| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
-1 Promotes Invasion of Head and Neck Squamous Cell Carcinoma1
Departments of Otolaryngology [S. M. T., F. M. C., J. S., S. D. D., J. R. G.], Pharmacology [J. R. G.], Pathology [A. W., J. K.], and Biostatistics [W. E. G.], University of Pittsburgh, University of Pittsburgh Cancer Institute, and Pittsburgh Veterans’ Administration Medical Center [A. W., J. K.], Pittsburgh, Pennsylvania 15213
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-1 (PLC-1) contributes to tumor cell invasion in experimental systems when activated by the epidermal growth factor receptor (EGFR). We hypothesized that EGFR overexpression in HNSCC mediates invasion via PLC-1. On EGFR ligand stimulation, phosphorylation of PLC-1 increased in all of the HNSCC cell lines tested (4 of 4). In the presence of EGFR-specific tyrosine kinase inhibitor (PD153035) or an anti-EGFR antibody (C225), PLC-1 activation was abrogated indicating that PLC-1 was downstream of EGFR. Blocking cellular PLC with an inhibitor (U73122) reduced inositol phosphate turnover in all of the HNSCC cell lines examined, and treatment with the PLC inhibitor or antisense oligonucleotides targeting PLC-1 significantly reduced in vitro invasiveness of HNSCC cell lines through Matrigel. To determine the clinical relevance of these findings, we compared levels of PLC-1 in tumor and paired normal tissue from 33 patients with HNSCC. PLC-1 levels were significantly higher (P < 0.0001) in the tumors compared with the normal mucosa of HNSCC patients. Levels of activated PLC-1 were analyzed in 20 patients. Tumors expressed higher levels of phosphorylated PLC-1 compared with normal adjacent mucosa (P = 0.05). Thus, PLC-1 may mediate invasion and metastasis downstream of EGFR in HNSCC. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
More than 95% of HNSCC tumors express elevated levels of the EGFR (2 , 3) . We have shown previously that increased EGFR expression in HNSCC tumors correlates with reduced survival and an increased incidence of lymph node metastasis (4) . An established oncogene, EGFR mediates cellular motility, proliferation, and prevents apoptosis in HNSCC cells via activation of a number of downstream signaling pathways. Activation of these pathways by EGFR is necessary for tumor progression (5) . However, to rationally disrupt these events, an increased understanding of EGFR signaling is required to elucidate its biological role in cancers including HNSCC.
Several signaling pathways downstream of EGFR have been reported in HNSCC including the MAPK, phosphatidylinositol 3'-kinase, and STATs (6)
. Several lines of evidence suggest a redundancy among EGFR signaling pathways (7)
, whereas others have reported modulation of a specific phenotype when one pathway is specifically targeted. In HNSCC cells, EGFR-stimulated MAPK activation induced proliferation but not invasion (8)
. The phosphatidylinositol 3'-kinase pathway has been implicated in mediating antiapoptotic functions and conferring radiation-resistance in HNSCC cells (9)
. We have shown previously that EGFR-mediated STAT3 activation is required for cell growth and survival in vitro (10)
. Additional evidence suggests that constitutively activated STAT3 in HNSCC tumors results in uncontrolled cell growth by an antiapoptotic mechanism (11)
. Phosphoinositide bisphosphate turnover downstream from PLC activation has not been studied previously in HNSCC.
The present study was undertaken to test the hypothesis that EGFR stimulation of PLC-1 mediates cell invasion in HNSCC. We examined PLC-1 expression and activation in a series of HNSCC cell lines and patient tissues. Blockade of EGFR abrogated PLC-1 levels suggesting that PLC-1 activation in HNSCC cells was primarily because of EGFR stimulation. Abrogation of PLC-1 decreased HNSCC cell invasion in vitro without affecting cell proliferation. In vivo, PLC-1 was expressed and phosphorylated at higher levels in tumor tissue compared with normal adjacent mucosa. These results indicate that EGFR-mediated PLC-1 activation modulates invasion of HNSCC cells and may contribute to tumorigenesis.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Patient tissues used in the study were obtained from patients undergoing surgery at the University of Pittsburgh Medical Center. Primary HNSCC and normal adjacent mucosa (
5 cm away from tumor site) were harvested under the auspices of an Institutional Review Board-approved protocol. Signed informed consent was obtained from each subject.
Reagents.
For in vitro cell stimulation, recombinant human EGF (Sigma Chemical Co., St. Louis, MO) was used. U73122 (BioMol, Plymouth Meeting, PA) was used to block PLC activity. An inactive analogue of U73122, U73343 (BioMol), was used as a negative control. Specific EGFR tyrosine kinase inhibitor PD153035 was obtained from Calbiochem-Novabiochem Corporation (San Diego, CA). The EGFR blocking antibody C225 was obtained from Imclone Systems Incorporated (New York, NY). Antibodies used included mouse monoclonal anti-PLC -1 (Upstate Biotechnology, Lake Placid, NY), antiphospho-PLC-1 (Cell Signaling Technologies, Beverly, MA), and ß-actin (Calbiochem-Novabiochem Corporation). Antisense and scrambled PLC-1 oligonucleotides were obtained from MWG Biotech (High Point, NC). The PLC-1 antisense oligonucleotide (5'AGGGGACGCGGCGCCCGCCAT3') is a 21-mer fragment directed against the translation initiation site of human PLC-1 (derived from Ref. 15
). A control scrambled oligonucleotide sequence of the antisense sequence to PLC-1 (5'ATCCGCGGTGGCCGCCGCCAG3') was also used in the study.
Effect of PLC Inhibition on Cellular Proliferation.
The cytotoxic effects of the PLC inhibitor U73122 and antisense PLC-1 oligonucleotides were determined by incubating HNSCC cells in increasing concentrations of reagents for 2–4 days. Cells were plated in growth medium (MEM + 10% FCS + 1% nonessential amino acids) in triplicate wells at a density of 2 x 104 cells/well in 24-well plates. After 24 h, the medium was replaced with growth medium containing either the PLC inhibitor U73122 or vehicle control (chloroform). For studies with oligonucleotides, medium was replaced with serum-free medium containing the respective oligonucleotides. At a predetermined end point cells were trypsinized and counted on a hemocytometer.
Immunoblotting.
Briefly, 80–90% confluent cells were serum starved for 48 h. Cells were then subjected to either 3 µM U73122 or U73343 for 25 min, 200 nM PD153035 or 7 µg/ml C225 for 2 h followed by stimulation with 10 ng/ml of recombinant human EGF for 5 min. After treatment, cells were harvested in lysis buffer [10 mM Tris HCl (pH 7.6), 50 mM Na4P2O7, 50 mM NaF, 1 mM NaV3O4, 1% Triton X-100 and 1x protease inhibitor mixture tablet that included a broad spectrum potent inhibitor of protein tyrosine phosphatases (Roche, Germany)]. Lysates were sonicated for 3 s and centrifuged at 4°C, 14,000 rpm for 5 min. The supernatant was collected for protein quantitation using the Bio-Rad protein assay dye reagent (Bio-Rad Laboratories, Hercules, CA) and BSA of known concentration as the standard. Fifty µg of protein was size-fractionated through an 8% SDS-PAGE gel and immunoblotted with anti-pPLC-1 antibody (Cell Signaling Technologies) followed by anti-PLC-1 antibody (Upstate Biotechnology).
Frozen HNSCC tumor and normal tissue samples were finely minced and suspended in 1 ml of lysis buffer (1% NP40, 0.1 M phenylmethylsulfonyl fluoride, and 1 µg/ml leupeptin and aprotinin). The cell debrie was pelleted and the supernatant aliquoted, protein concentration estimated, and the proteins were size-fractionated on an 8% SDS-PAGE gel as mentioned before. Paired samples for tumor and normal tissue were always run next to each other on the same gel. Twenty µg of A431 protein extract was loaded on every gel as a positive control and normalization standard. Samples were electrophoresed along with a Bio-Rad molecular weight marker (Bio-Rad). The proteins were transferred to a nitrocellulose membrane in a semidry transfer apparatus (Bio-Rad). Western blots were probed with anti-PLC-1, anti-pPLC-1, or anti-ß-actin antibody (Oncogene Research Products), and the signals were obtained on autoradiograms after enhanced chemiluminescent detection (Amersham ECL kit). Signals were quantified on a Molecular Dynamics Personal Densitometer SI and ImageQuant software (Image Products International, Chantilly, VA). Values obtained from PLC-1 and pPLC-1 quantification were normalized to ß-actin levels as well as A431 levels. The ratio of the tumor:normal PLC-1 and phospho-PLC-1 levels were calculated.
In Vitro Invasion of HNSCC Cells.
Cell invasiveness was evaluated in vitro using Matrigel-coated semipermeable modified Boyden inserts with a pore size of 8 µm (Becton Dickinson/Biocoat, Bedford, MA). Cells were plated at a density of 2 x 104 cells/well in the chamber or insert. Both the insert and the holding well were subjected to the same medium composition with the exception of serum. The insert contained no serum, whereas the lower well contained 10% FBS that served as a chemoattractant. Chambers were treated with reagents depending on the experiment. Reagents used for invasion assays were EGF (10 ng/ml), PLC-1 antisense oligonucleotides (5'AGGGGACGCGGCGCCCGCCAT3'), or scrambled control oligonucleotides (5'ATCCGCGGTGGCCGCCGCCAG3'; 12.5 µM), U73122 (3 µM), U73343 (3 µM), or PD153035 (200 nM). After 48 h of treatment at 37°C in a 5% CO2 incubator, the cells in the insert were removed by wiping gently with a cotton swab. Cells on the reverse side of the insert were fixed and stained with Hema 3 (Fisher Scientifics) according to the manufacturer’s instructions. Invading cells in 4 representative fields were counted using light microscopy at x400 magnification. Mean ± SE was calculated from two independent experiments.
IP Turnover Assay.
The accumulation of IP was measured in cells as described previously (16)
. Briefly, cells were incubated with 0.5 µCi/ml myo [1,2-3H (N)]-inositol for 24 h followed by incubation with 10 mM LiCl2 for 10 min and then subjected to U73122 (3 µM) treatment for 25 min and/or recombinant human EGF (10 ng/ml) for 5 min. Cell lysates were run on AG1-X8 100–200 mesh anion-exchange resin-containing columns. IP was eluted using ammonium formate/formic acid (200 mM/100 mM). Levels of IP were obtained from radioactive counts in the ammonium formate/formic acid fraction.
Statistical Analysis.
The signed rank test was applied to test the differences between PLC-1 levels in tumor compared with matched adjacent normal mucosa of 33 subjects. To analyze the differences between phosphorylated PLC-1 levels in tumor and normal tissue from 20 subjects, the exact sign rank test was used. Cell counts from invasion experiments were analyzed by a one-way ANOVA. Pairwise differences were tested with the Sidak procedure.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-1 Activation in HNSCC Cells.-1 has not been studied previously in HNSCC cells. Four HNSCC cell lines were screened for expression of PLC-1. All four of the cell lines were found to express basal levels of PLC-1 (Fig. 1A)
. Phosphorylation of PLC-1 by EGFR tyrosine kinase results in activation of PLC-1. The ability of EGFR ligand, EGF, to induce PLC-1 phosphorylation was tested. HNSCC cells were serum starved for 48 h to minimize the effects of growth factors in the serum and signaling from secreted autocrine ligands. Cells were then stimulated with recombinant EGF (10 ng/ml for 5 min). Total cellular protein was harvested and fractionated on a SDS-PAGE gel. Western blotting was performed with anti-phospho-PLC-1 followed by anti-PLC-1 antibody to demonstrate equal loading. In all four of the cell lines tested, the EGFR ligand increased phosphorylation of PLC-1 compared with corresponding unstimulated cells (Fig. 1B)
. These findings suggest that EGFR ligand stimulation induces phosphorylation and, hence, activation of PLC-1 in HNSCC cells.
|
-1.-1 can be stimulated after activation of several growth factor receptors including EGFR. To determine whether activation of PLC-1 was mediated via an EGFR signaling pathway, HNSCC cells were treated with an EGFR-specific tyrosine kinase inhibitor (PD153035) at a dose reported previously to block EGFR phosphorylation in HNSCC cells (17)
. A representative HNSCC cell line (OSC-19) was pretreated for 2 h with either EGFR inhibitor PD153035 (200 nM) or anti-EGFR antibody C225 (7 µg/ml), or for 25 min with PLC inhibitor U73122 or the inactive analogue U73343 (3 µM). Pretreatment was followed by EGF stimulation (10 ng/ml for 5 min). Protein extracts were fractionated on a SDS-PAGE gel. Immunoblots were probed with anti-phospho-PLC-1 antibody and PLC-1 antibody to demonstrate equal loading. Activation of PLC-1 was reduced by EGFR or PLC inhibition by more than 90% (Fig. 2, A and B)
. These results indicate that EGFR activation stimulates PLC-1 phosphorylation in HNSCC cells.
|
-1 Signaling Reduces Cell Invasion in Vitro.
.
|
-1 hydrolyzes phosphatidylinositol biphosphate to inositol triphosphate and diacylglecerol. The amount of the inositol triphosphate produced indicates the activity of PLC enzyme within cells and is a measure of PLC-1 activation. IP turnover in HNSCC cell lines treated with a PLC inhibitor was measured to determine whether reduced invasion correlated with lowered PLC activity. Cells were quiesed for 24 h and then treated with U73122 (3 µM for 25 min) and EGF (10 ng/ml for 5 min). We found that PLC inhibition by U73122 resulted in a decrease in IP turn over all of the HNSCC cell lines tested (Fig. 3B)
.
To determine whether invasion was mediated by EGFR signaling in vitro, HNSCC cells were plated in Matrigel-coated transwell chambers in the presence of either PLC or EGFR-specific inhibitors (U73122 or PD153035, respectively). After 48 h, the cells that invaded the transwell chamber were fixed, stained, and counted. We found that inhibition of either EGFR or PLC significantly reduced the percentage of cells invading the Matrigel as compared with untreated control wells by >50% (Fig. 3C)
.
Because U73122 inhibits all of the cellular PLCs, we designed PLC-1 antisense oligonucleotides to test the consequence of specific abrogation of PLC-1. The antisense oligonucleotide was directed against the ATG start site. HNSCC cells (OSC-19) were plated in invasion chambers at a high density and treated with EGF (10 ng/ml), EGF + U73122 (3 µM), EGF + antisense oligonucleotides against PLC-1 (12.5 µM), or EGF + control scrambled oligonucleotides (12.5 µM). Cells were treated for 48 h, fixed, stained, and counted. Immunoblotting demonstrated that the PLC-1 antisense oligonucleotides decreased expression of PLC-1 protein by 50% (Fig. 4A)
. Both the PLC inhibitor as well as PLC-1 antisense oligonucleotides abrogated in vitro invasion of a representative HNSCC cell line (Fig. 4B)
. On quantifying the number of invading cells it was found that the number of invading cells in wells with inhibitors was reduced significantly compared with the corresponding controls (P = 0.05 when tested with the Sikak procedure; Fig. 4C
).
|
-1 inhibition on cell proliferation, a representative HNSCC cell line (OSC-19) was treated with 12.5 µM of PLC-1 antisense oligonucleotides, scrambled control oligonucleotides, or PLC inhibitor U73122. The cell number in each well was determined at several time points by cell counting using vital dye exclusion. There was no significant difference in cell viability after PLC-1 blockade (Fig. 5)
. The lack of effect of PLC-1 inhibition on cell proliferation was corroborated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay as well as flow cytometric analysis (data not shown).
|
-1 in Tumors Compared with Corresponding Normal Mucosa from HNSCC Patients.-1 plays an important role in invasion of HNSCC cell lines. To explore the biological significance of this finding, we compared protein expression levels of PLC-1 in 33 HNSCC tumors and paired normal mucosa harvested several centimeters away from the tumor (see Table 1
for patient characteristics). Using immunoblotting of tissue lysates, we found a 1.8-fold increase in PLC-1 expression levels in HNSCC tumors compared with levels in paired adjacent normal mucosa (P = 0.0001; Fig. 6
). In 30 of 33 (91%) cases, PLC-1 expression levels in the tumor were greater than those in the corresponding normal mucosa. We also examined levels of phosphorylated PLC-1 in a subset of the paired tissues where adequate material was available for analysis (20 subjects). In these samples, activated PLC-1 levels were 1.65-fold higher in HNSCC tumors compared with levels in paired normal mucosa (P = 0.05). These in vitro and in vivo results indicate that EGFR-mediated PLC-1 activation may play an important role in invasion of HNSCC cells.
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-1 and that PLC-1 may be involved in tumor progression. Upon ligand stimulation, EGFR activated PLC-1 in a series of HNSCC cell lines and mediated cellular invasion in vitro. Targeting PLC-1 reduced invasion of HNSCC cells through Matrigel. Furthermore, abrogation of PLC-1 did not modulate proliferation or survival. These findings implicate a specific invasive function of EGFR-mediated signaling via PLC-1 activation. To determine the clinical relevance of our in vitro findings, we examined PLC-1 and phosphorylated PLC-1 levels in HNSCC tumors compared with levels in paired normal adjacent mucosa. This is the first study, to our knowledge, of activated PLC-1 in de novo human cancers. Expression levels of both PLC-1 and phosphorylated PLC-1 were elevated nearly 2-fold in the tumors. These results suggest that PLC-1 plays an important role in EGFR-mediated invasion of HNSCC.
EGFR elicits multiple biological effects in cells overexpressing the receptor including proliferation, prevention of apoptosis, invasion, and transformation (18)
. Despite the multiplicity of downstream EGFR signaling pathways, several lines of evidence support a redundancy in EGFR signaling. For example, ligand-stimulated EGFR mutants unable to bind SH2 domain proteins use alternate mechanisms including tyrosine-phosphorylated proteins (Shc and Gab1) to activate downstream effectors (19)
. Thus, an alternate pathway resulting in phenotypic effects expected on EGFR ligand stimulation can overcome the specific inhibition of a downstream effector. However, other studies have reported specificity associated with signaling pathways activated by EGFR. We have shown previously that activation of EGFR stimulates STAT activation pathways that regulate proliferative and antiapoptotic signals (20)
. Down-modulation of STAT3 using antisense oligonucleotides or dominant-negative approaches resulted in abrogation of growth and apoptosis in HNSCC cells (21)
. In HNSCC cells, EGFR has been shown to modulate proliferation via MAPK where inhibition of MAPK activation by EGFR did not affect invasion in vitro (8)
. To elucidate the role of EGFR-mediated signaling via PLC-1 in both mitogenic and motogenic responses, we specifically blocked PLC-1 using several approaches in HNSCC cell lines and determined the effects on proliferation. Our results suggest that PLC-1 inhibition decreases invasion but not proliferation of HNSCC cells in vitro. Similar findings have been reported in prostate carcinoma cells where inhibition of PLC-1 in vitro did not decrease cell growth, whereas in vivo PLC blockade reduced invasion but not tumor volumes (22
, 23)
. Thus, activated EGFR may specifically mediate cancer cell invasion by activation of PLC-1.
This is the first report to demonstrate a correlation between EGFR-mediated PLC-1 signaling in HNSCC and its effects on cellular behavior. Little is known about the biology of invasion in HNSCC cells. Given the high rate of invasion and its associated morbidity and mortality, elucidation of the molecular mechanisms that govern tumor cell invasion is critical for the design of improved therapeutic strategies. To invade, cells secrete proteases that remodel the extracellular matrix and/or activate the tumor cells enabling the cells to migrate although the basement membrane. The MMP family of proteolytic enzymes has been implicated in tumor cell invasion. Several studies have reported up-regulation of MMP-2 and -9 in HNSCC tissues (24, 25, 26)
. Increased expression levels of MMP-9 were found to correlate with overexpression of EGFR in HNSCC tumors (27)
. Incubation of HNSCC cells with EGFR ligands increased MMP-9 gene expression and in vitro invasion in HNSCC cells (28)
. The mechanisms that govern EGFR regulation of MMPs are incompletely understood. Another protease linked to increased cell motility, the urokinase-type plasminogen activator, has also been shown to play a role in EGFR-mediated invasion of HNSCC cells (29)
. However, these proteases appear to function downstream of EGFR activation and are not directly modulated by cytoplasmic EGFR signaling pathways. We found decreased invasion of HNSCC cells after treatment with an EGFR-specific tyrosine kinase inhibitor. Abrogation of HNSCC invasion after EGFR or a PLC-1 inhibition suggests that PLC-1 is activated immediately downstream of EGFR leading to HNSCC cellular invasion.
To examine the clinical relevance of our in vitro data, we measured the levels of PLC-1 and phosphorylated PLC-1 in HNSCC tumors and paired normal mucosa specimens. Our results suggest that HNSCC tumors express significantly higher levels of PLC-1 in tumors compared with adjacent normal epithelial mucosa. Mammary carcinoma cells were reported to express increased levels of EGFR and erbB-2, as well as PLC-1 when compared with levels in nonmalignant breast tissue (30)
. Others have reported in vivo overexpression of PLC-1 protein in meningiomas (31)
and colorectal carcinomas (32, 33, 34)
. However for the first time, we examined activation status by probing for phosphorylated PLC-1 and found it to be increased in the tumor tissues. Up-regulation of PLC-1 downstream of EGFR may contribute to the invasive phenotype of HNSCC tumors. Therapies that specifically target PLC-1 may reduce local and regional tumor invasion and, hence, improve survival.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by NIH Grant 5RO1CA77308 (to J. R. G.), a Veterans Administration Merit Award (to A. W.) and a Lung Specialized Programs of Research Excellence postdoctoral fellowship (to S. M. T.). 
2 To whom requests for reprints should be addressed, at Department of Otolaryngology, The Eye and Ear Institute Building, Suite 500, 200 Lothrop Street, Pittsburgh, PA 15213. Phone: (412) 647-5280; Fax: (412) 647-2080; E-mail: jgrandis{at}pitt.edu
3 The abbreviations used are: HNSCC, head and neck squamous cell carcinoma; EGFR, epidermal growth factor receptor; MAPK, mitogen-activated protein kinase; STAT, signal transducers and activators of transcription; PLC, phospholipase C; FBS, fetal bovine serum; SCC, squamous cell carcinoma; EGF, epidermal growth factor; IP, inositol phosphate; MMP, matrix metalloproteinase.
Received 2/12/03. Revised 5/20/03. Accepted 6/11/03.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer. Cancer Res., 53: 3579-3584, 1993. and EGFR protein in head and neck squamous cell carcinoma and patient survival. J. Natl. Cancer Inst., 90: 824-832, 1998.-mediated signaling in tumor cell invasion. Clin. Cancer Res., 5: 2251-2260, 1999. signaling abrogates DU-145 prostate tumor cell invasion. Clin. Cancer Res., 3: 2275-2282, 1997. 1 in meningiomas. Hum. Pathol., 25: 146-153, 1994.[Medline]
1 in colorectal carcinomas is associated with overexpression of factors that bind its promoter. J. Biol. Chem., 270: 16378-16384, 1995. 1, ß 1, and 
1 in primary human colon carcinomas and colon carcinoma cell lines. Mol. Carcinog., 12: 146-152, 1995.[Medline]
1 in colorectal cancer tissues. Cancer (Phila.), 73: 36-41, 1994.This article has been cited by other articles:
|
|
 |
|
  W. K. K. WU, T. T. M. TSE, J. J. Y. SUNG, Z. J. LI, L. YU, and C. H. CHO Expression of ErbB Receptors and their Cognate Ligands in Gastric and Colon Cancer Cell Lines Anticancer Res, January 1, 2009; 29(1): 229 - 234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Sala, F. Dituri, C. Raimondi, S. Previdi, T. Maffucci, M. Mazzoletti, C. Rossi, M. Iezzi, R. Lattanzio, M. Piantelli, et al. Phospholipase C{gamma}1 Is Required for Metastasis Development and Progression Cancer Res., December 15, 2008; 68(24): 10187 - 10196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Liu, W. K. K. Wu, L. Yu, Z. J. Li, J. J. Y. Sung, S. T. Zhang, and C. H. Cho Epidermal Growth Factor-Induced Esophageal Cancer Cell Proliferation Requires Transactivation of {beta}-Adrenoceptors J. Pharmacol. Exp. Ther., July 1, 2008; 326(1): 69 - 75. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Nozawa, G. Howell, S. Suzuki, Q. Zhang, Y. Qi, J. Klein-Seetharaman, A. Wells, J. R. Grandis, and S. M. Thomas Combined Inhibition of PLC{gamma}-1 and c-Src Abrogates Epidermal Growth Factor Receptor-Mediated Head and Neck Squamous Cell Carcinoma Invasion Clin. Cancer Res., July 1, 2008; 14(13): 4336 - 4344. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-W. Lo, S.-C. Hsu, W. Xia, X. Cao, J.-Y. Shih, Y. Wei, J. L. Abbruzzese, G. N. Hortobagyi, and M.-C. Hung Epidermal Growth Factor Receptor Cooperates with Signal Transducer and Activator of Transcription 3 to Induce Epithelial-Mesenchymal Transition in Cancer Cells via Up-regulation of TWIST Gene Expression Cancer Res., October 1, 2007; 67(19): 9066 - 9076. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. P. Jones and M. Katan Role of Phospholipase C{gamma}1 in Cell Spreading Requires Association with a {beta}-Pix/GIT1-Containing Complex, Leading to Activation of Cdc42 and Rac1 Mol. Cell. Biol., August 15, 2007; 27(16): 5790 - 5805. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. V. Karamouzis, J. R. Grandis, and A. Argiris Therapies Directed Against Epidermal Growth Factor Receptor in Aerodigestive Carcinomas JAMA, July 4, 2007; 298(1): 70 - 82. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Wang, K. Peyrollier, and L. Y. Bourguignon The Influence of Hyaluronan-CD44 Interaction on Topoisomerase II Activity and Etoposide Cytotoxicity in Head and Neck Cancer Arch Otolaryngol Head Neck Surg, March 1, 2007; 133(3): 281 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Thomas, N. E. Bhola, Q. Zhang, S. C. Contrucci, A. L. Wentzel, M. L. Freilino, W. E. Gooding, J. M. Siegfried, D. C. Chan, and J. R. Grandis Cross-talk between G Protein-Coupled Receptor and Epidermal Growth Factor Receptor Signaling Pathways Contributes to Growth and Invasion of Head and Neck Squamous Cell Carcinoma Cancer Res., December 15, 2006; 66(24): 11831 - 11839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Wang and L. Y. W. Bourguignon Hyaluronan and the Interaction Between CD44 and Epidermal Growth Factor Receptor in Oncogenic Signaling and Chemotherapy Resistance in Head and Neck Cancer. Arch Otolaryngol Head Neck Surg, July 1, 2006; 132(7): 771 - 778. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kalyankrishna and J. R. Grandis Epidermal Growth Factor Receptor Biology in Head and Neck Cancer J. Clin. Oncol., June 10, 2006; 24(17): 2666 - 2672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang, J. Wu, and Z. Wang Akt Binds to and Phosphorylates Phospholipase C-{gamma}1 in Response to Epidermal Growth Factor Mol. Biol. Cell, May 1, 2006; 17(5): 2267 - 2277. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Wang and L. Y. W. Bourguignon Hyaluronan-CD44 Promotes Phospholipase C-Mediated Ca2+ Signaling and Cisplatin Resistance in Head and Neck Cancer Arch Otolaryngol Head Neck Surg, January 1, 2006; 132(1): 19 - 24. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. P. Jones, J. Peak, S. Brader, S. A. Eccles, and M. Katan PLC{gamma}1 is essential for early events in integrin signalling required for cell motility J. Cell Sci., June 15, 2005; 118(12): 2695 - 2706. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Allen, L. S. Young, and C. W. Dawson The Epstein-Barr Virus-Encoded LMP2A and LMP2B Proteins Promote Epithelial Cell Spreading and Motility J. Virol., February 1, 2005; 79(3): 1789 - 1802. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
