Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium  09 AM Call for Abstracts
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frasca, F.
Right arrow Articles by Vigneri, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frasca, F.
Right arrow Articles by Vigneri, P.
[Cancer Research 63, 5829-5837, September 15, 2003]
© 2003 American Association for Cancer Research


Regular Articles

p73 Tumor-Suppressor Activity Is Impaired in Human Thyroid Cancer1

Francesco Frasca2, Veronica Vella2, Alessandra Aloisi, Angelo Mandarino, Emanuela Mazzon, Riccardo Vigneri3 and Paolo Vigneri

Dipartimento di Medicina Interna e di Medicina Specialistica – Endocrinologia, Università di Catania, 95123 Catania [F. F., V. V., A. A., A. M., R. V.]; Centro di Biomorfologia, Università di Messina, 98122 Messina [E. M.]; and Dottorato di Ricerca in Oncologia, Università di Catanzaro "Magna Graecia," 88100 Catanzaro, and Dipartimento di Scienze Biomediche, Università di Catania, 95124 Catania, [P. V.], Italy


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The p73 protein is a member of the p53 family and, like p53, can induce cell-cycle arrest and apoptosis in response to DNA damage. Because the loss of p53 function is responsible for the progression of well-differentiated thyroid cancer to more aggressive phenotypes, we hypothesized that p73 might also be involved in thyroid carcinogenesis.

We find that normal thyrocites do not express p73, whereas most thyroid malignancies are positive for p73 expression. However, the p73 protein of thyroid cancer cells is unresponsive to DNA-damaging agents, failing to elicit a block of the cell cycle or an apoptotic response. Notably, overexpression of transcriptionally active p73 in thyroid cancer lines can arrest the cell cycle but is still unable to induce cell death. The loss of p73 biological activity in neoplastic thyroid cells is partly explained by its interaction with transcriptionally inactive variants of p73 ({Delta}Np73) and with mutant p53. Our findings suggest that the functional impairment of p73 could be involved in the development of thyroid malignancies, defining p73 as a potential therapeutic target for thyroid cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Malignancies of the thyroid follicular epithelium are regarded as a unique model to study human carcinogenesis, because they comprise tumors with different clinical and histological features (1) . Indeed, papillary and follicular thyroid cancers are slow-growing, well-differentiated tumors, whereas anaplastic thyroid cancers are undifferentiated neoplasias that behave much more aggressively, usually leading to the death of the patient <1 year from diagnosis (2 , 3) . Well-differentiated thyroid cancers maintain some morphological features of the normal thyroid and are often responsive to radioiodine treatment, because they usually retain the expression of the sodium iodide symporter (4) . On the contrary, anaplastic tumors have lost any significant resemblance to the structural organization of a normal thyroid follicle, and are unresponsive to both radioactive iodine treatment and chemotherapeutic agents (5) .

From a molecular standpoint, well-differentiated thyroid cancers are often initiated by genetic events that involve the improper activation of cellular proto-oncogenes (6) . In up to 40% of papillary thyroid carcinomas, rearrangements of the RET or NTRK1 tyrosine kinases with a plethora of activating genes represent the first event in tumor development (7 , 8) . In ~35% of follicular thyroid carcinomas, neoplastic transformation is triggered by activating mutations of the RAS gene or by the fusion of the PAX8 transcription factor with the gene encoding for peroxisome proliferator-activated receptor {gamma} (1 , 9) . Unfortunately, whereas some of the genetic events responsible for the development of well-differentiated thyroid cancers have been identified, the molecular mechanisms that generate the lethal anaplastic thyroid cancer are still unclear (10) . To date, the only established genetic alteration involved in the dedifferentiation process leading to anaplastic thyroid tumor development is the loss of the p53 tumor suppressor gene (11) .

p73 belongs to a family of proteins defined by the p53 tumor suppressor gene (12 , 13) . p53 and p73 share significant homologies in their structural organization characterized by an NH2-terminal transactivation domain, a central DNA-binding domain, and a COOH-terminal oligomerization domain (14) . In addition, both p53 and p73 can block the cell cycle or induce cell death in response to DNA damage, or after the activation of selected oncogenes (15 , 16) .

Despite these characteristics, p53 and p73 can play distinct and sometimes opposing biological roles in cancer development (17) . Unlike p53, p73 can be expressed as a wide variety of significantly different transcripts. Abnormal splicing mechanisms generate p73 mRNAs defective of the second exon ({Delta}2p73), or both the second and third exons ({Delta}2–3p73; Refs. 18, 19, 20 ). Moreover, the presence of two functional promoters can alternatively produce TAp734 (Ref. 4 ; transcribed from the first exon) or {Delta}Np73 (transcribed from a previously silent 3' exon) isoforms (21) . Both the aberrant splicing of the first exons and the activation of an alternative promoter generate p73 transcripts that lack a functional transactivation domain (22) . Because these {Delta}TAp73 isoforms are still able to oligomerize with transcriptionally competent p73 variants, they behave as dominant-negative proteins that interfere with the activity of TAp73 and can cause malignant transformation (16 , 23) . This composite picture is additionally complicated by the discovery that each NH2-terminal p73 variant can present multiple COOH terminus ends originated by the alternative splicing of the last five exons of p73 (24, 25, 26) . In the end, the net biological function of p73 results from the multiple interactions of transcriptionally active (TAp73) and transcriptionally silent ({Delta}2p73, {Delta}2–3p73, and {Delta}Np73) isoforms of the protein (14 , 16) .

Another intricate issue concerns the direct interplay between p53 and p73. Multiple reports have shown that {Delta}Np73 can interfere with wild-type p53 activity by competing for the p53 binding sites on several promoters (20 , 27, 28, 29) . At the same time, it has been demonstrated that certain p53 mutants can bind TAp73, thereby inactivating its transcriptional activity (30 , 31) .

Here we report that TAp73 and {Delta}Np73 are expressed in well-differentiated and undifferentiated thyroid carcinomas but are not present in normal thyroid tissues, suggesting that p73 might be involved in thyroid carcinogenesis. Indeed, in thyroid carcinomas, TAp73 is not up-regulated by DNA-damaging agents and fails to induce either cell-cycle arrest or apoptosis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells.
Human thyroid cancer cell lines TPC-1 (papillary), BC-PAP (papillary), NPA (papillary), WRO (follicular), ARO (anaplastic), and KAT-4 (anaplastic), provided by Alfredo Fusco and Massimo Santoro (University of Naples Federico II, Italy); ARO Neo, ARO IF, and ARO C5 a gift of Alfredo Pontecorvi (Catholic University of the Sacred Heart of Jesus, Rome, Italy); SW-1736 (anaplastic), Hth-74 (anaplastic), and C-643 (anaplastic) provided by Nils Heldin (Uppsala University, Uppsala, Sweden); FF-1 (anaplastic) established in our laboratory; ONCO-DG-1 (papillary) and 8505-C (papillary) purchased from DMSZ (Braunschweig, Germany); and FTC-133 (follicular), FTC-238 (follicular,) and 8305-C (anaplastic) purchased from ECACC (Salisbury, United Kingdom) were grown in RPMI 1640 (Sigma, St. Louis, MO) supplemented with 2 mM glutamine, 10% FBS, and 100 µg/ml penicillin and streptomycin. Normal thyroid cells in primary culture were obtained from surgical specimens after treatment with 1 mg/ml collagenase IV (Sigma). The human osteosarcoma cell line Saos-2 and simian kidney cell line COS-1 were provided by Jean Wang (University of California, San Diego, CA) and cultured in DMEM (Sigma) additioned with 10% FBS, and 100 µg/ml penicillin and streptomycin. The human hepatocarcinoma cell line HepG2 (American Type Culture Collection, Manassas, VA) was grown in MEM supplemented with FBS and antibiotics as described above.

Human Thyroid Tissue Samples.
Human thyroid cancer specimens were obtained at surgery and stored in liquid nitrogen until processing.

Immunohistochemistry.
Immunohistochemical staining was performed on 7-µm thick sections of unfixed tissue specimens. Sections were cut with a cryostat at -30°C, fixed with acetone at -20°C for 10 min, and hydrated with PBS, at room temperature for 45 min. After blocking in 2% normal serum for 20 min, sections were incubated overnight with the anti-p73 polyclonal antibody Ab-6 (1:100; NeoMarkers, Labvision Corp., Fremont, CA). Specific labeling was detected with biotin-conjugated antimouse/antirabbit IgG and avidin-biotin peroxidase complex. Sections were counterstained with hematoxylin QS, examined, and photographed using an Olympus BH-2 microscope.

Immunofluorescence.
Cells were fixed in 3.7% formaldehyde, permeabilized with PBS/0.3% Triton X-100, blocked with PBS/10% normal goat serum, and incubated with primary antibodies for 1 h. To detect endogenous TAp73 we used monoclonal antibody 429 (Imgenex, San Diego, CA), whereas HA-tagged p73 was revealed by an anti-HA monoclonal antibody (CRP, Berkley, CA). The cells were then incubated with Alexa-conjugated (Alexa Fluor 594 or 488) secondary antibodies (Molecular Probes, Leiden, the Netherlands) for 1 h. To visualize the cytoplasm, the cells were also incubated with Alexa-conjugated phalloidin (Molecular Probes) for an additional 30 min. The cells were finally counterstained with Hoechst (Sigma) to color the nuclei. Epifluorescence microscopy was performed with an Olympus microscope. The images were digitally acquired with an Orca CCD Camera (Hamamatsu, Hamamatsu City, Japan) and processed with the Image-Pro Plus 4.0 software (Media Cybernetics, Silver Spring, MD).

Immunoprecipitation and Immunoblot Analysis.
Cell lysates were prepared in radioimmunoprecipitation assay buffer containing 0.1% SDS and protease inhibitor mixture (Roche Biochemical Inc, Basel, Switzerland). For immunoprecipitation (IP) experiments, 1 mg of cell lysate was incubated for 2 h with 2 µg of antibody. After an incubation with protein A-Sepharose (Amersham Biosciences, Uppsala, Sweden), samples were resuspended in loading buffer, separated by SDS-PAGE, and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with 5% milk-Tris Buffered Saline with 0.5% Tween and then immunoblotted with primary antibodies (1 mg/ml). Appropriate horseradish peroxidase-conjugated secondary antibodies were added at 1:2000 (Amersham Biosciences), and proteins were visualized by enhanced chemiluminescence (Pierce, Rockford, IL).

The following antibodies were used for immunoprecipitation: mixture of monoclonal antibodies against different epitopes of p73 Ab-4 (NeoMarkers), polyclonal anti-HA antibody (CRP), polyclonal anti-{Delta}Np73 antibody (Oncogene Research, La Jolla, CA), monoclonal antibody DO-1 against the NH2 terminus of p53 (Santa Cruz Biotechnology, Santa Cruz, CA), and monoclonal anti-GFP antibody (CRP).

The following antibodies were used for Western blotting: monoclonal antibodies 429 and 1288 (Imgenex), respectively, recognizing the transactivation domain and the DNA-binding domain of p73; polyclonal Ab-5 antibody (NeoMarkers) recognizing the DNA binding domain of p73; monoclonal DO-1 antibody (Santa Cruz Biotechnology); polyclonal anti p21 antibody (Santa Cruz Biotechnology); monoclonal anti-Bax antibody (Trevigen Inc., Gaithersburg, MD); monoclonal anti- actin antibody (Sigma); and monoclonal anti-HA and anti-GFP antibodies (CRP). The proteasome inhibitor MG132 was purchased from Sigma.

Transcript Analysis by RT-PCR.
Total RNA (1 µg) was reverse transcribed with Superscript II (Invitrogen, Paisley, United Kingdom) and oligodeoxythymidylic acid primers. Two µl of the synthesized cDNA were then combined in a PCR reaction specific for TAp73, using primers 5' CGGGACGGACGCCGATG 3' (forward) and 5' CTTGGCGATCTGGCAGTAG 3' (reverse) spanning exons 1 and 5 of the p73 gene (fragment size, 542 bp). The {Delta}Np73 transcript was detected using primers 5'GCTGTACGTCGGTGACCC3' (forward) and 5' CTTGGCGATCTGGCAGTAG 3' (reverse; fragment size, 322 bp). Transcription of the housekeeping ELE1 gene was carried out using primers 5' ATTGAAGAAATTGCAGGCTC 3' (forward) and 5' TGGAGAAGAGGAGCTGTATCT 3' (reverse). All of the TAp73 transcripts expressed by thyroid cancer lines included in this report were screened for possible mutations by automatic sequencing of RT-PCR amplicons generated using primers 5' CGGGACGGACGCCGATG 3' (forward) and 5' CAGATGGTCATGCGGTACTG 3' (reverse). To assess the p53 status of all thyroid cancer cells studied, the p53 coding sequence was amplified by RT-PCR using primers 5' CCTTCCGGGTCACTGC 3' (forward) and 5' TGGGCCTTGAAGTTAGAGAAA 3' (reverse). PCR products were then subjected to automatic sequencing (BMR-CRIBI Sequencing Service, University of Padua, Padua, Italy).

Plasmids and Transfections.
pCDNA3.0-HA-TAp73{alpha}, pCDNA3.0-HA-{Delta}Np73{alpha}, pCDNA3.1-p53, and pBOS-H2B-GFP were provided by Jean Wang (University of California, San Diego, CA). pCDNA3.1-p53-GFP was a gift of Geoffrey Wahl and Jane Stommel (The Salk Institute, LA Jolla, CA); p21Luc and BaxLuc were donated by Giovanni Blandino (Regina Elena Cancer Institute, Rome, Italy). pCDNA3.0-HA-GFP-TAp73{alpha} was prepared in our laboratory. The GFP cDNA was obtained by RT-PCR using pEGFP (Clontech, Palo Alto, CA) as a template. The primers used were 5' GCTAGCATGGTGAGCAAGGGCGAG 3' (forward) and 5' GATGCTAGCCTTGTACAGCTCGTCCAT 3' (reverse). The GFP cDNA was inserted into pCDNA3.0-HA-TAp73{alpha} at the NheI site, located between the HA tag and the TAp73{alpha} sequence. All of the transfections were performed in six-well plates with Fugene 6 (Roche Biochemical Inc.) according to the manufacturer’s instructions (DNA:fugene ratio 1:3), and cells were processed 24 h after transfection. To obtain stable transfected clones, cells were plated onto 100-mm Petri dishes and grown in complete medium containing 1 mg/ml of Geneticin (Invitrogen). After 2 weeks, clones were isolated, grown in 35-mm Petri dishes, and screened by Western blot for HA-GFP-TAp73{alpha} expression.

Luciferase Assay.
The p21Luc or BaxLuc constructs were cotransfected with pCDNA3.1, pCDNA3.0-HAp73, or pCDNA3.1-p53 (DNA ratio 1:1). A vector coding for the Renilla luciferase (provided by Enrico Conte, University of Catania, Catania, Italy) was also cotransfected in all of the conditions (DNA ratio 1:20). Twenty-four h after transfection, the cells were processed with the Dual Luciferase Assay (Promega Corp., Madison, WI) according to the manufacturer’s instructions. Luciferase activity was normalized for transfection efficiency (Renilla activity).

Cell Cycle and Apoptosis Evaluation.
Cells were synchronized for 36 h in serum-free medium without leucine and released in complete medium for 12 (cell cycle) or 72 h (apoptosis) in the presence or the absence of 2 µM doxorubicin. Adherent and floating cells were harvested and resuspended in 70% ethanol and stored at -20°C. Permeabilized cells were centrifuged and resuspended in PBS containing 20 mg/ml PI plus 40 mg/ml RNase (Sigma) for 30 min in the dark. Cells were then subjected to FACS analysis (FACScalibur, BD Bioscience, Bedford, MA) and gated for PI (X axis = FLH2; Y axis = events). Sub-G1 cells were scored as apoptotic. Cells transfected with GFP-tagged constructs were fixed with 1% paraformaldehyde in PBS for 2 h at 4°C and permeabilized with 0.3% Triton in PBS for 20 min at room temperature. Permeabilized cells were then incubated with PI and RNase O/N at 4°C in the dark. Cells were gated for PI and GFP.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
p73 Expression and Localization in Thyroid Cancer Cell Lines.
To determine the expression of TAp73 in immortalized thyroid cancer cells, we analyzed 5 papillary, 3 follicular, and 7 anaplastic thyroid cancer lines by RT-PCR. We also screened 4 primary cultures of normal thyrocites. To detect all of the p73 isoforms derived from alternative splicing of the p73 NH2 terminus (TA, {Delta}2, or {Delta}2–3 p73), we designed primers located on exon 1 and exon 5 of the p73 sequence. We did not find TAp73 transcripts in normal thyroid or in follicular thyroid cancer lines (Fig. 1ACitation , top panel). However, 4 of 5 papillary and 4 of 7 anaplastic cell lines expressed variable levels of TAp73 (Fig. 1ACitation , top panel). In contrast, we never observed amplicons compatible with {Delta}2p73 or {Delta}2–3p73 (data not shown). Because differential splicing of the p73 COOH terminus originates multiple TAp73 isoforms, we performed an additional RT-PCR, amplifying exons 10–14 of the p73 gene. We found a high expression of p73{alpha} and lower but detectable levels of p73ß (data not shown).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. p73 expression and localization in human thyroid cancer cell lines. A, thyrocites from a normal thyroid, 5 papillary (TPC-1, ONCO-DG1, 8505C, BC-PAP, and NPA), 3 follicular (WRO, FTC133, and FTC238), and 7 anaplastic (ARO, FF1, KAT-4, SW-1736, C-643, Hth-74, and 8305C) thyroid cancer cell lines were screened by RT-PCR for TAp73 and {Delta}Np73 expression. Amplification of the ubiquitous ELE1 gene confirms adequate normalization of the samples. B, lysates from representative thyroid cancer cells were subjected to SDS-PAGE and then probed with an antibody against NH2-terminal residues present only in TAp73 (clone 429). The antitubulin blot shows equal protein loading in all conditions. To identify the {Delta}Np73 protein, cell lysates were immunoprecipitated with a mixture of three monoclonal antibodies recognizing all p73 isoforms. The lysates were then blotted with a polyclonal antibody (Ab5) against epitopes shared by both TA and {Delta}Np73. Cos-1 cells transfected with TAp73{alpha}, TAp73ß, {Delta}Np73, or cotransfected with all three constructs are shown as a control. C, TPC-1, NPA, Hth-74, and SW-1736 cells were plated on coverslips, fixed, and stained for TAp73 (red) and filamentous actin (green). Nuclei were visualized with Hoechst (blue).

 
We then investigated whether our cell lines expressed {Delta}Np73. Using primers located on the last nucleotides of the third intron (transcribed only in {Delta}Np73) and on the fourth exon of the p73 sequence we observed the {Delta}Np73 mRNA in all of the cell lines positive for TAp73 (Fig. 1ACitation , bottom panel).

We next sought to establish whether our RT-PCR results reflected p73 protein expression. We performed a Western blot on the thyroid cancer cells that expressed p73 mRNA, using an antibody (clone 429) that recognizes an epitope in the NH2-terminal transactivation domain of p73. We confirmed protein expression in all of the cell lines positive for the TAp73 transcript (Fig. 1BCitation , top panel) with the exception of 8505C cells (data not shown).

To ascertain {Delta}Np73 protein expression, thyroid cancer cells expressing {Delta}Np73 mRNA were lysed, immunoprecipitated, and blotted with antibodies that can distinguish all of the p73 variants by their molecular weight. We found barely detectable levels of {Delta}Np73 in BC-PAP and Hth-74 cells, whereas ONCO-DG-1, ARO, KAT-4, and SW-1736 expressed higher levels of {Delta}Np73 (Fig. 1BCitation , bottom panel; data not shown).

We also evaluated the subcellular localization of TAp73 in thyroid cancer cells. An immunofluorescence experiment on three p73-positive cell lines (NPA, Hth-74, and SW-1736) using a TAp73-specific antibody (clone 429) revealed an intense nuclear signal (Fig. 1C)Citation . As expected, we did not observe p73 staining in the p73-negative TPC-1 cells (Fig. 1C)Citation .

Our initial findings indicated that TAp73 and {Delta}Np73 are not expressed in normal thyroid cells but are present in a wide variety of thyroid cancer cell lines, thereby raising the possibility that these proteins might be involved in thyroid tumorigenesis.

p73 Expression and Localization in Human Thyroid Cancer Specimens.
To validate the results obtained in thyroid cancer cell lines, we analyzed the p73 status of tissue specimens derived from malignant tumors of the thyroid epithelium. Initially, we isolated mRNA from three thyroid cancers and a normal thyroid, and performed two RT-PCR reactions using primers specific for TAp73 or {Delta}Np73. TAp73 and {Delta}Np73 expression was elevated in all of the thyroid neoplasias but was undetectable in the normal thyroid tissue (Fig. 2A)Citation .



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 2. TAp73 and {Delta}Np73 expression and localization in human thyroid cancer specimens A, specimens obtained from three thyroid cancers and a normal thyroid were analyzed by RT-PCR for TAp73 and {Delta}Np73 expression. RNA of SW-1736 cells was used as a positive control. The ELE1 gene shows proper normalization of the RNA extracted from each sample. B, lysates from eight human thyroid cancer specimens were immunoprecipitated and then blotted with a polyclonal antibody (Ab6) that recognizes both TAp73 and {Delta}Np73. TPC-1 (p73-negative), SW-1736 (p73-positive), and COS1 cells transfected with both TAp73 and {Delta}Np73 were used as a control. C, immunohistochemistry for both TAp73 and {Delta}Np73 was performed on frozen thyroid cancer specimens (see Table 1Citation ). Hematoxilin Eosin staining (i, ii, and iii), a specificity control using a nonimmune serum (iv, v, and vi), TAp73 staining (vii, viii, and ix), and {Delta}Np73 staining (x, xi, and xii) of a normal thyroid tissue (left), and two thyroid carcinomas. Higher magnification of a selected area is shown in the insert.

 
We then extracted cell lysates from 8 thyroid cancer specimens and performed an anti-p73 immunoblot. Six of 8 samples showed TAp73 protein expression, whereas 4 tumors expressed {Delta}Np73 (Fig. 2B)Citation .

To additionally confirm that the malignant thyroid cells were the source of p73 expression and to verify the subcellular distribution of TAp73 and {Delta}Np73, we analyzed a more consistent number of specimens by immunohistochemistry. We selected 20 thyroid specimens including 3 normal thyroids, 5 papillary, 4 follicular, and 8 anaplastic thyroid cancers (Table 1)Citation . TAp73 and {Delta}Np73 were never expressed in the normal thyroid (Fig. 2Citation C; Table 1Citation ). On the contrary, we observed both TAp73 and {Delta}Np73 in all of the thyroid tumors tested (Fig. 2Citation C; Table 1Citation ). This result was partially in contrast with our findings on follicular thyroid cancer cell lines in which we did not detect any p73 transcript. This discrepancy could be because of adaptation mechanisms proper of cell lines grown in vitro.


View this table:
[in this window]
[in a new window]
 
Table 1 TAp73 and {Delta}Np73 expression in human thyroid cancer specimens

Twenty specimens isolated from normal (3) or malignant (17) thyroid tissues were screened for TAp73 and {Delta}Np73 expression by immunohistochemistry. Two independent pathologists reviewed the slides separately. Quantification of the staining was based on the analysis of at least ten different fields.

 
Immunohistochemistry also showed that TAp73 and {Delta}Np73 expression is predominantly nuclear, although in sporadic cases we could detect some citoplasmic staining.

Overall, our results in human thyroid tissue specimens confirmed that p73 is not expressed in normal thyroid epithelia but is present in thyroid cancer.

Lack of Functional Activity of TAp73 in Thyroid Cancer.
p73 is a member of the p53 family of proteins and, like p53, can regulate cell proliferation and survival after DNA damage (32) . Specifically, in response to DNA-damaging agents, TAp73 can induce several downstream targets including p21Cip1 and Bax. In turn, the increased expression of these proteins blocks the cell cycle in the G1 phase or induces cell death. The observation that a protein with potential tumor-suppressor activity is highly expressed in thyroid tumors was difficult to understand and warranted additional investigation.

We have analyzed the p53 sequence of all of the thyroid cancer cells included in our study and report that each line presents mutations that functionally inactivate p53 (Table 2)Citation . Hence, in these cell lines, the induction of p21Cip1 or Bax in response to DNA damage is likely attributable to TAp73. We wanted to determine whether the tumor-suppressor activity of TAp73 was preserved in these thyroid cancer cells. Therefore, we selected seven representative lines and grew them for 12 h in normal medium or in medium additioned with 2 µM doxorubicin. Unexpectedly, doxorubicin treatment failed to cause any G1 arrest in thyroid cancer cells (Fig. 3A)Citation . This result was additionally confirmed by a Western blot that failed to detect an increase in p21Cip1 expression in any of the thyroid cells exposed to doxorubicin (Fig. 3CCitation , top panel). On the contrary, doxorubicin treatment increased p21Cip1 expression in HepG2 hepatocarcinoma cells that we chose as a control (Fig. 3CCitation , top panel).


View this table:
[in this window]
[in a new window]
 
Table 2 p53 mutations in thyroid cancer cell lines

Total RNA isolated from the indicated thyroid cancer cell lines was subjected to RT-PCR with primers specific for p53. The expected amplicon was observed in all lines with the exception of SW-1736. Each PCR product was fully sequenced twice with an automated sequencer.

 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. The endogenous TAp73 lacks functional activity in thyroid cancer cell lines A, 8505-C, ONCO-DG-1, BC-PAP, NPA, ARO, KAT-4, and SW-1736 cells were analyzed for variations in their cell-cycle profiles, and in their viability before and after treatment with 2 µM doxorubicin. The bars represent average ± SD of the cell-cycle distribution after FACS analysis (G0/G1 {blacksquare}, S {square}, G2/M ) of four separate experiments. B, for the cell viability assay, untreated ({square}) or doxorubicin-treated () cells were analyzed by FACS to evaluate the percentage of sub-G1 cells in the total population. The bars represent average ± SD of three separate experiments. C, the above indicated thyroid cancer cells and the HepG2 hepatocarcinoma line (as a control) were grown for 12 h in normal medium or in the presence of 2 µM doxorubicin. At the end of treatment, the cells were lysed and analyzed by Western blot for the expression of p53, TAp73, and two downstream targets of the p53 family of proteins: p21Cip1 and Bax. The actin blot shows equal protein loading in all lanes (bottom panel).

 
To assess whether p73 was able to induce apoptosis, we treated the seven cancer cell lines with 2 µM doxorubicin for 72 h. Whereas we noticed an increase in the total number of apoptotic cells, this increase was marginal at best (~10%), indicating that p73 is ineffective in eliciting apoptosis in thyroid cancer cells (Fig. 3B)Citation . This result was strengthened by an immunoblot with an anti-Bax antibody, showing minimal or no increase in the expression of this proapoptotic protein after doxorubicin treatment (Fig. 3CCitation , second panel from top). However, doxorubicin treatment led to an induction of Bax in HepG2 control cells.

In various epithelial cancer models, exposure to DNA-damaging agents leads to an induction of both TAp73 and p53. Indeed, doxorubicin treatment of HepG2 cells caused a strong induction of p53, whereas no TAp73 was detectable because these cells do not express p73 (Fig. 3C)Citation . We next performed an immunoblot with antibodies against TAp73 and p53 on lysates derived from thyroid cancer lines grown in the absence or the presence of doxorubicin. We did not observe significant modifications in TAp73 expression. Similarly, treatment with doxorubicin caused a mild increase of p53 levels in 8505C and BC-PAP cells but failed to increase p53 expression in the remaining thyroid cancer lines (Fig. 3CCitation , fourth panel from top). It is likely that the failure of doxorubicin treatment to increase p53 levels in some of the thyroid cancer cells studied could be because of the high basal level of mutant p53 expressed by these cancer lines.

Our observations suggest that thyroid cancer cells do not induce TAp73 in response to doxorubicin treatment. This result could explain the inability of TAp73 to activate its target genes in thyroid neoplastic cells.

TAp73 Functional Activity Can Be Partially Restored by Overexpression.
We wanted to determine whether overexpression of TAp73 could restore its ability to induce cell-cycle arrest or apoptosis. To track the cells overexpressing p73, we engineered a TAp73 construct that is tagged with both the HA epitope and the GFP. Both tags were inserted at the NH2-terminal of TAp73{alpha}, upstream of the first codon, as described in the scheme depicted in Fig. 4ACitation . To verify expression and localization of HA-GFP-TAp73, we transiently expressed this construct or a DNA encoding for wild-type TAp73 in Cos-1 cells. Immunoblots from lysates obtained from the transfected cells confirmed that the two constructs could be expressed at similar levels (Fig. 4B)Citation . Immunofluorescence analysis also confirmed that HA-GFP-TAp73 localizes to the nucleus of Saos2 cells, an osteosarcoma cell line negative for both p53 and p73 expression (Fig. 4C)Citation . Furthermore, like p53-GFP and wild-type TA-p73, overexpression of HA-GFP-TAp73 in Saos2 cells activates the transcription of p21Cip1 and Bax (Fig. 4D)Citation . We finally tested the ability of our construct to induce apoptosis in the absence of p53. We transiently overexpressed increasing concentrations of p53-GFP, HA-TAp73, or HA-GFP-TAp73 in Saos2 cells and analyzed the transfected population by immunofluorescence to score cells with condensed chromatin and fragmented nuclei. The three constructs induced comparable levels of cell death (Fig. 4E)Citation .



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 4. Expression, localization, and biological activity of a TAp73 construct tagged with the GFP. A, to visualize cells transfected with TAp73, we engineered a TAp73 construct with a GFP tag. The GFP sequence was inserted in frame between the HA tag and the coding sequence for TAp73{alpha} as indicated in the diagram. B, HA-TAp73 or HA-GFP-TAp73 were ectopically expressed in Cos-1 cells. The cells were lysed and immunoblotted with anti-GFP or anti-p73 antibodies to verify the expression levels of the two different constructs. C, the Saos2 osteosarcoma cell line (p53 and p73 null) was transiently transfected with p53-GFP, HA-TAp73, or HA-GFP-TAp73. Two days after transfection, cells were fixed and stained with an anti-HA antibody (red). Nuclei were contrasted with Hoechst. D, Saos2 cells where cotransfected with reporter constructs for p21Cip1 or Bax and with the indicated p53 and p73 constructs. The next day, cells lysates were assayed for their relative luciferase activity expressed as fold activation with the control cells (Vector) arbitrarily set at 100. Results shown represent the average of three independent experiments normalized for transfection efficiency. E, Saos2 cells were transfected with an empty vector or with the indicated concentrations (µg of DNA) of p53-GFP, HA-TAp73, or HA-GFP-TAp73. After 24 h, cells were fixed and nuclei were stained with Hoechst. The percentage of cells with condensed chromatin was scored among the transfected cells.

 
We transfected HA-GFP-TAp73 in five thyroid cancer lines, one negative (TPC-1) and four positive (ONCO-DG-1, BC-PAP, KAT-4, and SW-1736) for p73 expression (Fig. 5Citation C, third panel from top). The same cells were also transfected with an empty vector or with p53-GFP (Fig. 5Citation C, third panel from top). FACS analysis showed that overexpression of HA-GFP-TAp73 in TPC-1 or ONCO-DG-1 cells had marginal effects in terms of cell-cycle distribution (Fig. 5A)Citation . However, in the three other cell lines, high levels of TAp73 induced a significant G1 arrest (Fig. 5A)Citation . These findings were confirmed by an anti-p21Cip1 Western blot, showing an ample range of p21Cip1 induction in ONCO-DG-1, BC-PAP, KAT-4, and SW-1736 cells (Fig. 5CCitation , top panel). In contrast, in TPC-1 cells p21Cip1 levels were not affected by TAp73 overexpression. In all of these cell lines, transient expression of p53-GFP was more potent than TAp73 in blocking the cell cycle in G1 and inducing p21Cip1 (Fig. 5, A and CCitation , top panel).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. p73 activity can be partially restored by overexpression A, TPC-1 (p73-negative), ONCO-DG-1, BC-PAP, KAT-4, and SW-1736 (p73-positive) cells were transfected with an empty vector, HA-GFP-TAp73 or p53-GFP. After transfection, the GFP-positive cells were analyzed by FACS to determine their cell-cycle profile. The bars (G0/G1 {blacksquare}, S {square}, G2/M ) represent average ± SD of three different experiments. Statistically significant variations are indicated with * (*, P < 0.05, **, P < 0.01). B, cell viability of the transfected population was determined as the sub-G1 fraction identifiable by FACS analysis. The bars (empty vector: , HA-GFP-TAp73: {blacksquare}, p53-GFP: {square}) represent average ± SD of three separate experiments. C, TPC-1, ONCO-DG-1, BC-PAP, KAT-4, and SW-1736 were transiently transfected with HA-GFP-TAp73 or p53-GFP, and then analyzed by Western blot for the expression of p21Cip1, Bax, and GFP (to visualize either p73 or p53). An aspecific band can be seen in all conditions in the anti-GFP blot. The actin blot confirms equal protein loading in each lane.

 
It remained to be verified whether high levels of HA-GFP-TAp73 could induce cell death in thyroid cancer cells. Thus, we analyzed the sub-G1 population in the same thyroid cells transiently overexpressing HA-GFP-TAp73. Unlike what we observed for cell cycle progression, high levels of TAp73 produced no significant increase in apoptotic cells within the transfected population (Fig. 5BCitation , black bars). The same was true for cells transfected with p53-GFP (Fig. 5BCitation , white bars). Accordingly, when we performed an immunoblot on the transfected population, we noticed only a minimal increase in the expression levels of Bax (Fig. 5CCitation , second panel from top).

Our findings indicate that TAp73 overexpression can restore the ability of the protein to arrest the cell cycle in G1. However, as had been reported previously for p53 overexpression (33) , high levels of TAp73 do not cause a significant increase in apoptosis.

Mutant p53 and {Delta}Np73 Contribute to TAp73 Inactivation in Thyroid Cancer.
A possible explanation for the lack of TAp73 activity in thyroid cancer could be that TAp73 is inactivated frequently by mutational events. Whereas mutations of TAp73 are extremely infrequent in human neoplasias, such events have been described in tumors of the central nervous system, the lung, and the breast (16) . Sequence analysis of the p73 mRNA isolated from all of the thyroid cancer cells studied failed to identify DNA alterations. Hence, we could exclude that mutations in the p73 sequence might account for its inability to arrest or kill thyroid cancer cells.

Previous reports have demonstrated that both mutant p53 and {Delta}Np73 play a role in the functional inactivation of TAp73 (27 , 31) . Inactivation of p53 is a frequent event in the progression of thyroid cancer to less-differentiated, more invasive phenotypes (11) . Moreover, all of the thyroid cancer cell lines used in our study express mutated p53 (Table 2)Citation . To establish whether nonfunctional p53 is involved in TAp73 inactivation, we immunoprecipitated p53 in KAT-4 and Hth-74 cells, and then probed the blot with an anti-TAp73 antibody. Indeed, TAp73 was found to interact with mutant-p53 (Fig. 6ACitation , top panel). As expected, we did not detect any interaction in TPC-1 and SW-1736 cells, because the former thyroid cancer line is negative for p73, whereas the latter does not express p53 (Fig. 6ACitation , top panel).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 6. Mutant p53 and {Delta}Np73 contribute to the inactivation of TAp73. A, lysates from TPC-1, KAT-4, Hth-74, and SW-1736 were immunoprecipitated with an anti-p53 antibody, and then blotted with an antibody specific for TAp73. Alternatively, cell lysates from the same cell lines were subjected to the reverse experiment, in which immunoprecipitation with an anti-TAp73 antibody was followed by a Western blot with an anti-p53 antibody. TPC-1 (p73-negative) and SW-1736 (p53-negative) cells were used as controls. B, lysates from TPC-1, ARO, KAT-4, and SW-1736 cells were immunoprecipitated with an antibody specific for {Delta}Np73 and then blotted using an antibody that recognizes only TAp73 (clone 429). Reblotting for {Delta}Np73 shows expression of this protein in the three positive cell lines (bottom panel). TPC-1 cells (p73-negative), and Cos-1 cells transiently expressing TAp73{alpha} and {Delta}Np73 are shown as a control.

 
To establish whether {Delta}Np73 is also involved in the functional inactivation of TAp73, we immunoprecipitated lysates from ARO, KAT-4, and SW-1736 cells with an antibody that recognizes only {Delta}Np73. Blotting with an antibody specific for TAp73 revealed that the endogenous {Delta}Np73 interacts with TAp73 (Fig. 6B)Citation . This interaction did not occur in TPC-1 cells that do not express p73 (Fig. 6B)Citation . These results were additionally confirmed by the opposite experiment in which an immunoprecipitation for TAp73 was followed by blotting with an antibody against {Delta}Np73 (data not shown).

Overall, our results confirmed that both mutant p53 and {Delta}Np73 are involved in the functional inactivation of TAp73 in thyroid cancer cells.

Expression of Wild-Type p53 Down-Regulates Endogenous TAp73 in Thyroid Cancer.
Previous evidence suggests that TAp73 is involved in the apoptotic response triggered by p53 (34) . However, in thyroid cancer cell lines that express TAp73, high levels of wild-type p53 lead to G1 arrest but not to cell death (Fig. 5A)Citation . We wanted to investigate whether, in our cell lines, overexpression of wild-type p53 influenced the levels of TAp73. Hence, we performed anti-TAp73 and anti-p53 immunoblots on two clones of ARO cells (AROIF and AROC5) that stably express a temperature-sensitive p53 construct. This naturally occurring p53 mutant is not functional at 37°C but is active at 32°C (33) . Untransfected or mock-transfected ARO cells showed no variations in TAp73 expression at the two different temperatures (Fig. 7Citation A, top panel). To our surprise, activation of p53 led to a significant decrease in TAp73 expression in both AROIF and AROC5 (Fig. 7Citation A, top panel). As expected, p53 expression was not modified by growth at 32°C, because in these cells the lower temperature induces the functional activation but not the expression of the p53 protein (Fig. 7ACitation , second panel). Activation of p53 also caused the induction of p21Cip1 (Fig. 7ACitation , third panel). Notably, the up-regulation of p21Cip1 occurred in conditions in which TAp73 levels were down-regulated.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 7. Expression of wild-type p53 in thyroid cancer cell lines down-regulates TAp73 A, Two clones (AROIF and AROC5) of ARO cells stably transfected with a temperature-sensitive wild-type p53 construct (active at 32°C) were lysed and immunoblotted with antibodies against TAp73, p53, and p21Cip1. Untransfected (ARO) or mock-transfected (ARO Neo) cells were used as a control. The anti-actin immunoblot confirms equal protein loading in all of the lanes. B, ARO Neo (control) and AROC5 cells grown at 37°C or at 32°C were lysed at the indicated time points and immunoblotted with an anti-p73 or an anti-p21Cip1 antibody. Where indicated, the proteasome inhibitor MG132 was added to the cells 12 h before they were collected. An actin reblotting shows equal protein loading in each condition. C, SW-1736 cells were transiently transfected with H2B-GFP or p53-GFP and then stained with an antibody against TAp73 (red) and with Hoechst to visualize the nuclei (blue). The bar graph represents the quantification of the TAp73-positive cells in the transfected population (300 cells were counted for each condition).

 
To investigate additionally the dynamics of the down-regulation of TAp73 in response to the expression of wild-type p53 we performed a time course experiment on ARO Neo and AROC5 cells grown at the permissive temperature for 1–4 days. A TAp73 immunoblot performed on the control ARO Neo cells showed no modifications in the expression of TAp73 (Fig. 7B)Citation . On the contrary, in AROC5 p73 levels began to decrease 24 h after the conformational activation of p53, and after 3 days p73 expression was virtually lost (Fig. 7B)Citation . Interestingly, the down-regulation of TAp73 was blocked when AROC5 cells were treated with the proteasome inhibitor MG132 (Fig. 7B)Citation . An anti-p21Cip1 immunoblot confirmed that p53 transcriptional activity was fully restored after 48 h of culture at 32°C (Fig. 7Citation B, right panel). To gain additional insight on this unexpected result we transiently expressed p53-GFP in SW-1736 cells that present undetectable levels of endogenous p53. After transfection, the cells were analyzed by immunofluorescence for TAp73 expression. In most of the transfected cells we could not detect the TAp73 protein, indicating that expression of wild-type p53 led to a down-regulation of TAp73 (Fig. 7C)Citation . This observation was strengthened by the assessment of the percentage of p53-transfected cells that were also positive for TAp73. Only 21% of SW-1736 cells that expressed p53-GFP maintained visible expression of TAp73, as compared with 71% of the cells in which we overexpressed the unrelated H2B-GFP construct (Fig. 7Citation C, right panel).

Our observations suggest that, in thyroid cancer cells, the expression levels of wild-type p53 and TAp73 are interdependent and possibly mutually regulated.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study we report that the p73 protein is not expressed in normal human thyrocites but is present in several histotypes of epithelial thyroid cancer. This observation is unexpected, because p73 is a member of the p53 family and exerts growth-inhibitory and apoptotic functions. Our results are even more puzzling considering that, in thyroid cancer cell lines exposed to DNA damage, TAp73 does not arrest the cell cycle nor does it induce cell death. These findings lead to ask why the TAp73 protein of thyroid cancer cells fails to exercise its tumor-suppressor functions.

Many different mechanisms could explain our observations. First of all, it is interesting to note that in thyroid cancer cells, TAp73 is unresponsive to doxorubicin, because exposure to the drug leads to a marginal increase in protein expression. We are still uncertain if this lack of TAp73 induction is because of a dysfunctional promoter or to a decreased half-life of the protein. In any case, this phenomenon is not specific for doxorubicin because many other DNA-damaging agents fail to induce TAp73 expression in our panel of thyroid cancer lines.5 Moreover, the fact that overexpression can only partially rescue TAp73 tumor-suppressor activity suggests that, in addition to defects upstream of TAp73 activation, signaling downstream of TAp73 could be compromised as well. Hence, thyroid cancer cells appear to select multiple roadblocks to interfere both with the activation and the downstream signaling of TAp73.

We report elsewhere that one such block is represented by a strong reduction in the nuclear import of the ABL tyrosine kinase (35) . Here we describe two additional mechanisms involved in the inactivation of TAp73 in thyroid cancer cells. The first concerns the p53 tumor suppressor protein. Previous studies have demonstrated that mutant p53 can interact with TAp73 via its core domain (36) . The formation of heterotetramers composed of mutated p53 and wild-type TAp73 results in the functional inactivation of the latter (30 , 31) . All of the thyroid cancer cells included in our study express a nonfunctional p53 protein (Table 2)Citation . In several of them we have found mutant p53 to interact with TAp73.

A second mechanism that interferes with TAp73 activity in thyroid cancer involves {Delta}Np73. {Delta}Np73 is a dominant-negative form of p73 that can abrogate the activity of TAp73 (16) . In our study we have found that thyroid cancer cell lines that express TAp73 also express {Delta}Np73. Immunoprecipitation studies documented a direct interaction between TAp73 and {Delta}Np73. These results strongly suggest that {Delta}Np73 may also play a major role in the functional inactivation of TAp73.

An issue that is still unresolved concerns the biological role of p73 in the malignant thyroid epithelium. In our study we identified p73 in a wide panel of thyroid cancer cell lines and in all of the primary specimens isolated from thyroid cancer. On the contrary, the normal thyroid did not express p73. Thus the question lingers: why do thyroid cancer cells express p73? Whereas it is true that all tumor cells are able to survive by dodging the many death signals that surround them (37) , it seems unlikely that in thyroid cancer p73 expression is a remnant of an apoptotic pathway that the cells have successfully inactivated. Previous reports suggest that, in ovarian cancer, p73 expression reduces p53 transcriptional activity (38 , 39) . More recently, Freebern et al. (40) have reported that in a leukemia cell line, TAp73, acts as a transcriptional repressor, blocking p53-mediated cell death. Therefore, it is possible that p73 expression could confer some kind of selective advantage to thyroid cancer cells. Indeed, in our cancer lines, overexpression of wild-type p53 causes a strong down-regulation of TAp73 expression. This down-regulation is due to an increased degradation of the protein, because treatment with a proteasome inhibitor can restore normal levels of TAp73. It remains to be seen whether the down-regulation of TAp73 after ectopic expression of wild-type p53 is because of p53 itself, or represents an adaptation response of the neoplastic cells to avoid a synergic effect between p53 and TAp73.

An additional level of complexity is represented by the expression of {Delta}Np73 regardless of the histotype or the differentiation status of thyroid neoplasias. Wild-type p53 and TAp73 have both been identified as targets of {Delta}Np73 biological activity. Differentiated thyroid carcinomas usually display wild-type p53. Hence, it is possible that in these tumors {Delta}Np73 disrupts p53 activity. On the other hand, undifferentiated thyroid cancers are often characterized by the inactivation of both p53 alleles. It remains to be determined whether, in this aggressive form of thyroid carcinoma, TAp73 is the only target of {Delta}Np73.

In summary, whereas it seems clear that p73 expression is a marker of neoplastic thyroid cells, the biological function and the molecular interplay of the various p73 isoforms in thyroid cancer remain partially unresolved. The clarification of these complex issues awaits additional investigation.


    ACKNOWLEDGMENTS
 
We thank Dr. Pietro Gangemi (Department of Pathology, Ospedale Vittorio Emanuele, Catania, Italy) for review of thyroid cancer slides.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a grant from AIRC (Associazione Italiana per la Ricerca sul Cancro) to R. V. F. F. is a fellow of the AICF (American Italian Cancer Foundation), whereas both V. V. and A. A. are supported by a fellowship from AIRC. P. V. is a fellow of the LRF (Leukemia Research Foundation). Back

2 These authors equally contributed to this work. Back

3 To whom requests for reprints should be addressed at Dipartimento di Medicina Interna e di Medicina Specialistica – Endocrinologia, Ospedale Garibaldi, Piazza Santa Maria di Gesù, 1 95123 Catania, Italy. Phone: 39-095-326290; Fax: 39-095-7158072; E-mail: vigneri{at}unict.it Back

4 The abbreviations used are: TAp73, transcriptionally active p73; {Delta}Np73, p73 isoforms lacking the NH2-terminus (first three exons); {Delta}TAp73, p73 isoforms lacking a functional transactivation domain; GFP, green fluorescent protein; PI, propidium iodide; FBS, fetal bovine serum; RT-PCR, reverse transcription-PCR; FACS, fluorescence-activated cell sorter; HA, hemagglutinin. Back

5 Frasca and Vigneri, unpublished observations. Back

Received 2/10/03. Revised 6/19/03. Accepted 7/10/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fagin J. A. Minireview: branded from the start-distinct oncogenic initiating events may determine tumor fate in the thyroid. Mol. Endocrinol., 16: 903-911, 2002.[Abstract/Free Full Text]
  2. Giuffrida D., Gharib H. Anaplastic thyroid carcinoma: current diagnosis and treatment. Ann. Oncol., 11: 1083-1089, 2000.[Abstract/Free Full Text]
  3. Fagin J. A. Perspective: lessons learned from molecular genetic studies of thyroid cancer–insights into pathogenesis and tumor-specific therapeutic targets. Endocrinology, 143: 2025-2028, 2002.[Free Full Text]
  4. Vini L., Harmer C. Management of thyroid cancer. Lancet Oncol., 3: 407-414, 2002.[Medline]
  5. Gimm O. Thyroid cancer. Cancer Lett., 163: 143-156, 2001.[Medline]
  6. Pierotti M. A., Bongarzone I., Borello M. G., Greco A., Pilotti S., Sozzi G. Cytogenetics and molecular genetics of carcinomas arising from thyroid epithelial follicular cells. Genes Chromosomes Cancer, 16: 1-14, 1996.[Medline]
  7. Pierotti M. A. Chromosomal rearrangements in thyroid carcinomas: a recombination or death dilemma. Cancer Lett., 166: 1-7, 2001.[Medline]
  8. Vecchio G., Santoro M. Oncogenes and thyroid cancer. Clin. Chem. Lab. Med., 38: 113-116, 2000.[Medline]
  9. Kroll T. G., Sarraf P., Pecciarini L., Chen C. J., Mueller E., Spiegelman B. M., Fletcher J. A. PAX8-PPAR{gamma}1 fusion oncogene in human thyroid carcinoma. Science (Wash. DC), 289: 1357-1360, 2000.[Abstract/Free Full Text]
  10. McIver B., Hay I. D., Giuffrida D. F., Dvorak C. E., Grant C. S., Thompson G. B., van Heerden J. A., Goellner J. R. Anaplastic thyroid carcinoma: a 50-year experience at a single institution. Surgery (St. Louis), 130: 1028-1034, 2001.
  11. Fagin J. A., Matsuo K., Karmakar A., Chen D. L., Tang S. H., Koeffler H. P. High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. J. Clin. Investig., 91: 179-184, 1993.
  12. Oren M. Lonely no more: p53 finds its kin in a tumor suppressor haven. Cell, 90: 829-832, 1997.[Medline]
  13. Kaghad M., Bonnet H., Yang A., Creancier L., Biscan J. C., Valent A., Minty A., Chalon P., Lelias J. M., Dumont X., Ferrara P., McKeon F., Caput D. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell, 90: 809-819, 1997.[Medline]
  14. Irwin M. S., Kaelin W. G. p53 family update: p73 and p63 develop their own identities. Cell Growth Differ., 12: 337-349, 2001.[Free Full Text]
  15. Jost C. A., Marin M. C., Kaelin W. G., Jr. p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature (Lond.), 389: 191-194, 1997.[Medline]
  16. Melino G., De Laurenzi V., Vousden K. H. p73: Friend or foe in tumorigenesis. Nat. Rev. Cancer, 2: 605-615, 2002.[Medline]
  17. Stiewe T., Putzer B. M. Role of p73 in malignancy: tumor suppressor or oncogene?. Cell Death Differ., 9: 237-245, 2002.[Medline]
  18. Ng S. W., Yiu G. K., Liu Y., Huang L. W., Palnati M., Jun S. H., Berkowitz R. S., Mok S. C. Analysis of p73 in human borderline and invasive ovarian tumor. Oncogene, 19: 1885-1890, 2000.[Medline]
  19. Fillippovich I., Sorokina N., Gatei M., Haupt Y., Hobson K., Moallem E., Spring K., Mould M., McGuckin M. A., Lavin M. F., Khanna K. K. Transactivation-deficient p73{alpha} (p73{delta}exon2) inhibits apoptosis and competes with p53. Oncogene, 20: 514-522, 2001.[Medline]
  20. Stiewe T., Theseling C. C., Putzer B. M. Transactivation-deficient {delta} TA-p73 inhibits p53 by direct competition for DNA binding: implications for tumorigenesis. J. Biol. Chem., 277: 14177-14185, 2002.[Abstract/Free Full Text]
  21. Levrero M., De Laurenzi V., Costanzo A., Gong J., Melino G., Wang J. Y. Structure, function and regulation of p63 and p73. Cell Death Differ., 6: 1146-1153, 1999.[Medline]
  22. Levrero M., De Laurenzi V., Costanzo A., Gong J., Wang J. Y., Melino G. The p53/p63/p73 family of transcription factors: overlapping and distinct functions. J. Cell Sci., 113(Pt10): 1661-1670, 2000.[Abstract]
  23. Stiewe T., Zimmermann S., Frilling A., Esche H., Putzer B. M. Transactivation-deficient {delta}TA-p73 acts as an oncogene. Cancer Res., 62: 3598-3602, 2002.[Abstract/Free Full Text]
  24. De Laurenzi V., Costanzo A., Barcaroli D., Terrinoni A., Falco M., Annicchiarico-Petruzzelli M., Levrero M., Melino G. Two new p73 splice variants, {gamma} and {delta}, with different transcriptional activity. J. Exp. Med., 188: 1763-1768, 1998.[Abstract/Free Full Text]
  25. De Laurenzi V. D., Catani M. V., Terrinoni A., Corazzari M., Melino G., Costanzo A., Levrero M., Knight R. A. Additional complexity in p73: induction by mitogens in lymphoid cells and identification of two new splicing variants epsilon and zeta. Cell Death Differ., 6: 389-390, 1999.[Medline]
  26. Ueda Y., Hijikata M., Takagi S., Chiba T., Shimotohno K. New p73 variants with altered C-terminal structures have varied transcriptional activities. Oncogene, 18: 4993-4998, 1999.[Medline]
  27. Grob T. J., Novak U., Maisse C., Barcaroli D., Luthi A. U., Pirnia F., Hugli B., Graber H. U., De Laurenzi V., Fey M. F., Melino G., Tobler A. Human {delta} Np73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ., 8: 1213-1223, 2001.[Medline]
  28. Ishimoto O., Kawahara C., Enjo K., Obinata M., Nukiwa T., Ikawa S. Possible oncogenic potential of {delta}Np73: a newly identified isoform of human p73. Cancer Res., 62: 636-641, 2002.[Abstract/Free Full Text]
  29. Zhu J., Jiang J., Zhou W., Chen X. The potential tumor suppressor p73 differentially regulates cellular p53 target genes. Cancer Res., 58: 5061-5065, 1998.[Abstract/Free Full Text]
  30. Strano S., Munarriz E., Rossi M., Cristofanelli B., Shaul Y., Castagnoli L., Levine A. J., Sacchi A., Cesareni G., Oren M., Blandino G. Physical and functional interaction between p53 mutants and different isoforms of p73. J. Biol. Chem., 275: 29503-29512, 2000.[Abstract/Free Full Text]
  31. Marin M. C., Jost C. A., Brooks L. A., Irwin M. S., O’Nions J., Tidy J. A., James N., McGregor J. M., Harwood C. A., Yulug I. G., Vousden K. H., Allday M. J., Gusterson B., Ikawa S., Hinds P. W., Crook T., Kaelin W. G., Jr. A common polymorphism acts as an intragenic modifier of mutant p53 behaviour. Nat. Genet., 25: 47-54, 2000.[Medline]
  32. White E., Prives C. DNA damage enables p73. Nature, 399: 734-735, 737, 1999.[Medline]
  33. Moretti F., Farsetti A., Soddu S., Misiti S., Crescenzi M., Filetti S., Andreoli M., Sacchi A., Pontecorvi A. p53 re-expression inhibits proliferation and restores differentiation of human thyroid anaplastic carcinoma cells. Oncogene, 14: 729-740, 1997.[Medline]
  34. Flores E. R., Tsai K. Y., Crowley D., Sengupta S., Yang A., McKeon F., Jacks T. p63 and p73 are required for p53-dependent apoptosis in response to DNA damage. Nature (Lond.), 416: 560-564, 2002.[Medline]
  35. Vella V., Zhu J., Frasca F., Li C. Y., Vigneri P., Vigneri R., Wang J. Exclusion of c-Abl from the nucleus restrains the p73 tumor suppression function. J. Biol. Chem., 278: 25151-25157, 2003.[Abstract/Free Full Text]
  36. Gaiddon C., Lokshin M., Ahn J., Zhang T., Prives C. A subset of tumor-derived mutant forms of p53 down-regulate p63 and p73 through a direct interaction with the p53 core domain. Mol. Cell Biol., 21: 1874-1887, 2001.[Abstract/Free Full Text]
  37. Vousden K. H., Lu X. Live or let die: the cell’s response to p53. Nat. Rev. Cancer, 2: 594-604, 2002.[Medline]
  38. Vikhanskaya F., D’Incalci M., Broggini M. p73 competes with p53 and attenuates its response in a human ovarian cancer cell line. Nucleic Acids Res., 28: 513-519, 2000.[Abstract/Free Full Text]
  39. Vikhanskaya F., Marchini S., Marabese M., Galliera E., Broggini M. P73a overexpression is associated with resistance to treatment with DNA-damaging agents in a human ovarian cancer cell line. Cancer Res., 61: 935-938, 2001.[Abstract/Free Full Text]
  40. Freebern W. J., Smith J. L., Chaudhry S. S., Haggerty C. M., Gardner K. Novel cell specific and dominant negative anti-apoptotic roles of p73 in transformed leukemia cells. J. Biol. Chem., : 2002.
  41. Park D. J., Nakamura H., Chumakov A. M., Said J. W., Miller C. W., Chen D. L., Koeffler H. P. Transactivational and DNA binding abilities of endogenous p53 in p53 mutant cell lines. Oncogene, 9: 1899-1906, 1994.[Medline]
  42. Wright P. A., Lemoine N. R., Goretzki P. E., Wyllie F. S., Bond J., Hughes C., Roher H. D., Williams E. D., Wynford-Thomas D. Mutation of the p53 gene in a differentiated human thyroid carcinoma cell line, but not in primary thyroid tumours. Oncogene, 6: 1693-1697, 1991.[Medline]
  43. Simon D., Goretzki P. E., Gorelev V., Ebling B., Reishaus E., Lyons J., Haubruck H., Roher H. D. Significance of P53 in human thyroid tumors. World J. Surg., 18: 535-540, discussion 540–531 1994.[Medline]
  44. Blagosklonny M. V., Giannakakou P., Wojtowicz M., Romanova L. Y., Ain K. B., Bates S. E., Fojo T. Effects of p53-expressing adenovirus on the chemosensitivity and differentiation of anaplastic thyroid cancer cells. J. Clin. Endocrinol. Metab., 83: 2516-2522, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
R. Malaguarnera, V. Vella, G. Pandini, M. Sanfilippo, V. Pezzino, R. Vigneri, and F. Frasca
TAp73{alpha} Increases p53 Tumor Suppressor Activity in Thyroid Cancer Cells via the Inhibition of Mdm2-Mediated Degradation
Mol. Cancer Res., January 1, 2008; 6(1): 64 - 77.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Johnson, J. Lagowski, A. Sundberg, S. Lawson, Y. Liu, and M. Kulesz-Martin
p73 Loss Triggers Conversion to Squamous Cell Carcinoma Reversible upon Reconstitution with TAp73{alpha}
Cancer Res., August 15, 2007; 67(16): 7723 - 7730.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. Bozzetti, R. Nizzoli, A. Musolino, E. M. Martella, P. Crafa, C. A. Lagrasta, R. Camisa, A. Bonati, P. Lunghi, and A. Ardizzoni
p73 and p53 Pathway in Human Breast Cancers
J. Clin. Oncol., April 10, 2007; 25(11): 1451 - 1453.
[Full Text] [PDF]


Home page
JCOHome page
G. Dominguez and F. Bonilla
In Reply
J. Clin. Oncol., April 10, 2007; 25(11): 1453 - 1454.
[Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R Malaguarnera, V Vella, R Vigneri, and F Frasca
p53 family proteins in thyroid cancer
Endocr. Relat. Cancer, March 1, 2007; 14(1): 43 - 60.