change in hFc
RI expression was seen with CpG A, even at a high dose. No hFc
RI was detected in NTg mice. A clear time-response curve is seen with hFc
RI expression after a single s.c. dose of CpG B, with hFc
RI expression up-regulated for >8 days after a single 100 µg dose of CpG B. Treatment with CpG B, but not CpG A, enhanced hFc
RI expression levels on monocytes and DCs as well in a dose-dependent manner (data not shown).
|
RI Is Enhanced by CpG B.
RI-directed BsAb MDX-H210. Effector cells for these assays were harvested by obtaining whole blood from mG-CSF-treated mice and incubating the blood in vitro with CpG B. Tg granulocytes activated with CpG B exhibited enhanced MDX-H210, mediated cell killing, with the combination of MDX-H210 and CpG B being effective at very low MDX-H210 concentrations (Fig. 5)
RII/III (41)
.
|
RI x HER/2-neu BsAb and CpG B Inhibits Tumor Growth.
RI Tg mice, MDX-H210, and mouse fibrosarcoma cells that express the HER-2/neu target antigen (CMS7HE). In vitro studies indicated that CpG B had no detectable effect on tumor cell morphology, proliferation, antigen expression, or viability (data not shown). Clear reduction in tumor growth was observed in Tg mice treated with the combination of MDX-H210 and CpG B, whereas tumors grew progressively in all of the other treatment groups (Fig. 6)
RI by nonstimulated effector cells, thereby limiting Fc
RI-mediated targeting and cytotoxicity. Paradoxically, tumors in animals treated with BsAb alone appeared to grow faster than tumors in control mice; however, this difference was not statistically significant.
|
| DISCUSSION |
|---|
|
|
|---|
Given that CpG ODNs activate NK cells, monocytes, and macrophages, and induce production of immunostimulatory cytokines, it is rational to explore how CpG ODN impacts on the efficacy of mAb therapy, and which effector cells contribute to this antitumor activity. We used the differential effects of CpG A and CpG B to assess which effector cells contribute to the antitumor effect of therapy with mAb plus CpG ODN. CpG A (1585) and CpG B (1826) enhanced the efficacy of mAb to a similar degree. However, this enhanced effect was mediated by different effector cell populations. For CpG A, NK cells played the central role, with the enhanced antitumor effect being lost after depletion of NK cells. In contrast, the antitumor effect of mAb plus CpG B could be mediated by either granulocytes or NK cells, because depletion of either population alone had little impact on efficacy, whereas depletion of both types of effector cells resulted in a loss of the therapeutic effect.
Use of Ab to deplete various cell populations has its limitations. Although we administered anti-NK and antigranulocyte mAb frequently with the goal of complete depletion, and were unable to find NK cells or granulocytes after depletion during the critical therapeutic window of the antitumor mAb, depletion may not have been complete. Residual NK cells or granulocytes may have contributed to the residual antitumor activity either by mediating ADCC or supplying cytokines that contributed to activating other cellular effectors. It is also possible that this approach resulted in unintentional depletion of a cell population that was important for the antitumor activity of therapy. This is particularly important in interpretation of the granulocyte depletion studies, which were done using the anti-LY-6C mAb Gr-1. Whereas this mAb clearly can deplete granulocytes, it has also been reported that the LY-6C target antigen is expressed by other cell populations, including plasmacytoid DC (42)
. The ability of this population of DC to produce IFN-
is enhanced by CpG ODN (43
, 44)
. Thus, an alternative explanation for the observed findings is that depletion with Gr-1 decreased the efficacy of therapy by eliminating the IFN-
-producing cell. If this was the case, we would have expected depletion with Gr-1 to significantly decrease the therapeutic efficacy of mAb and CpG A, because the primary mechanism of action proposed for CpG A is induction of IFN-
production by plasmacytic DC, with secondary activation of NK cells. In fact, Gr-1 depletion had no detectable effect on therapy with mAb plus CpG A (Table 1)
, suggesting that our proposed mechanism, namely granulocyte depletion, and not depletion of IFN-
-producing cells, was responsible for the observed effects.
A second approach to exploring the role of various effector cells is to evaluate antitumor effects using BsAb that engage effector cells in a more focused manner. Granulocytes can express FcR and so could also contribute to the observed antitumor effects of mAb. In vivo studies in mice and data from clinical trials of the hFc
RI-directed BsAb, MDX-H210, have shown that granulocytes can be retargeted and demonstrate biological activity (8
, 12
, 45, 46, 47, 48, 49)
. To assess whether CpG ODNs enhance the efficacy of ADCC at least in part by inducing up-regulation of hFc
RI on granulocytes, we evaluated the effect of CpG B on hFc
RI expression and function. hFc
RI expression on murine granulocytes was up-regulated by a single low dose of CpG B in vivo. In addition, whole blood obtained from mG-CSF-treated hFc
RI Tg mice and stimulated in vitro with CpG B enhanced the ability of that blood to mediate ADCC. Up-regulation of hFc
RI on monocytes, macrophages, and DCs, and ADCC mediated by these cells, could have been responsible for some of the enhanced hFc
RI-mediated ADCC seen with CpG B. However, mG-CSF stimulated blood has low numbers of these cells. The E:T ratio would have been inadequate to mediate ADCC if the granulocytes were not contributing to the cytotoxic effect.
TLR9 is a key receptor in the response to CpG ODNs (50)
. A coreceptor responsible for the differential effects of CpG A and CpG B has been hypothesized but has not yet been identified. Production of a variety of cytokines by subsets of DCs (44)
appears to be particularly important in the systemic response to CpG ODNs in both the murine and human systems. Interestingly, purified murine monocytes express TLR9, whereas purified human monocytes do not. This and other species differences related to response to CpG ODNs need to be taken into account when applying results in murine models to humans. Nevertheless, there are key similarities in the response of mice and humans to CpG ODNs. For example, in a recently completed Phase I clinical study, CpG ODN was found to enhance production of tumor necrosis factor
, interleukin 12, IFN-
, and IFN-
. Some of the cytokines produced in response to CpG ODN in the human system, such as IFN-
, up-regulate Fc
RI and activate monocytes indirectly. Indirect mechanisms are also responsible for the effects that CpG ODN has on granulocytes, because TLR9 is not expressed by murine or human granulocytes. CpG A and CpG B have similar, although not identical, effects on immune cell populations and cytokine production in mice and humans. Thus, there is reason to hypothesize that the differences in response to CpG A and CpG B observed in the murine models described here could be found in humans as well.
In conclusion, the studies outlined above supply valuable information related to the cellular effector mechanisms responsible for the antitumor effects seen with mAb alone, and when combined with CpG A or CpG B. CpG A enhances the efficacy of mAb therapy largely by activating NK cells, whereas CpG B activates multiple effector cell populations. Both classes of ODN are effective only when used with mAbs that are potent mediators of ADCC. Granulocytes appear to play an important role, and may be responsible for much of the synergistic effect seen with the combination of mAb and CpG B. Human Fc
RI expression on granulocytes is up-regulated by CpG B. This FcR is likely responsible for much of the enhanced lysis seen with BsAb and CpG B. A number of important questions remain. We do not know the contribution of monocytes and macrophages, because hFc
RI is also up-regulated on these cells by CpG B. It remains unclear whether the contribution of NK cells and granulocytes is because of their ability to mediate ADCC directly, or whether their role is more indirect because of production of cytokines that contribute to activation of other cell populations. Whereas animal models are useful, they do not always reflect the mechanisms responsible for the efficacy of mAbs used for human disease. Clinical trials of mAb plus CpG B, with clinical correlative studies, have begun recently, and will supply important information related to whether the promising results in animal models can be duplicated in the clinic. Ongoing preclinical and clinical evaluation of mAb mechanisms of action, including assessment of the role of monocytes and macrophages, and immunotherapeutic approaches in involving mAb plus other immunologically active agents is also needed if we are to determine which cellular effectors are responsible for the antitumor effects of mAb and use this information to develop the next generation of rationally designed immunotherapeutic approaches.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by grants from the Dutch Cancer Society "K.W.F." (UU1997-1571 and UU-2001-2496), United States Public Health Service Grants R01 CA77764 and P50 CA097274, and Coley Pharmaceutical Group. G. J. W. serves as a consultant for Coley Pharmaceutical Group. ![]()
2 To whom requests for reprints should be addressed, at Holden Comprehensive Cancer Center, 5970Z JPP University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242. Phone: (319) 353-8620; Fax: (319) 353-8988; E-mail: george-weiner{at}uiowa.edu ![]()
3 The abbreviations used are: mAb, monoclonal antibody; Ab, antibody; ADCC, antibody-dependent cell-mediated cytotoxicity; BsAb, bispecific antibody; DC, dendritic cell; FACS, fluorescence-activated cell sorter; FcR, Fc receptor; Fc
R, receptor for Fc domain of IgG; h, human; mG-CSF, murine granulocyte colony-stimulating factor; NK, natural killer; NTg, nontransgenic; ODN, oligodeoxynucleotide; Tg, transgenic; TLR9, toll-like receptor 9. ![]()
Received 2/20/03. Revised 5/19/03. Accepted 6/ 2/03.
| REFERENCES |
|---|
|
|
|---|
RI/CD64-directed bispecific antibodies in B-cell lymphoma. Blood, 96: 3544-3552, 2000.
R-directed immunotherapies. Immunol. Today, 18: 127-135, 1997.[Medline]
receptor type I-expressing effector cells. Cancer Res., 57: 4008-4014, 1997.
RI; CD64) in enhanced tumor cell cytotoxicity of neutrophils during granulocyte colony-stimulating factor therapy. Blood, 82: 931-939, 1993.
RI/CD64 transgenic model for in vivo analysis of (bispecific) antibody therapeutics. J. Hematother., 4: 351-356, 1995.[Medline]
RI/CD64 triggers enhanced antibody responses in transgenic mice. J. Clin. Investig., 97: 331-338, 1996.[Medline]
RI (CD64) confer the unique high affinity binding of IgG2a. Mol. Immunol., 35: 989-996, 1998.[Medline]
RI) after stimulation with granulocyte colony-stimulating factor (G-CSF). J. Leukoc. Biol., 57: 455-461, 1995.[Abstract]
RI, CD64) after in vivo application of recombinant human granulocyte colony-stimulating factor. Blood, 78: 885-889, 1991.
RIII (CD16). J. Immunol., 161: 3026-3032, 1998.
RI x murine MHC class II bispecific antibody. Cancer Immunol. Immunother., 45: 166-170, 1997.[Medline]
RI x anti-HER-2/neu) in combination with granulocyte-colony-stimulating factor (Filgrastim) for treatment of advanced breast cancer. Cancer Immunol. Immunother., 45: 207-209, 1997.[Medline]
RI as target for immunotherapy of invasive candidiasis.. J. Immunol., 166: 7019-7022, 2001.This article has been cited by other articles:
![]() |
J. P. Leonard, B. K. Link, C. Emmanouilides, S. A. Gregory, D. Weisdorf, J. Andrey, J. Hainsworth, J. A. Sparano, D. E. Tsai, S. Horning, et al. Phase I Trial of Toll-Like Receptor 9 Agonist PF-3512676 with and Following Rituximab in Patients with Recurrent Indolent and Aggressive Non Hodgkin's Lymphoma Clin. Cancer Res., October 15, 2007; 13(20): 6168 - 6174. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Damiano, R. Caputo, S. Garofalo, R. Bianco, R. Rosa, G. Merola, T. Gelardi, L. Racioppi, G. Fontanini, S. De Placido, et al. TLR9 agonist acts by different mechanisms synergizing with bevacizumab in sensitive and cetuximab-resistant colon cancer xenografts PNAS, July 24, 2007; 104(30): 12468 - 12473. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iida, H. Misaka, M. Inoue, M. Shibata, R. Nakano, N. Yamane-Ohnuki, M. Wakitani, K. Yano, K. Shitara, and M. Satoh Nonfucosylated Therapeutic IgG1 Antibody Can Evade the Inhibitory Effect of Serum Immunoglobulin G on Antibody-Dependent Cellular Cytotoxicity through its High Binding to Fc{gamma}RIIIa. Clin. Cancer Res., May 1, 2006; 12(9): 2879 - 2887. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Damiano, R. Caputo, R. Bianco, F. P. D'Armiento, A. Leonardi, S. De Placido, A. R. Bianco, S. Agrawal, F. Ciardiello, and G. Tortora Novel Toll-Like Receptor 9 Agonist Induces Epidermal Growth Factor Receptor (EGFR) Inhibition and Synergistic Antitumor Activity with EGFR Inhibitors Clin. Cancer Res., January 15, 2006; 12(2): 577 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. N. Buhtoiarov, H. D. Lum, G. Berke, P. M. Sondel, and A. L. Rakhmilevich Synergistic Activation of Macrophages via CD40 and TLR9 Results in T Cell Independent Antitumor Effects J. Immunol., January 1, 2006; 176(1): 309 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Roda, R. Parihar, and W. E. Carson III CpG-Containing Oligodeoxynucleotides Act through TLR9 to Enhance the NK Cell Cytokine Response to Antibody-Coated Tumor Cells J. Immunol., August 1, 2005; 175(3): 1619 - 1627. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Friedberg, H. Kim, M. McCauley, E. M. Hessel, P. Sims, D. C. Fisher, L. M. Nadler, R. L. Coffman, and A. S. Freedman Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin lymphoma: increased interferon-{alpha}/{beta}-inducible gene expression, without significant toxicity Blood, January 15, 2005; 105(2): 489 - 495. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Christiansen and A. K. Rajasekaran Biological impediments to monoclonal antibody-based cancer immunotherapy Mol. Cancer Ther., November 1, 2004; 3(11): 1493 - 1501. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bevaart, H. H. Van Ojik, A. W. Sun, T. H. Sulahian, J. H. W. Leusen, G. J. Weiner, J. G. J. van de Winkel, and M. J. Van Vugt CpG oligodeoxynucleotides enhance Fc{gamma}RI-mediated cross presentation by dendritic cells Int. Immunol., August 1, 2004; 16(8): 1091 - 1098. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |