Cancer Research Cancer Epigenetics  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, S. M.
Right arrow Articles by Grandis, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, S. M.
Right arrow Articles by Grandis, J. R.
[Cancer Research 63, 5629-5635, September 1, 2003]
© 2003 American Association for Cancer Research


Regular Articles

Epidermal Growth Factor Receptor-stimulated Activation of Phospholipase C{gamma}-1 Promotes Invasion of Head and Neck Squamous Cell Carcinoma1

Sufi Mary Thomas, Francesca M. Coppelli, Alan Wells, William E. Gooding, John Song, Jareer Kassis, Stephanie D. Drenning and Jennifer Rubin Grandis2

Departments of Otolaryngology [S. M. T., F. M. C., J. S., S. D. D., J. R. G.], Pharmacology [J. R. G.], Pathology [A. W., J. K.], and Biostatistics [W. E. G.], University of Pittsburgh, University of Pittsburgh Cancer Institute, and Pittsburgh Veterans’ Administration Medical Center [A. W., J. K.], Pittsburgh, Pennsylvania 15213


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lymph node metastasis and local invasion of head and neck squamous cell carcinoma (HNSCC) is associated with a poor prognosis. However, little is known about the factors governing tumor cell invasion in HNSCC. Phospholipase C{gamma}-1 (PLC{gamma}-1) contributes to tumor cell invasion in experimental systems when activated by the epidermal growth factor receptor (EGFR). We hypothesized that EGFR overexpression in HNSCC mediates invasion via PLC{gamma}-1. On EGFR ligand stimulation, phosphorylation of PLC{gamma}-1 increased in all of the HNSCC cell lines tested (4 of 4). In the presence of EGFR-specific tyrosine kinase inhibitor (PD153035) or an anti-EGFR antibody (C225), PLC{gamma}-1 activation was abrogated indicating that PLC{gamma}-1 was downstream of EGFR. Blocking cellular PLC with an inhibitor (U73122) reduced inositol phosphate turnover in all of the HNSCC cell lines examined, and treatment with the PLC inhibitor or antisense oligonucleotides targeting PLC{gamma}-1 significantly reduced in vitro invasiveness of HNSCC cell lines through Matrigel. To determine the clinical relevance of these findings, we compared levels of PLC{gamma}-1 in tumor and paired normal tissue from 33 patients with HNSCC. PLC{gamma}-1 levels were significantly higher (P < 0.0001) in the tumors compared with the normal mucosa of HNSCC patients. Levels of activated PLC{gamma}-1 were analyzed in 20 patients. Tumors expressed higher levels of phosphorylated PLC{gamma}-1 compared with normal adjacent mucosa (P = 0.05). Thus, PLC{gamma}-1 may mediate invasion and metastasis downstream of EGFR in HNSCC.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Nearly 50% of patients with HNSCC3 present with cervical lymph node metastases (1) . Invasion of the tumor into the neck viscera is a primary cause of morbidity and mortality in this cancer. The mechanisms that govern tumor cell invasion in HNSCC are incompletely understood. Elucidation of the molecular events that mediate invasion is required to improve therapeutic approaches and, hence, survival.

More than 95% of HNSCC tumors express elevated levels of the EGFR (2 , 3) . We have shown previously that increased EGFR expression in HNSCC tumors correlates with reduced survival and an increased incidence of lymph node metastasis (4) . An established oncogene, EGFR mediates cellular motility, proliferation, and prevents apoptosis in HNSCC cells via activation of a number of downstream signaling pathways. Activation of these pathways by EGFR is necessary for tumor progression (5) . However, to rationally disrupt these events, an increased understanding of EGFR signaling is required to elucidate its biological role in cancers including HNSCC.

Several signaling pathways downstream of EGFR have been reported in HNSCC including the MAPK, phosphatidylinositol 3'-kinase, and STATs (6) . Several lines of evidence suggest a redundancy among EGFR signaling pathways (7) , whereas others have reported modulation of a specific phenotype when one pathway is specifically targeted. In HNSCC cells, EGFR-stimulated MAPK activation induced proliferation but not invasion (8) . The phosphatidylinositol 3'-kinase pathway has been implicated in mediating antiapoptotic functions and conferring radiation-resistance in HNSCC cells (9) . We have shown previously that EGFR-mediated STAT3 activation is required for cell growth and survival in vitro (10) . Additional evidence suggests that constitutively activated STAT3 in HNSCC tumors results in uncontrolled cell growth by an antiapoptotic mechanism (11) . Phosphoinositide bisphosphate turnover downstream from PLC{gamma} activation has not been studied previously in HNSCC.

The present study was undertaken to test the hypothesis that EGFR stimulation of PLC{gamma}-1 mediates cell invasion in HNSCC. We examined PLC{gamma}-1 expression and activation in a series of HNSCC cell lines and patient tissues. Blockade of EGFR abrogated PLC{gamma}-1 levels suggesting that PLC{gamma}-1 activation in HNSCC cells was primarily because of EGFR stimulation. Abrogation of PLC{gamma}-1 decreased HNSCC cell invasion in vitro without affecting cell proliferation. In vivo, PLC{gamma}-1 was expressed and phosphorylated at higher levels in tumor tissue compared with normal adjacent mucosa. These results indicate that EGFR-mediated PLC{gamma}-1 activation modulates invasion of HNSCC cells and may contribute to tumorigenesis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Tissues.
Cell lines derived from HNSCC were maintained in DMEM with 10% FBS (Life Technologies, Inc., Grand Island, NY). The OSC-19 cell line was cultured in Eagle’s MEM containing 10% FBS and nonessential amino acids (0.1 mM). Cell lines OSC-19 (12) and PCI-15b were derived from metastatic lymph nodes (13) . UM-22a was derived from a SCC of the buccal mucosal (14) . UPCI:SCC32, derived from the retromolar trigone, is a generous gift from Dr. Susanne M. Gollin (University of Pittsburgh, Pittsburgh, PA). A431 is a well-characterized vulvar SCC known to overexpress EGFR and was used as a positive control.

Patient tissues used in the study were obtained from patients undergoing surgery at the University of Pittsburgh Medical Center. Primary HNSCC and normal adjacent mucosa (~5 cm away from tumor site) were harvested under the auspices of an Institutional Review Board-approved protocol. Signed informed consent was obtained from each subject.

Reagents.
For in vitro cell stimulation, recombinant human EGF (Sigma Chemical Co., St. Louis, MO) was used. U73122 (BioMol, Plymouth Meeting, PA) was used to block PLC activity. An inactive analogue of U73122, U73343 (BioMol), was used as a negative control. Specific EGFR tyrosine kinase inhibitor PD153035 was obtained from Calbiochem-Novabiochem Corporation (San Diego, CA). The EGFR blocking antibody C225 was obtained from Imclone Systems Incorporated (New York, NY). Antibodies used included mouse monoclonal anti-PLC{gamma} -1 (Upstate Biotechnology, Lake Placid, NY), antiphospho-PLC{gamma}-1 (Cell Signaling Technologies, Beverly, MA), and ß-actin (Calbiochem-Novabiochem Corporation). Antisense and scrambled PLC{gamma}-1 oligonucleotides were obtained from MWG Biotech (High Point, NC). The PLC{gamma}-1 antisense oligonucleotide (5'AGGGGACGCGGCGCCCGCCAT3') is a 21-mer fragment directed against the translation initiation site of human PLC{gamma}-1 (derived from Ref. 15 ). A control scrambled oligonucleotide sequence of the antisense sequence to PLC{gamma}-1 (5'ATCCGCGGTGGCCGCCGCCAG3') was also used in the study.

Effect of PLC Inhibition on Cellular Proliferation.
The cytotoxic effects of the PLC inhibitor U73122 and antisense PLC{gamma}-1 oligonucleotides were determined by incubating HNSCC cells in increasing concentrations of reagents for 2–4 days. Cells were plated in growth medium (MEM + 10% FCS + 1% nonessential amino acids) in triplicate wells at a density of 2 x 104 cells/well in 24-well plates. After 24 h, the medium was replaced with growth medium containing either the PLC inhibitor U73122 or vehicle control (chloroform). For studies with oligonucleotides, medium was replaced with serum-free medium containing the respective oligonucleotides. At a predetermined end point cells were trypsinized and counted on a hemocytometer.

Immunoblotting.
Briefly, 80–90% confluent cells were serum starved for 48 h. Cells were then subjected to either 3 µM U73122 or U73343 for 25 min, 200 nM PD153035 or 7 µg/ml C225 for 2 h followed by stimulation with 10 ng/ml of recombinant human EGF for 5 min. After treatment, cells were harvested in lysis buffer [10 mM Tris HCl (pH 7.6), 50 mM Na4P2O7, 50 mM NaF, 1 mM NaV3O4, 1% Triton X-100 and 1x protease inhibitor mixture tablet that included a broad spectrum potent inhibitor of protein tyrosine phosphatases (Roche, Germany)]. Lysates were sonicated for 3 s and centrifuged at 4°C, 14,000 rpm for 5 min. The supernatant was collected for protein quantitation using the Bio-Rad protein assay dye reagent (Bio-Rad Laboratories, Hercules, CA) and BSA of known concentration as the standard. Fifty µg of protein was size-fractionated through an 8% SDS-PAGE gel and immunoblotted with anti-pPLC{gamma}-1 antibody (Cell Signaling Technologies) followed by anti-PLC{gamma}-1 antibody (Upstate Biotechnology).

Frozen HNSCC tumor and normal tissue samples were finely minced and suspended in 1 ml of lysis buffer (1% NP40, 0.1 M phenylmethylsulfonyl fluoride, and 1 µg/ml leupeptin and aprotinin). The cell debrie was pelleted and the supernatant aliquoted, protein concentration estimated, and the proteins were size-fractionated on an 8% SDS-PAGE gel as mentioned before. Paired samples for tumor and normal tissue were always run next to each other on the same gel. Twenty µg of A431 protein extract was loaded on every gel as a positive control and normalization standard. Samples were electrophoresed along with a Bio-Rad molecular weight marker (Bio-Rad). The proteins were transferred to a nitrocellulose membrane in a semidry transfer apparatus (Bio-Rad). Western blots were probed with anti-PLC{gamma}-1, anti-pPLC{gamma}-1, or anti-ß-actin antibody (Oncogene Research Products), and the signals were obtained on autoradiograms after enhanced chemiluminescent detection (Amersham ECL kit). Signals were quantified on a Molecular Dynamics Personal Densitometer SI and ImageQuant software (Image Products International, Chantilly, VA). Values obtained from PLC{gamma}-1 and pPLC{gamma}-1 quantification were normalized to ß-actin levels as well as A431 levels. The ratio of the tumor:normal PLC{gamma}-1 and phospho-PLC{gamma}-1 levels were calculated.

In Vitro Invasion of HNSCC Cells.
Cell invasiveness was evaluated in vitro using Matrigel-coated semipermeable modified Boyden inserts with a pore size of 8 µm (Becton Dickinson/Biocoat, Bedford, MA). Cells were plated at a density of 2 x 104 cells/well in the chamber or insert. Both the insert and the holding well were subjected to the same medium composition with the exception of serum. The insert contained no serum, whereas the lower well contained 10% FBS that served as a chemoattractant. Chambers were treated with reagents depending on the experiment. Reagents used for invasion assays were EGF (10 ng/ml), PLC{gamma}-1 antisense oligonucleotides (5'AGGGGACGCGGCGCCCGCCAT3'), or scrambled control oligonucleotides (5'ATCCGCGGTGGCCGCCGCCAG3'; 12.5 µM), U73122 (3 µM), U73343 (3 µM), or PD153035 (200 nM). After 48 h of treatment at 37°C in a 5% CO2 incubator, the cells in the insert were removed by wiping gently with a cotton swab. Cells on the reverse side of the insert were fixed and stained with Hema 3 (Fisher Scientifics) according to the manufacturer’s instructions. Invading cells in 4 representative fields were counted using light microscopy at x400 magnification. Mean ± SE was calculated from two independent experiments.

IP Turnover Assay.
The accumulation of IP was measured in cells as described previously (16) . Briefly, cells were incubated with 0.5 µCi/ml myo [1,2-3H (N)]-inositol for 24 h followed by incubation with 10 mM LiCl2 for 10 min and then subjected to U73122 (3 µM) treatment for 25 min and/or recombinant human EGF (10 ng/ml) for 5 min. Cell lysates were run on AG1-X8 100–200 mesh anion-exchange resin-containing columns. IP was eluted using ammonium formate/formic acid (200 mM/100 mM). Levels of IP were obtained from radioactive counts in the ammonium formate/formic acid fraction.

Statistical Analysis.
The signed rank test was applied to test the differences between PLC{gamma}-1 levels in tumor compared with matched adjacent normal mucosa of 33 subjects. To analyze the differences between phosphorylated PLC{gamma}-1 levels in tumor and normal tissue from 20 subjects, the exact sign rank test was used. Cell counts from invasion experiments were analyzed by a one-way ANOVA. Pairwise differences were tested with the Sidak procedure.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
EGFR Stimulation Increases PLC{gamma}-1 Activation in HNSCC Cells.
Expression and activation of PLC{gamma}-1 has not been studied previously in HNSCC cells. Four HNSCC cell lines were screened for expression of PLC{gamma}-1. All four of the cell lines were found to express basal levels of PLC{gamma}-1 (Fig. 1A)Citation . Phosphorylation of PLC{gamma}-1 by EGFR tyrosine kinase results in activation of PLC{gamma}-1. The ability of EGFR ligand, EGF, to induce PLC{gamma}-1 phosphorylation was tested. HNSCC cells were serum starved for 48 h to minimize the effects of growth factors in the serum and signaling from secreted autocrine ligands. Cells were then stimulated with recombinant EGF (10 ng/ml for 5 min). Total cellular protein was harvested and fractionated on a SDS-PAGE gel. Western blotting was performed with anti-phospho-PLC{gamma}-1 followed by anti-PLC{gamma}-1 antibody to demonstrate equal loading. In all four of the cell lines tested, the EGFR ligand increased phosphorylation of PLC{gamma}-1 compared with corresponding unstimulated cells (Fig. 1B)Citation . These findings suggest that EGFR ligand stimulation induces phosphorylation and, hence, activation of PLC{gamma}-1 in HNSCC cells.



View larger version (53K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. EGFR stimulation activates PLC{gamma} in HNSCC cells. A, PLC{gamma}-1 levels in HNSCC cell lines. Four representative HNSCC cell lines were analyzed for PLC{gamma}-1 expression by Western blotting. The same membrane was probed for ß-actin to demonstrate equal loading. B, four representative HNSCC cell lines were analyzed for PLC{gamma}-1 activation. Cell lysates from representative HNSCC cell lines (UPCI:SCC32, OSC-19, PCI-15b, and UM-22a) were treated with recombinant EGF (10 ng/ml for 5 min) followed by immunoblotting with anti-pPLC{gamma}-1 antibody. The same blot was probed with anti-PLC{gamma}-1 and ß-actin antibodies to show equal loading of protein in all lanes. EGFR ligand stimulation results in increased activation of pPLC{gamma}-1(top panel), whereas total levels of PLC{gamma}-1 (bottom panel) remain unchanged.

 
Blockade of EGFR and PLC Abrogates the Activation of PLC{gamma}-1.
PLC{gamma}-1 can be stimulated after activation of several growth factor receptors including EGFR. To determine whether activation of PLC{gamma}-1 was mediated via an EGFR signaling pathway, HNSCC cells were treated with an EGFR-specific tyrosine kinase inhibitor (PD153035) at a dose reported previously to block EGFR phosphorylation in HNSCC cells (17) . A representative HNSCC cell line (OSC-19) was pretreated for 2 h with either EGFR inhibitor PD153035 (200 nM) or anti-EGFR antibody C225 (7 µg/ml), or for 25 min with PLC inhibitor U73122 or the inactive analogue U73343 (3 µM). Pretreatment was followed by EGF stimulation (10 ng/ml for 5 min). Protein extracts were fractionated on a SDS-PAGE gel. Immunoblots were probed with anti-phospho-PLC{gamma}-1 antibody and PLC{gamma}-1 antibody to demonstrate equal loading. Activation of PLC{gamma}-1 was reduced by EGFR or PLC inhibition by more than 90% (Fig. 2, A and B)Citation . These results indicate that EGFR activation stimulates PLC{gamma}-1 phosphorylation in HNSCC cells.



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. EGFR mediates activation of PLC{gamma}-1 in HNSCC cells. A, a representative HNSCC cell line (OSC 19) was pretreated for 2 h with an EGFR-specific inhibitor PD153035 (200 nM) or a PLC inhibitor U73122 (3 µM for 25 min) and/or treated with EGF (10 ng/ml for 5 min). Cell lysates were size fractionated on a SDS-PAGE gel and immunoblotted with anti-phospho-PLC{gamma}-1 antibody. The same blot was probed for PLC{gamma}-1 to show equal loading of protein in all lanes. Densitometric analysis was carried out, and gels were normalized to values of corresponding PLC{gamma}-1 levels. Bars, ±SE from two separate experiments. B, a representative HNSCC cell line (OSC 19) was pretreated for 2 h with anti-EGFR antibody C225 (7 µg/ml) and/or treated with EGF (10 ng/ml for 5 min). Cell lysates were size fractionated on a SDS-PAGE gel and immunoblotted with anti-phospho-PLC{gamma}-1 antibody. The same blot was probed for PLC{gamma}-1 to show equal loading of protein in all lanes. Densitometric analysis was carried out and gels were normalized to values of corresponding PLC{gamma}-1 levels. Bars, ±SE from two separate experiments.

 
Inhibition of PLC{gamma}-1 Signaling Reduces Cell Invasion in Vitro.
To determine whether PLC blockade abrogated HNSCC cell invasion in vitro, six HNSCC cell lines were plated in duplicate in transwell chambers at 2 x 104 cells/well with either EGF or the PLC inhibitor in the upper and lower chambers. After 24 h the cells on the lower side of the chamber were fixed and stained. The number of cells that invaded the Matrigel coated transwell chamber was counted using a light field inverted microscope. An average of four fields of cells counted under 400x magnification was determined. We found that the percentage of cells invading the chamber was reduced in the presence on 3 µM of U73122 in all of the cell lines tested (Fig. 3A)Citation .



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. PLC inhibition decreases invasion of representative HNSCC cell lines in vitro. A, the percent invasion of HNSCC cells (UPCI:SCC32, OSC-19, PCI-15b, and UM-22a) through Matrigel-coated transwell chambers was calculated relative to the control Bars, ±SE of duplicate samples. There was a reduction in the number of invading cells in the presence of the PLC inhibitor U73122 as compared with the untreated control. B, IP turnover in representative HNSCC cell lines (OSC-19, PCI-15b, and UM-22a). PLC activity was measured as the production of IPs by anion-exchange chromatography. The effect of U73122 (3 µM for 25 min) on IP turnover in EGF-treated (10 ng/ml for 5 min) cells was calculated and normalized to the control (EGF-treated). C, effect of PLC or EGFR inhibition on cell invasion in vitro. A representative HNSCC cell line (OSC-19) was plated in transwell invasion chambers in the presence of either an EGFR inhibitor PD153035 (200 nM) or PLC inhibitor U73122 (3 µM). The percentage invasion was determined by normalizing the number of cells that migrated in the control group. The experiment was repeated three times with similar results.

 
Activated PLC{gamma}-1 hydrolyzes phosphatidylinositol biphosphate to inositol triphosphate and diacylglecerol. The amount of the inositol triphosphate produced indicates the activity of PLC enzyme within cells and is a measure of PLC{gamma}-1 activation. IP turnover in HNSCC cell lines treated with a PLC inhibitor was measured to determine whether reduced invasion correlated with lowered PLC activity. Cells were quiesed for 24 h and then treated with U73122 (3 µM for 25 min) and EGF (10 ng/ml for 5 min). We found that PLC inhibition by U73122 resulted in a decrease in IP turn over all of the HNSCC cell lines tested (Fig. 3B)Citation .

To determine whether invasion was mediated by EGFR signaling in vitro, HNSCC cells were plated in Matrigel-coated transwell chambers in the presence of either PLC or EGFR-specific inhibitors (U73122 or PD153035, respectively). After 48 h, the cells that invaded the transwell chamber were fixed, stained, and counted. We found that inhibition of either EGFR or PLC significantly reduced the percentage of cells invading the Matrigel as compared with untreated control wells by >50% (Fig. 3C)Citation .

Because U73122 inhibits all of the cellular PLCs, we designed PLC{gamma}-1 antisense oligonucleotides to test the consequence of specific abrogation of PLC{gamma}-1. The antisense oligonucleotide was directed against the ATG start site. HNSCC cells (OSC-19) were plated in invasion chambers at a high density and treated with EGF (10 ng/ml), EGF + U73122 (3 µM), EGF + antisense oligonucleotides against PLC{gamma}-1 (12.5 µM), or EGF + control scrambled oligonucleotides (12.5 µM). Cells were treated for 48 h, fixed, stained, and counted. Immunoblotting demonstrated that the PLC{gamma}-1 antisense oligonucleotides decreased expression of PLC{gamma}-1 protein by 50% (Fig. 4A)Citation . Both the PLC inhibitor as well as PLC{gamma}-1 antisense oligonucleotides abrogated in vitro invasion of a representative HNSCC cell line (Fig. 4B)Citation . On quantifying the number of invading cells it was found that the number of invading cells in wells with inhibitors was reduced significantly compared with the corresponding controls (P = 0.05 when tested with the Sikak procedure; Fig. 4CCitation ).



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. The effect of PLC{gamma}-1 inhibition on invasion in vitro. A, PLC{gamma}-1 expression is decreased by anti-PLC{gamma}-1 antisense oligonucleotides. Cells were treated with 12.5 µM of either antisense PLC{gamma}-1 or scrambled control in the absence of serum for 72 h. Cell lysates were subjected to Western blotting, and the blots were probed with anti-ß-actin antibody to demonstrate equal loading. Results from densitometric analysis were plotted as fold change of pPLC{gamma}-1 compared with untreated control. Ratios of pPLC{gamma}-1:ß-actin were plotted to account for any variation in loading. B, a representative HNSCC cell line (OSC-19) was plated in transwell invasion chambers in the absence or presence of EGF (10 ng/ml). Duplicate wells were treated in the presence of EGF (10 ng/ml) with either 12.5 µM of PLC{gamma}-1 antisense oligonucleotides, scrambled control oligonucleotides or 3 µM of PLC inhibitor U73122, or medium alone or EGF alone. After 48 h, noninvading cells inside the wells were wiped off the insert with a cotton-tipped applicator. Invading cells were fixed, stained, and either counted or photographed using x400 magnification with an inverted microscope. The experiment was repeated three times with similar results. C, in vitro invasion in presence of PLC and PLC{gamma}-1 inhibition was quantified by counting four fields under x400 magnification, and the results were plotted as percentage invasion relative to EGF treated control. Bars, ±SE of duplicate wells for each treatment from two independent experiments.

 
PLC Inhibition Does Not Abrogate HNSCC Proliferation.
We have reported previously that EGFR inhibition abrogates growth of HNSCC cells (17) . To determine the effect of PLC{gamma}-1 inhibition on cell proliferation, a representative HNSCC cell line (OSC-19) was treated with 12.5 µM of PLC{gamma}-1 antisense oligonucleotides, scrambled control oligonucleotides, or PLC inhibitor U73122. The cell number in each well was determined at several time points by cell counting using vital dye exclusion. There was no significant difference in cell viability after PLC{gamma}-1 blockade (Fig. 5)Citation . The lack of effect of PLC{gamma}-1 inhibition on cell proliferation was corroborated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay as well as flow cytometric analysis (data not shown).



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effect of PLC{gamma}-1 blockade on cell proliferation. HNSCC cells (OSC-19) were treated with either antisense, or scrambled oligonucleotides (12.5 µM) or U73122 (3 µM) over a 4-day period to determine the effect of PLC{gamma}-1/PLC blockade on cellular proliferation. Cells were treated in triplicate with U73122 (3 µM) or with 12.5 µM of either PLC{gamma}-1 antisense oligonucleotides or scrambled control oligonucleotides in serum-free medium. At the 2-day and 4-day time points, cells were trypsinized with 0.5% trypsin-EDTA and counted using a hemocytometer in presence of 0.1% trypan blue dye. All treatments were carried out in triplicate, and the experiment was repeated twice with similar results.

 
Increased Expression and Activation of PLC{gamma}-1 in Tumors Compared with Corresponding Normal Mucosa from HNSCC Patients.
Our in vitro studies suggest that PLC{gamma}-1 plays an important role in invasion of HNSCC cell lines. To explore the biological significance of this finding, we compared protein expression levels of PLC{gamma}-1 in 33 HNSCC tumors and paired normal mucosa harvested several centimeters away from the tumor (see Table 1Citation for patient characteristics). Using immunoblotting of tissue lysates, we found a 1.8-fold increase in PLC{gamma}-1 expression levels in HNSCC tumors compared with levels in paired adjacent normal mucosa (P = 0.0001; Fig. 6Citation ). In 30 of 33 (91%) cases, PLC{gamma}-1 expression levels in the tumor were greater than those in the corresponding normal mucosa. We also examined levels of phosphorylated PLC{gamma}-1 in a subset of the paired tissues where adequate material was available for analysis (20 subjects). In these samples, activated PLC{gamma}-1 levels were 1.65-fold higher in HNSCC tumors compared with levels in paired normal mucosa (P = 0.05). These in vitro and in vivo results indicate that EGFR-mediated PLC{gamma}-1 activation may play an important role in invasion of HNSCC cells.


View this table:
[in this window]
[in a new window]

 
Table 1 Clinicopathologic characteristics of 33 head and neck cancer patients evaluated

 


View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. PLC{gamma}-1 levels are increased in HNSCC tumors compared with paired normal tissues. A, immunoblot showing PLC{gamma}-1 levels (top panel), phospho-PLC{gamma}-1 levels (middle panel), and ß-actin levels (loading control) in tumor (T) and adjacent normal mucosa (N) from 2 representative HNSCC patients. Densitometric analysis was carried out, and gels were normalized to values of corresponding ß-actin levels. Cumulative results showing levels of (B) PLC{gamma}-1 and (C) activated PLC{gamma}-1 in tumors and normal tissue. The levels of PLC{gamma}-1 and phospho-PLC{gamma}-1 in tumor tissues were higher (1.8- and 1.6-fold, respectively) than that in the normal adjacent mucosa (P < 0.0001 and P = 0.05, respectively).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study we present evidence to support the hypothesis that EGFR mediates invasion of HNSCC cells via activation of PLC{gamma}-1 and that PLC{gamma}-1 may be involved in tumor progression. Upon ligand stimulation, EGFR activated PLC{gamma}-1 in a series of HNSCC cell lines and mediated cellular invasion in vitro. Targeting PLC{gamma}-1 reduced invasion of HNSCC cells through Matrigel. Furthermore, abrogation of PLC{gamma}-1 did not modulate proliferation or survival. These findings implicate a specific invasive function of EGFR-mediated signaling via PLC{gamma}-1 activation. To determine the clinical relevance of our in vitro findings, we examined PLC{gamma}-1 and phosphorylated PLC{gamma}-1 levels in HNSCC tumors compared with levels in paired normal adjacent mucosa. This is the first study, to our knowledge, of activated PLC{gamma}-1 in de novo human cancers. Expression levels of both PLC{gamma}-1 and phosphorylated PLC{gamma}-1 were elevated nearly 2-fold in the tumors. These results suggest that PLC{gamma}-1 plays an important role in EGFR-mediated invasion of HNSCC.

EGFR elicits multiple biological effects in cells overexpressing the receptor including proliferation, prevention of apoptosis, invasion, and transformation (18) . Despite the multiplicity of downstream EGFR signaling pathways, several lines of evidence support a redundancy in EGFR signaling. For example, ligand-stimulated EGFR mutants unable to bind SH2 domain proteins use alternate mechanisms including tyrosine-phosphorylated proteins (Shc and Gab1) to activate downstream effectors (19) . Thus, an alternate pathway resulting in phenotypic effects expected on EGFR ligand stimulation can overcome the specific inhibition of a downstream effector. However, other studies have reported specificity associated with signaling pathways activated by EGFR. We have shown previously that activation of EGFR stimulates STAT activation pathways that regulate proliferative and antiapoptotic signals (20) . Down-modulation of STAT3 using antisense oligonucleotides or dominant-negative approaches resulted in abrogation of growth and apoptosis in HNSCC cells (21) . In HNSCC cells, EGFR has been shown to modulate proliferation via MAPK where inhibition of MAPK activation by EGFR did not affect invasion in vitro (8) . To elucidate the role of EGFR-mediated signaling via PLC{gamma}-1 in both mitogenic and motogenic responses, we specifically blocked PLC{gamma}-1 using several approaches in HNSCC cell lines and determined the effects on proliferation. Our results suggest that PLC{gamma}-1 inhibition decreases invasion but not proliferation of HNSCC cells in vitro. Similar findings have been reported in prostate carcinoma cells where inhibition of PLC{gamma}-1 in vitro did not decrease cell growth, whereas in vivo PLC blockade reduced invasion but not tumor volumes (22 , 23) . Thus, activated EGFR may specifically mediate cancer cell invasion by activation of PLC{gamma}-1.

This is the first report to demonstrate a correlation between EGFR-mediated PLC{gamma}-1 signaling in HNSCC and its effects on cellular behavior. Little is known about the biology of invasion in HNSCC cells. Given the high rate of invasion and its associated morbidity and mortality, elucidation of the molecular mechanisms that govern tumor cell invasion is critical for the design of improved therapeutic strategies. To invade, cells secrete proteases that remodel the extracellular matrix and/or activate the tumor cells enabling the cells to migrate although the basement membrane. The MMP family of proteolytic enzymes has been implicated in tumor cell invasion. Several studies have reported up-regulation of MMP-2 and -9 in HNSCC tissues (24, 25, 26) . Increased expression levels of MMP-9 were found to correlate with overexpression of EGFR in HNSCC tumors (27) . Incubation of HNSCC cells with EGFR ligands increased MMP-9 gene expression and in vitro invasion in HNSCC cells (28) . The mechanisms that govern EGFR regulation of MMPs are incompletely understood. Another protease linked to increased cell motility, the urokinase-type plasminogen activator, has also been shown to play a role in EGFR-mediated invasion of HNSCC cells (29) . However, these proteases appear to function downstream of EGFR activation and are not directly modulated by cytoplasmic EGFR signaling pathways. We found decreased invasion of HNSCC cells after treatment with an EGFR-specific tyrosine kinase inhibitor. Abrogation of HNSCC invasion after EGFR or a PLC{gamma}-1 inhibition suggests that PLC{gamma}-1 is activated immediately downstream of EGFR leading to HNSCC cellular invasion.

To examine the clinical relevance of our in vitro data, we measured the levels of PLC{gamma}-1 and phosphorylated PLC{gamma}-1 in HNSCC tumors and paired normal mucosa specimens. Our results suggest that HNSCC tumors express significantly higher levels of PLC{gamma}-1 in tumors compared with adjacent normal epithelial mucosa. Mammary carcinoma cells were reported to express increased levels of EGFR and erbB-2, as well as PLC{gamma}-1 when compared with levels in nonmalignant breast tissue (30) . Others have reported in vivo overexpression of PLC{gamma}-1 protein in meningiomas (31) and colorectal carcinomas (32, 33, 34) . However for the first time, we examined activation status by probing for phosphorylated PLC{gamma}-1 and found it to be increased in the tumor tissues. Up-regulation of PLC{gamma}-1 downstream of EGFR may contribute to the invasive phenotype of HNSCC tumors. Therapies that specifically target PLC{gamma}-1 may reduce local and regional tumor invasion and, hence, improve survival.


    ACKNOWLEDGMENTS
 
We thank Lori Miller for technical assistance with cell culture work and Dr. Susanne M. Gollin for providing several HNSCC cell lines.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grant 5RO1CA77308 (to J. R. G.), a Veterans Administration Merit Award (to A. W.) and a Lung Specialized Programs of Research Excellence postdoctoral fellowship (to S. M. T.). Back

2 To whom requests for reprints should be addressed, at Department of Otolaryngology, The Eye and Ear Institute Building, Suite 500, 200 Lothrop Street, Pittsburgh, PA 15213. Phone: (412) 647-5280; Fax: (412) 647-2080; E-mail: jgrandis{at}pitt.edu Back

3 The abbreviations used are: HNSCC, head and neck squamous cell carcinoma; EGFR, epidermal growth factor receptor; MAPK, mitogen-activated protein kinase; STAT, signal transducers and activators of transcription; PLC{gamma}, phospholipase C{gamma}; FBS, fetal bovine serum; SCC, squamous cell carcinoma; EGF, epidermal growth factor; IP, inositol phosphate; MMP, matrix metalloproteinase. Back

Received 2/12/03. Revised 5/20/03. Accepted 6/11/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kowalski L. P., Bagietto R., Lara J. R., Santos R. L., Silva J. F., Jr., Magrin J. Prognostic significance of the distribution of neck node metastasis from oral carcinoma. Head Neck, 22: 207-214, 2000.[Medline]
  2. Grandis J. R., Tweardy D. J. Elevated levels of transforming growth factor {alpha} and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer. Cancer Res., 53: 3579-3584, 1993.[Abstract/Free Full Text]
  3. Ishitoya J., Toriyama M., Oguchi N., Kitamura K., Ohshima M., Asano K., Yamamoto T. Gene amplification and overexpression of EGF receptor in squamous cell carcinomas of the head and neck. Br. J. Cancer, 59: 559-562, 1989.[Medline]
  4. Grandis J. R., Melhem M. F., Gooding W. E., Day R., Holst V. A., Wagener M. M., Drenning S. D., Tweardy D. J. Levels of TGF-{alpha} and EGFR protein in head and neck squamous cell carcinoma and patient survival. J. Natl. Cancer Inst., 90: 824-832, 1998.[Abstract/Free Full Text]
  5. Wells A. Tumor invasion: role of growth factor-induced cell motility. Adv. Cancer Res., 78: 31-101, 2000.[Medline]
  6. Thomas S. M., Grandis J. R. Importance of epidermal growth factor receptor in head and neck cancer. Updates, 1: 1-11, 2001.
  7. Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell, 103: 211-225, 2000.[Medline]
  8. Tsang D. K., Crowe D. L. The mitogen activated protein kinase pathway is required for proliferation but not invasion of human squamous cell carcinoma lines. Int. J. Oncol., 15: 519-523, 1999.[Medline]
  9. Gupta A. K., McKenna W. G., Weber C. N., Feldman M. D., Goldsmith J. D., Mick R., Machtay M., Rosenthal D. I., Bakanauskas V. J., Cerniglia G. J., Bernhard E. J., Weber R. S., Muschel R. J. Local recurrence in head and neck cancer: relationship to radiation resistance and signal transduction. Clin. Cancer Res., 8: 885-892, 2002.[Abstract/Free Full Text]
  10. Grandis J. R., Drenning S. D., Chakraborty A., Zhou M. Y., Zeng Q., Pitt A. S., Tweardy D. J. Requirement of Stat3 but not Stat1 activation for epidermal growth factor receptor- mediated cell growth in vitro. J. Clin. Investig., 102: 1385-1392, 1998.[Medline]
  11. Grandis J. R., Drenning S. D., Zeng Q., Watkins S. C., Melhem M. F., Endo S., Johnson D. E., Huang L., He Y., Kim J. D. Constitutive activation of Stat3 signaling abrogates apoptosis in squamous cell carcinogenesis in vivo.. Proc. Natl. Acad. Sci. USA, 97: 4227-4232, 2000.[Abstract/Free Full Text]
  12. Yokoi T., Yamaguchi T., Odajima J., Furukawa K. Establishment and characterization of a human cell line derived from a squamous cell carcinoma of the tongue. Tumor Res., 23: 43-57, 1988.
  13. Heo D. S., Snyderman C., Gollin S. M., Pan S., Walker E., Deka R., Barnes E. L., Johnson J. T., Herberman R. B., Whiteside T. L. Biology, cytogenetics, and sensitivity to immunological effector cells of new head and neck squamous cell carcinoma lines. Cancer Res., 49: 5167-5175, 1989.[Abstract/Free Full Text]
  14. Zou C. P., Youssef E. M., Zou C. C., Carey T. E., Lotan R. Differential effects of chromosome 3p deletion on the expression of the putative tumor suppressor RAR ß and on retinoid resistance in human squamous carcinoma cells. Oncogene, 20: 6820-6827, 2001.[Medline]
  15. Chen P., Xie H., Sekar M. C., Gupta K., Wells A. Epidermal growth factor receptor-mediated cell motility: phospholipase C activity is required, but mitogen-activated protein kinase activity is not sufficient for induced cell movement. J. Cell Biol., 127: 847-857, 1994.[Abstract/Free Full Text]
  16. Kassis J., Moellinger J., Lo H., Greenberg N. M., Kim H. G., Wells A. A role for phospholipase C-{gamma}-mediated signaling in tumor cell invasion. Clin. Cancer Res., 5: 2251-2260, 1999.[Abstract/Free Full Text]
  17. Rubin Grandis J., Chakraborty A., Melhem M. F., Zeng Q., Tweardy D. J. Inhibition of epidermal growth factor receptor gene expression and function decreases proliferation of head and neck squamous carcinoma but not normal mucosal epithelial cells. Oncogene, 15: 409-416, 1997.[Medline]
  18. Wells A. EGF receptor. Int. J. Biochem. Cell Biol., 31: 637-643, 1999.[Medline]
  19. Li N., Schlessinger J., Margolis B. Autophosphorylation mutants of the EGF-receptor signal through auxiliary mechanisms involving SH2 domain proteins. Oncogene, 9: 3457-3465, 1994.[Medline]
  20. Song J. I., Grandis J. R. STAT signaling in head and neck cancer. Oncogene, 19: 2489-2495, 2000.[Medline]
  21. Grandis J. R., Zeng Q., Drenning S. D. Epidermal growth factor receptor–mediated stat3 signaling blocks apoptosis in head and neck cancer. Laryngoscope, 110: 868-874, 2000.[Medline]
  22. Turner T., Chen P., Goodly L. J., Wells A. EGF receptor signaling enhances in vivo invasiveness of DU-145 human prostate carcinoma cells. Clin. Exp. Metastasis, 14: 409-418, 1996.[Medline]
  23. Turner T., Epps-Fung M. V., Kassis J., Wells A. Molecular inhibition of phospholipase c{gamma} signaling abrogates DU-145 prostate tumor cell invasion. Clin. Cancer Res., 3: 2275-2282, 1997.[Abstract/Free Full Text]
  24. Yoshizaki T., Sato H., Maruyama Y., Murono S., Furukawa M., Park C. S., Seiki M. Increased expression of membrane type 1-matrix metalloproteinase in head and neck carcinoma. Cancer (Phila.), 79: 139-144, 1997.
  25. Imanishi Y., Fujii M., Tokumaru Y., Tomita T., Kanke M., Kanzaki J., Kameyama K., Otani Y., Sato H. Clinical significance of expression of membrane type 1 matrix metalloproteinase and matrix metalloproteinase-2 in human head and neck squamous cell carcinoma. Hum. Pathol., 31: 895-904, 2000.[Medline]
  26. Riedel F., Gotte K., Schwalb J., Hormann K. Serum levels of matrix metalloproteinase-2 and -9 in patients with head and neck squamous cell carcinoma. Anticancer Res., 20: 3045-3049, 2000.[Medline]
  27. P O. C., Rhys-Evans P., Modjtahedi H., Court W., Box G., Eccles S. Overexpression of epidermal growth factor receptor in human head and neck squamous carcinoma cell lines correlates with matrix metalloproteinase-9 expression and in vitro invasion. Int. J. Cancer, 86: 307-317, 2000.[Medline]
  28. P O. c., Modjtahedi H., Rhys-Evans P., Court W. J., Box G. M., Eccles S. A. Epidermal growth factor-like ligands differentially up-regulate matrix metalloproteinase 9 in head and neck squamous carcinoma cells. Cancer Res., 60: 1121-1128, 2000.[Abstract/Free Full Text]
  29. Shiratsuchi T., Ishibashi H., Shirasuna K. Inhibition of epidermal growth factor-induced invasion by dexamethasone and AP-1 decoy in human squamous cell carcinoma cell lines. J. Cell Physiol., 193: 340-348, 2002.[Medline]
  30. Arteaga C. L., Johnson M. D., Todderud G., Coffey R. J., Carpenter G., Page D. L. Elevated content of the tyrosine kinase substrate phospholipase C-1 in primary human breast carcinomas. Proc. Am. Assoc. Cancer Res., 88: 10435-10439, 1991.
  31. Johnson M. D., Horiba M., Winnier A. R., Arteaga C. L. The epidermal growth factor receptor is associated with phospholipase C-{gamma} 1 in meningiomas. Hum. Pathol., 25: 146-153, 1994.[Medline]
  32. Lee S. J., Lee S. D., Park J. G., Kim C. M., Ryu S. H., Suh P. G. Overexpression of phospholipase C-{gamma} 1 in colorectal carcinomas is associated with overexpression of factors that bind its promoter. J. Biol. Chem., 270: 16378-16384, 1995.[Abstract/Free Full Text]
  33. Nomoto K., Tomita N., Miyake M., Xhu D. B., LoGerfo P. R., Weinstein I. B. Expression of phospholipases {gamma} 1, ß 1, and {delta} 1 in primary human colon carcinomas and colon carcinoma cell lines. Mol. Carcinog., 12: 146-152, 1995.[Medline]
  34. Noh D. Y., Lee Y. H., Kim S. S., Kim Y. I., Ryu S. H., Suh P. G., Park J. G. Elevated content of phospholipase C-{gamma} 1 in colorectal cancer tissues. Cancer (Phila.), 73: 36-41, 1994.



This article has been cited by other articles:


Home page
Anticancer ResHome page
W. K. K. WU, T. T. M. TSE, J. J. Y. SUNG, Z. J. LI, L. YU, and C. H. CHO
Expression of ErbB Receptors and their Cognate Ligands in Gastric and Colon Cancer Cell Lines
Anticancer Res, January 1, 2009; 29(1): 229 - 234.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Sala, F. Dituri, C. Raimondi, S. Previdi, T. Maffucci, M. Mazzoletti, C. Rossi, M. Iezzi, R. Lattanzio, M. Piantelli, et al.
Phospholipase C{gamma}1 Is Required for Metastasis Development and Progression
Cancer Res., December 15, 2008; 68(24): 10187 - 10196.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
X. Liu, W. K. K. Wu, L. Yu, Z. J. Li, J. J. Y. Sung, S. T. Zhang, and C. H. Cho
Epidermal Growth Factor-Induced Esophageal Cancer Cell Proliferation Requires Transactivation of {beta}-Adrenoceptors
J. Pharmacol. Exp. Ther., July 1, 2008; 326(1): 69 - 75.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Nozawa, G. Howell, S. Suzuki, Q. Zhang, Y. Qi, J. Klein-Seetharaman, A. Wells, J. R. Grandis, and S. M. Thomas
Combined Inhibition of PLC{gamma}-1 and c-Src Abrogates Epidermal Growth Factor Receptor-Mediated Head and Neck Squamous Cell Carcinoma Invasion
Clin. Cancer Res., July 1, 2008; 14(13): 4336 - 4344.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H.-W. Lo, S.-C. Hsu, W. Xia, X. Cao, J.-Y. Shih, Y. Wei, J. L. Abbruzzese, G. N. Hortobagyi, and M.-C. Hung
Epidermal Growth Factor Receptor Cooperates with Signal Transducer and Activator of Transcription 3 to Induce Epithelial-Mesenchymal Transition in Cancer Cells via Up-regulation of TWIST Gene Expression
Cancer Res., October 1, 2007; 67(19): 9066 - 9076.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. P. Jones and M. Katan
Role of Phospholipase C{gamma}1 in Cell Spreading Requires Association with a {beta}-Pix/GIT1-Containing Complex, Leading to Activation of Cdc42 and Rac1
Mol. Cell. Biol., August 15, 2007; 27(16): 5790 - 5805.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
M. V. Karamouzis, J. R. Grandis, and A. Argiris
Therapies Directed Against Epidermal Growth Factor Receptor in Aerodigestive Carcinomas
JAMA, July 4, 2007; 298(1): 70 - 82.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
S. J. Wang, K. Peyrollier, and L. Y. Bourguignon
The Influence of Hyaluronan-CD44 Interaction on Topoisomerase II Activity and Etoposide Cytotoxicity in Head and Neck Cancer
Arch Otolaryngol Head Neck Surg, March 1, 2007; 133(3): 281 - 288.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. M. Thomas, N. E. Bhola, Q. Zhang, S. C. Contrucci, A. L. Wentzel, M. L. Freilino, W. E. Gooding, J. M. Siegfried, D. C. Chan, and J. R. Grandis
Cross-talk between G Protein-Coupled Receptor and Epidermal Growth Factor Receptor Signaling Pathways Contributes to Growth and Invasion of Head and Neck Squamous Cell Carcinoma
Cancer Res., December 15, 2006; 66(24): 11831 - 11839.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
S. J. Wang and L. Y. W. Bourguignon
Hyaluronan and the Interaction Between CD44 and Epidermal Growth Factor Receptor in Oncogenic Signaling and Chemotherapy Resistance in Head and Neck Cancer.
Arch Otolaryngol Head Neck Surg, July 1, 2006; 132(7): 771 - 778.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Kalyankrishna and J. R. Grandis
Epidermal Growth Factor Receptor Biology in Head and Neck Cancer
J. Clin. Oncol., June 10, 2006; 24(17): 2666 - 2672.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Y. Wang, J. Wu, and Z. Wang
Akt Binds to and Phosphorylates Phospholipase C-{gamma}1 in Response to Epidermal Growth Factor
Mol. Biol. Cell, May 1, 2006; 17(5): 2267 - 2277.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
S. J. Wang and L. Y. W. Bourguignon
Hyaluronan-CD44 Promotes Phospholipase C-Mediated Ca2+ Signaling and Cisplatin Resistance in Head and Neck Cancer
Arch Otolaryngol Head Neck Surg, January 1, 2006; 132(1): 19 - 24.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. P. Jones, J. Peak, S. Brader, S. A. Eccles, and M. Katan
PLC{gamma}1 is essential for early events in integrin signalling required for cell motility
J. Cell Sci., June 15, 2005; 118(12): 2695 - 2706.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. D. Allen, L. S. Young, and C. W. Dawson
The Epstein-Barr Virus-Encoded LMP2A and LMP2B Proteins Promote Epithelial Cell Spreading and Motility
J. Virol., February 1, 2005; 79(3): 1789 - 1802.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, S. M.
Right arrow Articles by Grandis, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, S. M.
Right arrow Articles by Grandis, J. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online