| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Dipartimento di Medicina Interna e di Medicina Specialistica Endocrinologia, Università di Catania, 95123 Catania [F. F., V. V., A. A., A. M., R. V.]; Centro di Biomorfologia, Università di Messina, 98122 Messina [E. M.]; and Dottorato di Ricerca in Oncologia, Università di Catanzaro "Magna Graecia," 88100 Catanzaro, and Dipartimento di Scienze Biomediche, Università di Catania, 95124 Catania, [P. V.], Italy
| ABSTRACT |
|---|
|
|
|---|
We find that normal thyrocites do not express p73, whereas most thyroid malignancies are positive for p73 expression. However, the p73 protein of thyroid cancer cells is unresponsive to DNA-damaging agents, failing to elicit a block of the cell cycle or an apoptotic response. Notably, overexpression of transcriptionally active p73 in thyroid cancer lines can arrest the cell cycle but is still unable to induce cell death. The loss of p73 biological activity in neoplastic thyroid cells is partly explained by its interaction with transcriptionally inactive variants of p73 (
Np73) and with mutant p53. Our findings suggest that the functional impairment of p73 could be involved in the development of thyroid malignancies, defining p73 as a potential therapeutic target for thyroid cancer.
| INTRODUCTION |
|---|
|
|
|---|
From a molecular standpoint, well-differentiated thyroid cancers are often initiated by genetic events that involve the improper activation of cellular proto-oncogenes (6)
. In up to 40% of papillary thyroid carcinomas, rearrangements of the RET or NTRK1 tyrosine kinases with a plethora of activating genes represent the first event in tumor development (7
, 8)
. In
35% of follicular thyroid carcinomas, neoplastic transformation is triggered by activating mutations of the RAS gene or by the fusion of the PAX8 transcription factor with the gene encoding for peroxisome proliferator-activated receptor
(1
, 9)
. Unfortunately, whereas some of the genetic events responsible for the development of well-differentiated thyroid cancers have been identified, the molecular mechanisms that generate the lethal anaplastic thyroid cancer are still unclear (10)
. To date, the only established genetic alteration involved in the dedifferentiation process leading to anaplastic thyroid tumor development is the loss of the p53 tumor suppressor gene (11)
.
p73 belongs to a family of proteins defined by the p53 tumor suppressor gene (12 , 13) . p53 and p73 share significant homologies in their structural organization characterized by an NH2-terminal transactivation domain, a central DNA-binding domain, and a COOH-terminal oligomerization domain (14) . In addition, both p53 and p73 can block the cell cycle or induce cell death in response to DNA damage, or after the activation of selected oncogenes (15 , 16) .
Despite these characteristics, p53 and p73 can play distinct and sometimes opposing biological roles in cancer development (17)
. Unlike p53, p73 can be expressed as a wide variety of significantly different transcripts. Abnormal splicing mechanisms generate p73 mRNAs defective of the second exon (
2p73), or both the second and third exons (
23p73; Refs. 18, 19, 20
). Moreover, the presence of two functional promoters can alternatively produce TAp734
(Ref. 4
; transcribed from the first exon) or
Np73 (transcribed from a previously silent 3' exon) isoforms (21)
. Both the aberrant splicing of the first exons and the activation of an alternative promoter generate p73 transcripts that lack a functional transactivation domain (22)
. Because these
TAp73 isoforms are still able to oligomerize with transcriptionally competent p73 variants, they behave as dominant-negative proteins that interfere with the activity of TAp73 and can cause malignant transformation (16
, 23)
. This composite picture is additionally complicated by the discovery that each NH2-terminal p73 variant can present multiple COOH terminus ends originated by the alternative splicing of the last five exons of p73 (24, 25, 26)
. In the end, the net biological function of p73 results from the multiple interactions of transcriptionally active (TAp73) and transcriptionally silent (
2p73,
23p73, and
Np73) isoforms of the protein (14
, 16)
.
Another intricate issue concerns the direct interplay between p53 and p73. Multiple reports have shown that
Np73 can interfere with wild-type p53 activity by competing for the p53 binding sites on several promoters (20
, 27, 28, 29)
. At the same time, it has been demonstrated that certain p53 mutants can bind TAp73, thereby inactivating its transcriptional activity (30
, 31)
.
Here we report that TAp73 and
Np73 are expressed in well-differentiated and undifferentiated thyroid carcinomas but are not present in normal thyroid tissues, suggesting that p73 might be involved in thyroid carcinogenesis. Indeed, in thyroid carcinomas, TAp73 is not up-regulated by DNA-damaging agents and fails to induce either cell-cycle arrest or apoptosis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Human Thyroid Tissue Samples.
Human thyroid cancer specimens were obtained at surgery and stored in liquid nitrogen until processing.
Immunohistochemistry.
Immunohistochemical staining was performed on 7-µm thick sections of unfixed tissue specimens. Sections were cut with a cryostat at -30°C, fixed with acetone at -20°C for 10 min, and hydrated with PBS, at room temperature for 45 min. After blocking in 2% normal serum for 20 min, sections were incubated overnight with the anti-p73 polyclonal antibody Ab-6 (1:100; NeoMarkers, Labvision Corp., Fremont, CA). Specific labeling was detected with biotin-conjugated antimouse/antirabbit IgG and avidin-biotin peroxidase complex. Sections were counterstained with hematoxylin QS, examined, and photographed using an Olympus BH-2 microscope.
Immunofluorescence.
Cells were fixed in 3.7% formaldehyde, permeabilized with PBS/0.3% Triton X-100, blocked with PBS/10% normal goat serum, and incubated with primary antibodies for 1 h. To detect endogenous TAp73 we used monoclonal antibody 429 (Imgenex, San Diego, CA), whereas HA-tagged p73 was revealed by an anti-HA monoclonal antibody (CRP, Berkley, CA). The cells were then incubated with Alexa-conjugated (Alexa Fluor 594 or 488) secondary antibodies (Molecular Probes, Leiden, the Netherlands) for 1 h. To visualize the cytoplasm, the cells were also incubated with Alexa-conjugated phalloidin (Molecular Probes) for an additional 30 min. The cells were finally counterstained with Hoechst (Sigma) to color the nuclei. Epifluorescence microscopy was performed with an Olympus microscope. The images were digitally acquired with an Orca CCD Camera (Hamamatsu, Hamamatsu City, Japan) and processed with the Image-Pro Plus 4.0 software (Media Cybernetics, Silver Spring, MD).
Immunoprecipitation and Immunoblot Analysis.
Cell lysates were prepared in radioimmunoprecipitation assay buffer containing 0.1% SDS and protease inhibitor mixture (Roche Biochemical Inc, Basel, Switzerland). For immunoprecipitation (IP) experiments, 1 mg of cell lysate was incubated for 2 h with 2 µg of antibody. After an incubation with protein A-Sepharose (Amersham Biosciences, Uppsala, Sweden), samples were resuspended in loading buffer, separated by SDS-PAGE, and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with 5% milk-Tris Buffered Saline with 0.5% Tween and then immunoblotted with primary antibodies (1 mg/ml). Appropriate horseradish peroxidase-conjugated secondary antibodies were added at 1:2000 (Amersham Biosciences), and proteins were visualized by enhanced chemiluminescence (Pierce, Rockford, IL).
The following antibodies were used for immunoprecipitation: mixture of monoclonal antibodies against different epitopes of p73 Ab-4 (NeoMarkers), polyclonal anti-HA antibody (CRP), polyclonal anti-
Np73 antibody (Oncogene Research, La Jolla, CA), monoclonal antibody DO-1 against the NH2 terminus of p53 (Santa Cruz Biotechnology, Santa Cruz, CA), and monoclonal anti-GFP antibody (CRP).
The following antibodies were used for Western blotting: monoclonal antibodies 429 and 1288 (Imgenex), respectively, recognizing the transactivation domain and the DNA-binding domain of p73; polyclonal Ab-5 antibody (NeoMarkers) recognizing the DNA binding domain of p73; monoclonal DO-1 antibody (Santa Cruz Biotechnology); polyclonal anti p21 antibody (Santa Cruz Biotechnology); monoclonal anti-Bax antibody (Trevigen Inc., Gaithersburg, MD); monoclonal anti-
actin antibody (Sigma); and monoclonal anti-HA and anti-GFP antibodies (CRP). The proteasome inhibitor MG132 was purchased from Sigma.
Transcript Analysis by RT-PCR.
Total RNA (1 µg) was reverse transcribed with Superscript II (Invitrogen, Paisley, United Kingdom) and oligodeoxythymidylic acid primers. Two µl of the synthesized cDNA were then combined in a PCR reaction specific for TAp73, using primers 5' CGGGACGGACGCCGATG 3' (forward) and 5' CTTGGCGATCTGGCAGTAG 3' (reverse) spanning exons 1 and 5 of the p73 gene (fragment size, 542 bp). The
Np73 transcript was detected using primers 5'GCTGTACGTCGGTGACCC3' (forward) and 5' CTTGGCGATCTGGCAGTAG 3' (reverse; fragment size, 322 bp). Transcription of the housekeeping ELE1 gene was carried out using primers 5' ATTGAAGAAATTGCAGGCTC 3' (forward) and 5' TGGAGAAGAGGAGCTGTATCT 3' (reverse). All of the TAp73 transcripts expressed by thyroid cancer lines included in this report were screened for possible mutations by automatic sequencing of RT-PCR amplicons generated using primers 5' CGGGACGGACGCCGATG 3' (forward) and 5' CAGATGGTCATGCGGTACTG 3' (reverse). To assess the p53 status of all thyroid cancer cells studied, the p53 coding sequence was amplified by RT-PCR using primers 5' CCTTCCGGGTCACTGC 3' (forward) and 5' TGGGCCTTGAAGTTAGAGAAA 3' (reverse). PCR products were then subjected to automatic sequencing (BMR-CRIBI Sequencing Service, University of Padua, Padua, Italy).
Plasmids and Transfections.
pCDNA3.0-HA-TAp73
, pCDNA3.0-HA-
Np73
, pCDNA3.1-p53, and pBOS-H2B-GFP were provided by Jean Wang (University of California, San Diego, CA). pCDNA3.1-p53-GFP was a gift of Geoffrey Wahl and Jane Stommel (The Salk Institute, LA Jolla, CA); p21Luc and BaxLuc were donated by Giovanni Blandino (Regina Elena Cancer Institute, Rome, Italy). pCDNA3.0-HA-GFP-TAp73
was prepared in our laboratory. The GFP cDNA was obtained by RT-PCR using pEGFP (Clontech, Palo Alto, CA) as a template. The primers used were 5' GCTAGCATGGTGAGCAAGGGCGAG 3' (forward) and 5' GATGCTAGCCTTGTACAGCTCGTCCAT 3' (reverse). The GFP cDNA was inserted into pCDNA3.0-HA-TAp73
at the NheI site, located between the HA tag and the TAp73
sequence. All of the transfections were performed in six-well plates with Fugene 6 (Roche Biochemical Inc.) according to the manufacturers instructions (DNA:fugene ratio 1:3), and cells were processed 24 h after transfection. To obtain stable transfected clones, cells were plated onto 100-mm Petri dishes and grown in complete medium containing 1 mg/ml of Geneticin (Invitrogen). After 2 weeks, clones were isolated, grown in 35-mm Petri dishes, and screened by Western blot for HA-GFP-TAp73
expression.
Luciferase Assay.
The p21Luc or BaxLuc constructs were cotransfected with pCDNA3.1, pCDNA3.0-HAp73, or pCDNA3.1-p53 (DNA ratio 1:1). A vector coding for the Renilla luciferase (provided by Enrico Conte, University of Catania, Catania, Italy) was also cotransfected in all of the conditions (DNA ratio 1:20). Twenty-four h after transfection, the cells were processed with the Dual Luciferase Assay (Promega Corp., Madison, WI) according to the manufacturers instructions. Luciferase activity was normalized for transfection efficiency (Renilla activity).
Cell Cycle and Apoptosis Evaluation.
Cells were synchronized for 36 h in serum-free medium without leucine and released in complete medium for 12 (cell cycle) or 72 h (apoptosis) in the presence or the absence of 2 µM doxorubicin. Adherent and floating cells were harvested and resuspended in 70% ethanol and stored at -20°C. Permeabilized cells were centrifuged and resuspended in PBS containing 20 mg/ml PI plus 40 mg/ml RNase (Sigma) for 30 min in the dark. Cells were then subjected to FACS analysis (FACScalibur, BD Bioscience, Bedford, MA) and gated for PI (X axis = FLH2; Y axis = events). Sub-G1 cells were scored as apoptotic. Cells transfected with GFP-tagged constructs were fixed with 1% paraformaldehyde in PBS for 2 h at 4°C and permeabilized with 0.3% Triton in PBS for 20 min at room temperature. Permeabilized cells were then incubated with PI and RNase O/N at 4°C in the dark. Cells were gated for PI and GFP.
| RESULTS |
|---|
|
|
|---|
2, or
23 p73), we designed primers located on exon 1 and exon 5 of the p73 sequence. We did not find TAp73 transcripts in normal thyroid or in follicular thyroid cancer lines (Fig. 1A
2p73 or
23p73 (data not shown). Because differential splicing of the p73 COOH terminus originates multiple TAp73 isoforms, we performed an additional RT-PCR, amplifying exons 1014 of the p73 gene. We found a high expression of p73
and lower but detectable levels of p73ß (data not shown).
|
Np73. Using primers located on the last nucleotides of the third intron (transcribed only in
Np73) and on the fourth exon of the p73 sequence we observed the
Np73 mRNA in all of the cell lines positive for TAp73 (Fig. 1A
We next sought to establish whether our RT-PCR results reflected p73 protein expression. We performed a Western blot on the thyroid cancer cells that expressed p73 mRNA, using an antibody (clone 429) that recognizes an epitope in the NH2-terminal transactivation domain of p73. We confirmed protein expression in all of the cell lines positive for the TAp73 transcript (Fig. 1B
, top panel) with the exception of 8505C cells (data not shown).
To ascertain
Np73 protein expression, thyroid cancer cells expressing
Np73 mRNA were lysed, immunoprecipitated, and blotted with antibodies that can distinguish all of the p73 variants by their molecular weight. We found barely detectable levels of
Np73 in BC-PAP and Hth-74 cells, whereas ONCO-DG-1, ARO, KAT-4, and SW-1736 expressed higher levels of
Np73 (Fig. 1B
, bottom panel; data not shown).
We also evaluated the subcellular localization of TAp73 in thyroid cancer cells. An immunofluorescence experiment on three p73-positive cell lines (NPA, Hth-74, and SW-1736) using a TAp73-specific antibody (clone 429) revealed an intense nuclear signal (Fig. 1C)
. As expected, we did not observe p73 staining in the p73-negative TPC-1 cells (Fig. 1C)
.
Our initial findings indicated that TAp73 and
Np73 are not expressed in normal thyroid cells but are present in a wide variety of thyroid cancer cell lines, thereby raising the possibility that these proteins might be involved in thyroid tumorigenesis.
p73 Expression and Localization in Human Thyroid Cancer Specimens.
To validate the results obtained in thyroid cancer cell lines, we analyzed the p73 status of tissue specimens derived from malignant tumors of the thyroid epithelium. Initially, we isolated mRNA from three thyroid cancers and a normal thyroid, and performed two RT-PCR reactions using primers specific for TAp73 or
Np73. TAp73 and
Np73 expression was elevated in all of the thyroid neoplasias but was undetectable in the normal thyroid tissue (Fig. 2A)
.
|
Np73 (Fig. 2B)
To additionally confirm that the malignant thyroid cells were the source of p73 expression and to verify the subcellular distribution of TAp73 and
Np73, we analyzed a more consistent number of specimens by immunohistochemistry. We selected 20 thyroid specimens including 3 normal thyroids, 5 papillary, 4 follicular, and 8 anaplastic thyroid cancers (Table 1)
. TAp73 and
Np73 were never expressed in the normal thyroid (Fig. 2
C; Table 1
). On the contrary, we observed both TAp73 and
Np73 in all of the thyroid tumors tested (Fig. 2
C; Table 1
). This result was partially in contrast with our findings on follicular thyroid cancer cell lines in which we did not detect any p73 transcript. This discrepancy could be because of adaptation mechanisms proper of cell lines grown in vitro.
|
Np73 expression is predominantly nuclear, although in sporadic cases we could detect some citoplasmic staining. Overall, our results in human thyroid tissue specimens confirmed that p73 is not expressed in normal thyroid epithelia but is present in thyroid cancer.
Lack of Functional Activity of TAp73 in Thyroid Cancer.
p73 is a member of the p53 family of proteins and, like p53, can regulate cell proliferation and survival after DNA damage (32)
. Specifically, in response to DNA-damaging agents, TAp73 can induce several downstream targets including p21Cip1 and Bax. In turn, the increased expression of these proteins blocks the cell cycle in the G1 phase or induces cell death. The observation that a protein with potential tumor-suppressor activity is highly expressed in thyroid tumors was difficult to understand and warranted additional investigation.
We have analyzed the p53 sequence of all of the thyroid cancer cells included in our study and report that each line presents mutations that functionally inactivate p53 (Table 2)
. Hence, in these cell lines, the induction of p21Cip1 or Bax in response to DNA damage is likely attributable to TAp73. We wanted to determine whether the tumor-suppressor activity of TAp73 was preserved in these thyroid cancer cells. Therefore, we selected seven representative lines and grew them for 12 h in normal medium or in medium additioned with 2 µM doxorubicin. Unexpectedly, doxorubicin treatment failed to cause any G1 arrest in thyroid cancer cells (Fig. 3A)
. This result was additionally confirmed by a Western blot that failed to detect an increase in p21Cip1 expression in any of the thyroid cells exposed to doxorubicin (Fig. 3C
, top panel). On the contrary, doxorubicin treatment increased p21Cip1 expression in HepG2 hepatocarcinoma cells that we chose as a control (Fig. 3C
, top panel).
|
|
10%), indicating that p73 is ineffective in eliciting apoptosis in thyroid cancer cells (Fig. 3B)
In various epithelial cancer models, exposure to DNA-damaging agents leads to an induction of both TAp73 and p53. Indeed, doxorubicin treatment of HepG2 cells caused a strong induction of p53, whereas no TAp73 was detectable because these cells do not express p73 (Fig. 3C)
. We next performed an immunoblot with antibodies against TAp73 and p53 on lysates derived from thyroid cancer lines grown in the absence or the presence of doxorubicin. We did not observe significant modifications in TAp73 expression. Similarly, treatment with doxorubicin caused a mild increase of p53 levels in 8505C and BC-PAP cells but failed to increase p53 expression in the remaining thyroid cancer lines (Fig. 3C
, fourth panel from top). It is likely that the failure of doxorubicin treatment to increase p53 levels in some of the thyroid cancer cells studied could be because of the high basal level of mutant p53 expressed by these cancer lines.
Our observations suggest that thyroid cancer cells do not induce TAp73 in response to doxorubicin treatment. This result could explain the inability of TAp73 to activate its target genes in thyroid neoplastic cells.
TAp73 Functional Activity Can Be Partially Restored by Overexpression.
We wanted to determine whether overexpression of TAp73 could restore its ability to induce cell-cycle arrest or apoptosis. To track the cells overexpressing p73, we engineered a TAp73 construct that is tagged with both the HA epitope and the GFP. Both tags were inserted at the NH2-terminal of TAp73
, upstream of the first codon, as described in the scheme depicted in Fig. 4A
. To verify expression and localization of HA-GFP-TAp73, we transiently expressed this construct or a DNA encoding for wild-type TAp73 in Cos-1 cells. Immunoblots from lysates obtained from the transfected cells confirmed that the two constructs could be expressed at similar levels (Fig. 4B)
. Immunofluorescence analysis also confirmed that HA-GFP-TAp73 localizes to the nucleus of Saos2 cells, an osteosarcoma cell line negative for both p53 and p73 expression (Fig. 4C)
. Furthermore, like p53-GFP and wild-type TA-p73, overexpression of HA-GFP-TAp73 in Saos2 cells activates the transcription of p21Cip1 and Bax (Fig. 4D)
. We finally tested the ability of our construct to induce apoptosis in the absence of p53. We transiently overexpressed increasing concentrations of p53-GFP, HA-TAp73, or HA-GFP-TAp73 in Saos2 cells and analyzed the transfected population by immunofluorescence to score cells with condensed chromatin and fragmented nuclei. The three constructs induced comparable levels of cell death (Fig. 4E)
.
|
|
Our findings indicate that TAp73 overexpression can restore the ability of the protein to arrest the cell cycle in G1. However, as had been reported previously for p53 overexpression (33) , high levels of TAp73 do not cause a significant increase in apoptosis.
Mutant p53 and
Np73 Contribute to TAp73 Inactivation in Thyroid Cancer.
A possible explanation for the lack of TAp73 activity in thyroid cancer could be that TAp73 is inactivated frequently by mutational events. Whereas mutations of TAp73 are extremely infrequent in human neoplasias, such events have been described in tumors of the central nervous system, the lung, and the breast (16)
. Sequence analysis of the p73 mRNA isolated from all of the thyroid cancer cells studied failed to identify DNA alterations. Hence, we could exclude that mutations in the p73 sequence might account for its inability to arrest or kill thyroid cancer cells.
Previous reports have demonstrated that both mutant p53 and
Np73 play a role in the functional inactivation of TAp73 (27
, 31) . Inactivation of p53 is a frequent event in the progression of thyroid cancer to less-differentiated, more invasive phenotypes (11)
. Moreover, all of the thyroid cancer cell lines used in our study express mutated p53 (Table 2)
. To establish whether nonfunctional p53 is involved in TAp73 inactivation, we immunoprecipitated p53 in KAT-4 and Hth-74 cells, and then probed the blot with an anti-TAp73 antibody. Indeed, TAp73 was found to interact with mutant-p53 (Fig. 6A
, top panel). As expected, we did not detect any interaction in TPC-1 and SW-1736 cells, because the former thyroid cancer line is negative for p73, whereas the latter does not express p53 (Fig. 6A
, top panel).
|
Np73 is also involved in the functional inactivation of TAp73, we immunoprecipitated lysates from ARO, KAT-4, and SW-1736 cells with an antibody that recognizes only
Np73. Blotting with an antibody specific for TAp73 revealed that the endogenous
Np73 interacts with TAp73 (Fig. 6B)
Np73 (data not shown).
Overall, our results confirmed that both mutant p53 and
Np73 are involved in the functional inactivation of TAp73 in thyroid cancer cells.
Expression of Wild-Type p53 Down-Regulates Endogenous TAp73 in Thyroid Cancer.
Previous evidence suggests that TAp73 is involved in the apoptotic response triggered by p53 (34)
. However, in thyroid cancer cell lines that express TAp73, high levels of wild-type p53 lead to G1 arrest but not to cell death (Fig. 5A)
. We wanted to investigate whether, in our cell lines, overexpression of wild-type p53 influenced the levels of TAp73. Hence, we performed anti-TAp73 and anti-p53 immunoblots on two clones of ARO cells (AROIF and AROC5) that stably express a temperature-sensitive p53 construct. This naturally occurring p53 mutant is not functional at 37°C but is active at 32°C (33)
. Untransfected or mock-transfected ARO cells showed no variations in TAp73 expression at the two different temperatures (Fig. 7
A, top panel). To our surprise, activation of p53 led to a significant decrease in TAp73 expression in both AROIF and AROC5 (Fig. 7
A, top panel). As expected, p53 expression was not modified by growth at 32°C, because in these cells the lower temperature induces the functional activation but not the expression of the p53 protein (Fig. 7A
, second panel). Activation of p53 also caused the induction of p21Cip1 (Fig. 7A
, third panel). Notably, the up-regulation of p21Cip1 occurred in conditions in which TAp73 levels were down-regulated.
|
Our observations suggest that, in thyroid cancer cells, the expression levels of wild-type p53 and TAp73 are interdependent and possibly mutually regulated.
| DISCUSSION |
|---|
|
|
|---|
Many different mechanisms could explain our observations. First of all, it is interesting to note that in thyroid cancer cells, TAp73 is unresponsive to doxorubicin, because exposure to the drug leads to a marginal increase in protein expression. We are still uncertain if this lack of TAp73 induction is because of a dysfunctional promoter or to a decreased half-life of the protein. In any case, this phenomenon is not specific for doxorubicin because many other DNA-damaging agents fail to induce TAp73 expression in our panel of thyroid cancer lines.5 Moreover, the fact that overexpression can only partially rescue TAp73 tumor-suppressor activity suggests that, in addition to defects upstream of TAp73 activation, signaling downstream of TAp73 could be compromised as well. Hence, thyroid cancer cells appear to select multiple roadblocks to interfere both with the activation and the downstream signaling of TAp73.
We report elsewhere that one such block is represented by a strong reduction in the nuclear import of the ABL tyrosine kinase (35)
. Here we describe two additional mechanisms involved in the inactivation of TAp73 in thyroid cancer cells. The first concerns the p53 tumor suppressor protein. Previous studies have demonstrated that mutant p53 can interact with TAp73 via its core domain (36)
. The formation of heterotetramers composed of mutated p53 and wild-type TAp73 results in the functional inactivation of the latter (30
, 31)
. All of the thyroid cancer cells included in our study express a nonfunctional p53 protein (Table 2)
. In several of them we have found mutant p53 to interact with TAp73.
A second mechanism that interferes with TAp73 activity in thyroid cancer involves
Np73.
Np73 is a dominant-negative form of p73 that can abrogate the activity of TAp73 (16)
. In our study we have found that thyroid cancer cell lines that express TAp73 also express
Np73. Immunoprecipitation studies documented a direct interaction between TAp73 and
Np73. These results strongly suggest that
Np73 may also play a major role in the functional inactivation of TAp73.
An issue that is still unresolved concerns the biological role of p73 in the malignant thyroid epithelium. In our study we identified p73 in a wide panel of thyroid cancer cell lines and in all of the primary specimens isolated from thyroid cancer. On the contrary, the normal thyroid did not express p73. Thus the question lingers: why do thyroid cancer cells express p73? Whereas it is true that all tumor cells are able to survive by dodging the many death signals that surround them (37) , it seems unlikely that in thyroid cancer p73 expression is a remnant of an apoptotic pathway that the cells have successfully inactivated. Previous reports suggest that, in ovarian cancer, p73 expression reduces p53 transcriptional activity (38 , 39) . More recently, Freebern et al. (40) have reported that in a leukemia cell line, TAp73, acts as a transcriptional repressor, blocking p53-mediated cell death. Therefore, it is possible that p73 expression could confer some kind of selective advantage to thyroid cancer cells. Indeed, in our cancer lines, overexpression of wild-type p53 causes a strong down-regulation of TAp73 expression. This down-regulation is due to an increased degradation of the protein, because treatment with a proteasome inhibitor can restore normal levels of TAp73. It remains to be seen whether the down-regulation of TAp73 after ectopic expression of wild-type p53 is because of p53 itself, or represents an adaptation response of the neoplastic cells to avoid a synergic effect between p53 and TAp73.
An additional level of complexity is represented by the expression of
Np73 regardless of the histotype or the differentiation status of thyroid neoplasias. Wild-type p53 and TAp73 have both been identified as targets of
Np73 biological activity. Differentiated thyroid carcinomas usually display wild-type p53. Hence, it is possible that in these tumors
Np73 disrupts p53 activity. On the other hand, undifferentiated thyroid cancers are often characterized by the inactivation of both p53 alleles. It remains to be determined whether, in this aggressive form of thyroid carcinoma, TAp73 is the only target of
Np73.
In summary, whereas it seems clear that p73 expression is a marker of neoplastic thyroid cells, the biological function and the molecular interplay of the various p73 isoforms in thyroid cancer remain partially unresolved. The clarification of these complex issues awaits additional investigation.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by a grant from AIRC (Associazione Italiana per la Ricerca sul Cancro) to R. V. F. F. is a fellow of the AICF (American Italian Cancer Foundation), whereas both V. V. and A. A. are supported by a fellowship from AIRC. P. V. is a fellow of the LRF (Leukemia Research Foundation). ![]()
2 These authors equally contributed to this work. ![]()
3 To whom requests for reprints should be addressed at Dipartimento di Medicina Interna e di Medicina Specialistica Endocrinologia, Ospedale Garibaldi, Piazza Santa Maria di Gesù, 1 95123 Catania, Italy. Phone: 39-095-326290; Fax: 39-095-7158072; E-mail: vigneri{at}unict.it ![]()
4 The abbreviations used are: TAp73, transcriptionally active p73;
Np73, p73 isoforms lacking the NH2-terminus (first three exons);
TAp73, p73 isoforms lacking a functional transactivation domain; GFP, green fluorescent protein; PI, propidium iodide; FBS, fetal bovine serum; RT-PCR, reverse transcription-PCR; FACS, fluorescence-activated cell sorter; HA, hemagglutinin. ![]()
5 Frasca and Vigneri, unpublished observations. ![]()
Received 2/10/03. Revised 6/19/03. Accepted 7/10/03.
| REFERENCES |
|---|
|
|
|---|
1 fusion oncogene in human thyroid carcinoma. Science (Wash. DC), 289: 1357-1360, 2000.
(p73
exon2) inhibits apoptosis and competes with p53. Oncogene, 20: 514-522, 2001.[Medline]
TA-p73 inhibits p53 by direct competition for DNA binding: implications for tumorigenesis. J. Biol. Chem., 277: 14177-14185, 2002.
TA-p73 acts as an oncogene. Cancer Res., 62: 3598-3602, 2002.
and
, with different transcriptional activity. J. Exp. Med., 188: 1763-1768, 1998.
Np73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ., 8: 1213-1223, 2001.[Medline]
Np73: a newly identified isoform of human p73. Cancer Res., 62: 636-641, 2002.This article has been cited by other articles:
![]() |
P. Lunghi, A. Costanzo, L. Mazzera, V. Rizzoli, M. Levrero, and A. Bonati The p53 Family Protein p73 Provides New Insights into Cancer Chemosensitivity and Targeting Clin. Cancer Res., November 1, 2009; 15(21): 6495 - 6502. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Malaguarnera, V. Vella, G. Pandini, M. Sanfilippo, V. Pezzino, R. Vigneri, and F. Frasca TAp73{alpha} Increases p53 Tumor Suppressor Activity in Thyroid Cancer Cells via the Inhibition of Mdm2-Mediated Degradation Mol. Cancer Res., January 1, 2008; 6(1): 64 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Johnson, J. Lagowski, A. Sundberg, S. Lawson, Y. Liu, and M. Kulesz-Martin p73 Loss Triggers Conversion to Squamous Cell Carcinoma Reversible upon Reconstitution with TAp73{alpha} Cancer Res., August 15, 2007; 67(16): 7723 - 7730. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bozzetti, R. Nizzoli, A. Musolino, E. M. Martella, P. Crafa, C. A. Lagrasta, R. Camisa, A. Bonati, P. Lunghi, and A. Ardizzoni p73 and p53 Pathway in Human Breast Cancers J. Clin. Oncol., April 10, 2007; 25(11): 1451 - 1453. [Full Text] [PDF] |
||||
![]() |
G. Dominguez and F. Bonilla In Reply J. Clin. Oncol., April 10, 2007; 25(11): 1453 - 1454. [Full Text] [PDF] |
||||
![]() |
R Malaguarnera, V Vella, R Vigneri, and F Frasca p53 family proteins in thyroid cancer Endocr. Relat. Cancer, March 1, 2007; 14(1): 43 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aiello, G. Pandini, F. Frasca, E. Conte, A. Murabito, A. Sacco, M. Genua, R. Vigneri, and A. Belfiore Peroxisomal Proliferator-Activated Receptor-{gamma} Agonists Induce Partial Reversion of Epithelial-Mesenchymal Transition in Anaplastic Thyroid Cancer Cells Endocrinology, September 1, 2006; 147(9): 4463 - 4475. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Cecchinelli, L. Lavra, C. Rinaldo, S. Iacovelli, A. Gurtner, A. Gasbarri, A. Ulivieri, F. Del Prete, M. Trovato, G. Piaggio, et al. Repression of the Antiapoptotic Molecule Galectin-3 by Homeodomain-Interacting Protein Kinase 2-Activated p53 Is Required for p53-Induced Apoptosis Mol. Cell. Biol., June 15, 2006; 26(12): 4746 - 4757. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Frasca, A. Rustighi, R. Malaguarnera, S. Altamura, P. Vigneri, G. Del Sal, V. Giancotti, V. Pezzino, R. Vigneri, and G. Manfioletti HMGA1 Inhibits the Function of p53 Family Members in Thyroid Cancer Cells. Cancer Res., March 15, 2006; 66(6): 2980 - 2989. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Malaguarnera, A. Mandarino, E. Mazzon, V. Vella, P. Gangemi, C. Vancheri, P. Vigneri, A. Aloisi, R. Vigneri, and F. Frasca The p53-homologue p63 may promote thyroid cancer progression Endocr. Relat. Cancer, December 1, 2005; 12(4): 953 - 971. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Nyman, A. Sobczak-Pluta, P. Vlachos, T. Perlmann, B. Zhivotovsky, and B. Joseph Full-length p73{alpha} Represses Drug-induced Apoptosis in Small Cell Lung Carcinoma Cells J. Biol. Chem., October 7, 2005; 280(40): 34159 - 34169. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Flinterman, L. Guelen, S. Ezzati-Nik, R. Killick, G. Melino, K. Tominaga, J. S. Mymryk, J. Gaken, and M. Tavassoli E1A Activates Transcription of p73 and Noxa to Induce Apoptosis J. Biol. Chem., February 18, 2005; 280(7): 5945 - 5959. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Uramoto, K. Sugio, T. Oyama, S. Nakata, K. Ono, M. Morita, K. Funa, and K. Yasumoto Expression of {Delta}Np73 Predicts Poor Prognosis in Lung Cancer Clin. Cancer Res., October 15, 2004; 10(20): 6905 - 6911. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |