
[Cancer Research 63, 6004-6007, September 15, 2003]
© 2003 American Association for Cancer Research
Identification and Functional Analysis of Single Nucleotide Polymorphism in the Tandem Repeat Sequence of Thymidylate Synthase Gene1
Kazuyuki Kawakami2 and
Go Watanabe
Department of Surgery, Kanazawa University School of Medicine, Kanazawa 920-8641, Japan
 |
ABSTRACT
|
|---|
The variable number of tandem repeat (VNTR) of thymidylate synthase (TS) gene, mainly 2 repeat (2R) and 3 repeat (3R), is one of the genetic variations that can potentially predict the effectiveness of 5-fluorouracil-based chemotherapy. In this study we identified an additional single nucleotide polymorphism (SNP) in the VNTR of TS, followed by functional and clinical analysis of the SNP. Two-hundred fifty eight tumor samples were obtained from patients with primary colorectal adenocarcinoma. We observed three different patterns of electrophoresis by analysis of the VNTR with 2R/3R heterozygote. The sequencing results revealed a SNP, G/C polymorphism, within the 28-bp repeat component of TS VNTR. Each polymorphic allele was assigned as 2G, 2C, 3G, or 3C according to the combination of SNP and VNTR. Functional analysis showed that the plasmid construct with 3G sequence had three to four times greater efficiency of translation than other polymorphic sequences. 3R allele in colorectal cancer was subdivided into around half by the SNP, indicating its commonness among Japanese. TS genotypes of the patients with colorectal cancer were classified into high expression type (2R/3G, 3C/3G, and 3G/3G) and low expression type (2R/2R, 2R/3C, and 3C/3C). The patients who received oral fluoropyrimedines survived longer than the patients with no treatment in the group of low expression type. No benefit of oral fluoropyrimedines was observed in the group of high expression type. These results suggest that the double polymorphism in the TS tandem repeat sequence, the SNP and the VNTR, may provide a potential for more effective prediction of the clinical outcome of 5-fluorouracil-based chemotherapy.
 |
INTRODUCTION
|
|---|
Recent advances in understanding of the genetic variations that influence drug metabolism, toxicity, and effectiveness are about to be introduced in cancer chemotherapy (1)
. Tailored chemotherapy based on such genetic variations has a great potential to improve cancer treatment. Polymorphism in the tandem repeat sequence of the TS3
gene is one of the genetic variations that can potentially predict the effectiveness of 5-FU. TS catalyzes the reductive methylation of dUMP by 5,10-methylenetetrahydrofolate to form dTMP, which is a critical reaction for cell proliferation. Accordingly, TS has been an important target of anticancer drugs including 5-FU, Raltitrexed, Pemetrexed, Nolatrexed, and other agents under development (2
, 3)
. The TS gene contains VNTR, mainly 2R and 3R, in its 5'-UTR and this polymorphism is associated with TS expression (4
, 5)
. Several clinical studies have shown the relationship between TS VNTR genotype and the effectiveness of 5-FU-based chemotherapy, although the studies had relatively small numbers of subjects, and validation by a larger-scale clinical study is needed (6, 7, 8, 9)
.
We have reported that the TS VNTR is related with TS protein expression (5)
through affecting translational activity of TS mRNA (10)
, and TS alleles show frequent loss of heterozygosity (11)
. During the analysis of TS VNTR in which a heteroduplex product between 2R- and 3R-derived PCR product was separated by high-resolution gel, we observed different electrophoresis patterns of the heteroduplex. This observation strongly suggested the presence of an additional polymorphism in the area of TS VNTR. In this study we identified a novel SNP in the VNTR sequence of the TS, followed by functional analysis of the SNP. In addition, the clinical significance of comprehensive genotype of the VNTR and the SNP was additionally investigated.
 |
MATERIALS AND METHODS
|
|---|
Patients and DNA Isolation.
A total of 258 tumor samples were obtained by surgical resection from 258 patients with primary colorectal adenocarcinoma. The patients were all Japanese, and comprised 153 males and 105 females, ranging in age from 33 to 93 years, with a mean age of 66.2 years. Approximately 2 g of the surgically removed tissues were frozen immediately in liquid nitrogen and stored at -80°C until DNA isolation. Genomic DNA was isolated either by the standard method of proteinase K digestion and phenol-chlorophorm extraction or by a QIAamp DNA Mini kit (Qiagen, Hilden, Germany) following the protocol provided by the manufacturer. The remaining section of the sample was fixed with formalin and used for additional histological examination to confirm the diagnosis. All of the histological examinations were performed after staining with H&E. Approval for this project was obtained from the Kanazawa University School of Medicine Ethics Committee.
PCR and Heteroduplex Analysis.
PCR with the template of genomic DNA was performed for TS genotyping of VNTR under the conditions described previously (5)
. The amplified DNA fragments were analyzed by electrophoresis on a 4% agarose gel followed by staining with ethidium bromide. For heteroduplex analysis, PCR was performed using a primer labeled with fluorescein 5'-isothiocyanate and analyzed by Spreadex gel (Elchrom Scientific, Cham, Switzerland) as described previously (11)
.
Cloning and Sequencing of PCR Product.
To determine the sequence of PCR products, the fragments were subcloned using the pGEM-T Vector System (Promega, Madison, WI). Subsequently the cloned PCR products were sequenced with a Thermo Sequenase Cy5.5 Terminator Sequencing kit (Amersham-Pharmacia, Piscataway, NJ).
Plasmid Construct.
Plasmid constructs of Firefly luciferase reporter gene fused downstream to TS 5'-UTR were created by the methods described previously (10)
. Briefly, the TS 5'-UTR sequence was obtained by PCR using forward primer TS33 GCCTCGAGCGGGACGGCCGCGGGAAAA and reverse primer TS28 TCCGAGCCGGCCACAGCCAT. The 5'-UTR sequence was inserted into the pGL3-Basic Vector (Promega), followed by additional insertion into pCI (Promega) for constitutional expression in transfected cells.
Luciferase Assay and RNA Protection Assay.
HeLa cell was obtained from Health Science Research Resources Bank (Osaka, Japan). Transfection of plasmids into HeLa cell followed by luciferase assay and RNA protection assay was performed by the methods described previously (10)
. Briefly, each plasmid was transfected into HeLa cells in conjunction with control plasmid pRL-CMV (Promega). The cells were harvested after 60 h and separated into two batches. One batch was used for cell lysis and the other for RNA isolation. Cells were lysed, and luciferase activity was measured by the Dual-Luciferase assay system (Promega). RNA was isolated by the single-step guanidinium isothiocyanate method and subjected to the RNase protection assay. Translational activity of the construct was assessed by Firefly luciferase activity divided by the quantity of Firefly luciferase RNA, and assay results were normalized by the activity or RNA content of the control, Renilla luciferase.
PCR-RFLP Analysis.
PCR was performed using forward primer TS25 AGGCGCGCGGAAGGGGTCCT and reverse primer TS18 TCCGAGCCGGCCACAGGCAT. The PCR conditions were the same as those for TS VNTR. The PCR product was digested with HaeIII followed by electrophoresis in 4% agarose gel and ethidium bromide stain. Analysis was performed at least twice to confirm the genotype.
Statistical Analysis.
The relationships between TS genotype and clinicopathological variables were analyzed by
2 analysis or ANOVA. The cumulative survival rate was obtained by the Kaplan-Meier method, and statistical significance was analyzed by the log-rank test. P < 0.05 was considered to indicate significance.
 |
RESULTS
|
|---|
Identification of a SNP in TS VNTR.
In a previous report, we identified heteroduplex formation between 2R- and 3R-derived PCR products of TS VNTR (11)
. The heteroduplex products showed three different electrophoresis patterns (types A, B, and C) with the high separation gel, Spreadex (Fig. 1)
. This observation strongly suggested the presence of a new polymorphism in the area of the TS VNTR. Therefore, we cloned and sequenced the PCR products that showed different patterns of electrophoresis. The sequence results revealed a SNP, G/C polymorphism, within the 28-bp repeat component of TS VNTR (Fig. 2)
. We assigned each polymorphic allele as 2G, 2C, 3G, and 3C according to the combination of SNP and VNTR. Types A, B, and C of the electrophoresis pattern in heteroduplex analysis reflected the genotypes of 2G/3G, 2C/3C, and 2C/3G, respectively. The 2C and 3G alleles have been identified as wild-type.

View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Polymorphic electrophoresis pattern of heteroduplex product in Spreadex gel. PCR product from a sample of 2R/3R genotype forms a heteroduplex that appears in the electrophoresis at positions of longer than 3R band. The heteroduplex product showed 3 different electrophoresis patterns: Lanes 1 and 2, close to 3R band (type A); Lanes 5 and 6, distant from 3R band (type C); Lanes 3 and 4, the middle of type A and C (type B).
|
|

View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. SNP in the VNTR of TS. A, SNP, G/C polymorphism marked by *, was identified in the 28-bp repeat component of TS VNTR. The last nucleotide, guanine, indicated by a box in the repeat component was substituted with cytidine only if the component was closest to the ATG start codon. B, the series of boxes indicates the combination of the 28-bp repeat components in the VNTR sequence. Closed box is translated region. Four different patterns according to SNP and VNTR was identified and assigned to 2G, 2C, 3G, and 3C.
|
|
In Vitro Functional Analysis of SNP and VNTR of TS.
We created a plasmid construct in which TS 5'-UTR of 2G, 2C, 3G, or 3C were fused upstream to firefly luciferase gene to assess the functional difference among the polymorphic sequences. The plasmids were transfected into HeLa cell and constitutively expressed by cytomegalovirus promoter. Translational efficiency of the constructs was identical among 2G, 2C, and 3C. However, the 3G sequence showed three to four times greater efficiency of translation than the other sequences (Fig. 3)
. These results suggest that the SNP affects translatability of TS mRNA, leading to functional subgroups in the 3R allele of TS VNTR.

View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Reporter assay using TS 5'-UTR-luciferase fusion constructs. Sequence structures of constructs are displayed at left. Open arrow with cytomegalovirus indicates cytomegalovirus promoter sequence. Open bar with 2G, 2C, 3G, or 3C indicates the TS 5'-UTR with each polymorphic sequence, respectively. Firefly luciferase activity of each construct, which was normalized by RNA quantity determined by RNase protection assay, is shown on the right. The ratio between luciferase activity and RNA content, which is expressed as Luc/RNA in the figure, indicates the translational efficiency. The translational efficiency of the construct with 3G sequence was three to four times higher than those of the other constructs. The results are based on four independent experiments and the value of the construct with 2G sequence was set as one in each experiment.
|
|
Frequency of SNP and VNTR of TS in Colorectal Cancer.
For better understanding of the clinical significance of the SNP, we analyzed the frequency of comprehensive genotypes of SNP and VNTR of TS in colorectal cancer. The PCR-RFLP method was developed for typing of the SNP in the TS 3R sequence (Fig. 4)
. SNP typing was not performed for 2R allele, because there was no functional difference between 2G and 2C sequences. TS genotypes including repeat numbers of >3 were excluded for the SNP typing because of their infrequency. The allele type of TS tandem repeat sequence was classified into 2R, 3G, and 3C according to the result of PCR-RFLP analysis. The allele frequency is summarized in Table 1
. 3R sequence in the VNTR was subdivided into around half by the SNP, indicating its commonness among Japanese. The allele of 3G was significantly less frequent in females than in male when considering the 3R allele. In addition, the genotype of 3G/3G was significantly less frequent in females when 174 cases of 3R/3R genotype were considered for the analysis (Table 2)
. There was no significant association of other clinicopathological features including patient age, histological type, and clinical stage with allele or genotype frequency (data not shown).

View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. PCR-RFLP analysis. The PCR product was electrophoresed before HaeIII digestion and the TS VNTR genotype was determined (top panel). TS VNTR genotype is indicated above the panel. The PCR product was additionally digested by HaeIII only if the genotype was 3R/3R or 2R/3R to determine the SNP type of 3R allele (bottom panel). HaeIII digestion produced 66-, 37-, 28-, and 10-bp bands for the 3G allele and 94-, 37-, and 10-bp bands for the 3C allele. Comprehensive genotype of TS is indicated under the panel.
|
|
Comprehensive Genotype of TS Predicts the Benefit from Oral FP in Patients with Colorectal Cancer.
To assess the clinical role of the SNP we compared the survival of the patients who received postoperative oral FP to those with no adjuvant treatment under stratification of the patients by TS genotype. Survival analysis was performed with 111 patients who were in Dukes stage B or C, underwent curative surgery, and were available with postoperative clinical information including adjuvant treatment and long-term follow-up. The patients whose TS genotypes contained repeat number of >3 were excluded from the analysis. 5-FU, UFT (a combination of Tegafur and Uracil), Doxifluridine, or Carmofur were administered postoperatively to 9, 36, 9, and 10 patients, respectively. The other 47 patients received no adjuvant treatment. The median duration of administration was 99 weeks (range, approximately 13200), and the median follow-up time was 59 months (range, approximately 11158). The survival rate of the patients with postoperative oral FP was marginally better than that of the patients with no adjuvant treatment when all of the patients were analyzed (P = 0.052; Fig. 5A
). The TS allele of 3G was considered a high expression allele and 2R or 3C as low expression alleles according to the in vitro functional analysis. On the basis of this consideration, TS genotypes of 2R/3G, 3C/3G, or 3G/3G were considered high expression (H) type and 2R/2R, 2R/3C or 3C/3C low expression (L) type. In the L-type group, patients who received oral FP survived longer than the patients with no adjuvant treatment (Fig. 5B)
. On the other hand, oral FP had no significant effect on the survival rate of the patients in the H-type group (Fig. 5C)
. The survival benefit from oral FP was not clear when the patients were stratified by TS VNTR only (data not shown).

View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Survival analysis of the patients with curatively resected colorectal cancer. The cumulative survival rate was compared between the patients with postoperative oral FP and those with no adjuvant treatment (A), L-type group (B), and H-type group of TS genotype (C). TS genotypes of 2R/2R, 2R/3C, or 3C/3C were classified as L-type group and 2R/3G, 3G/3C, or 3G/3G as H-type group.
|
|
 |
DISCUSSION
|
|---|
In this study we identified a functional SNP in the VNTR of TS. TS VNTR has been considered a novel predictor of clinical outcome of 5-FU-based chemotherapy. Recent clinical studies have demonstrated that the patients with 3R/3R homozygote obtain less benefit from 5-FU-based chemotherapy compared with patients who possess 2R allele (6, 7, 8, 9)
. In contrast, one study reported no association between type of TS VNTR and effectiveness of fluorouracil and folinic acid (12)
. These controversial results might be partly attributable to the SNP in the 3R allele because the SNP arises a functionally different subgroup in the 3R allele. A double polymorphism in the TS tandem repeat sequence, SNP and VNTR, may provide a potentially more effective prediction of the clinical outcome with 5-FU-based chemotherapy. The role of this double polymorphism in the TS gene should be validated by a well-controlled large-scale clinical study. Although the number of subjects was small and the results were preliminary, we observed a significant role of the TS double polymorphism for prediction of clinical outcome with oral FP in the current study. Interestingly, TS VNTR polymorphism itself was insufficient for the prediction. The results support the notion that both SNP and VNTR of TS should be considered to use the genotype information of TS for tailored chemotherapy.
In this study, the 3G allele in TS double polymorphism was less frequent in Japanese females with colorectal cancer. This result is intriguing because a previous report demonstrated gender difference in the benefit from 5-FU-based adjuvant chemotherapy among colorectal cancer patients (13)
. One interesting explanation arose from the associations among TS double polymorphism, efficacy with 5-FU-based chemotherapy, and patient gender. That is, the TS 3G allele is less frequent in females and may be related with poor response to 5-FU-based chemotherapy, resulting in a better response to the chemotherapy in females than in males. Although this notion is very interesting, other factor(s) may be responsible for the association of gender with the efficacy of 5-FU-based chemotherapy. Therefore, the relationship between TS 3G allele and the efficacy of 5-FU may simply be a coincidence arising from the gender difference in the allele distribution. In addition, it is necessary to analyze the frequency of TS double polymorphism with other ethnic populations, because a gender difference in the benefit from chemotherapy was demonstrated in Caucasians and the TS VNTR is known to have considerable ethnic variation (14)
. Recent studies suggest that genetic and epigenetic differences of colorectal cancer exist between males and females (15, 16, 17, 18)
. Elucidation of the involvement of TS genotype in the gender difference may be interesting and important aims for additional study.
In conclusion, we identified a functional SNP in the area of TS VNTR and presented the double polymorphism as a potential predictor of the efficacy with 5-FU-based chemotherapy. Pharmacogenomics is of clinical importance and can improve the effectiveness of antineoplastic agents for cancer treatment. Additional studies both on the bench and at bedside are needed to clarify the role of the TS double polymorphism in cancer treatment.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by the grant provided by the Ichiro Kanehara Foundation. 
2 To whom requests for reprints should be addressed, at Department of Surgery, Kanazawa University School of Medicine, Takaramachi 13-1, Kanazawa 920-8641, Japan. Phone: 81-76-265-2357; Fax: 81-76-222-6833; E-mail: kawakami{at}med.kanazawa-u.ac.jp 
3 The abbreviations used are: TS, thymidylate synthase; 5-FU, 5-fluorouracil; VNTR, variable number of tandem repeat; 2R, 2 repeat; 3R, 3 repeat; 5'-UTR, 5' untranslated region; SNP, single nucleotide polymorphism; RFLP, restriction fragment length polymorphism; FP, fluoropyrimidine. 
Received 3/12/03.
Accepted 4/23/03.
 |
REFERENCES
|
|---|
- Nagasubramanian R., Innocenti F., Ratain M. J. Pharmacogenetics in cancer treatment. Annu. Rev. Med., 54: 437-452, 2003.[Medline]
- Danenberg P. V. Thymidylate synthetase - a target enzyme in cancer chemotherapy. Biochim. Biophys. Acta, 473: 73-92, 1977.[Medline]
- Danenberg P. V., Malli H., Swenson S. Thymidylate synthase inhibitors. Semin. Oncol., 26: 621-631, 1999.[Medline]
- Horie N., Aiba H., Oguro K., Hojo H., Takeishi K. Functional analysis and DNA polymorphism of the tandemly repeated sequences in the 5'-terminal regulatory region of the human gene for thymidylate synthase. Cell Struct. Funct., 20: 191-197, 1995.[Medline]
- Kawakami K., Omura K., Kanehira E., Watanabe Y. Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers. Anticancer Res., 19: 3249-3252, 1999.[Medline]
- Iacopetta B., Grieu F., Joseph D., Elsaleh H. A polymorphism in the enhancer region of the thymidylate synthase promoter influences the survival of colorectal cancer patients treated with 5-fluorouracil. Br. J. Cancer, 85: 827-830, 2001.[Medline]
- Marsh S., McKay J. A., Cassidy J., McLeod H. L. Polymorphism in the thymidylate synthase promoter enhancer region in colorectal cancer. Int. J. Oncol., 19: 383-386, 2001.[Medline]
- Pullarkat S. T., Stoehlmacher J., Ghaderi V., Xiong Y. P., Ingles S. A., Sherrod A., Warren R., Tsao-Wei D., Groshen S., Lenz H. J. Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy. Pharmacogenomics J., 1: 65-70, 2001.[Medline]
- Villafranca E., Okruzhnov Y., Dominguez M. A., Garcia-Foncillas J., Azinovic I., Martinez E., Illarramendi J. J., Arias F., Martinez Monge R., Salgado E., Angeletti S., Brugarolas A. Polymorphisms of the repeated sequences in the enhancer region of the thymidylate synthase gene promoter may predict downstaging after preoperative chemoradiation in rectal cancer. J. Clin. Oncol., 19: 1779-1786, 2001.[Abstract/Free Full Text]
- Kawakami K., Salonga D., Park J. M., Danenberg K. D., Uetake H., Brabender J., Omura K., Watanabe G., Danenberg P. V. Different lengths of a polymorphic repeat sequence in the thymidylate synthase gene affect translational efficiency but not its gene expression. Clin. Cancer Res., 7: 4096-4101, 2001.[Abstract/Free Full Text]
- Kawakami K., Ishida Y., Danenberg K. D., Omura K., Watanabe G., Danenberg P. V. Functional polymorphism of the thymidylate synthase gene in colorectal cancer accompanied by frequent loss of heterozygosity. Jpn. J. Cancer Res., 93: 1221-1229, 2002.[Medline]
- Etienne M. C., Chazal M., Laurent-Puig P., Magne N., Rosty C., Formento J. L., Francoual M., Formento P., Renee N., Chamorey E., Bourgeon A., Seitz J. F., Delpero J. R., Letoublon C., Pezet D., Milano G. Prognostic value of tumoral thymidylate synthase and p53 in metastatic colorectal cancer patients receiving fluorouracil-based chemotherapy: phenotypic and genotypic analyses. J. Clin. Oncol., 20: 2832-2843, 2002.[Abstract/Free Full Text]
- Elsaleh H., Joseph D., Grieu F., Zeps N., Spry N., Iacopetta B. Association of tumour site and sex with survival benefit from adjuvant chemotherapy in colorectal cancer. Lancet., 355: 1745-1750, 2000.[Medline]
- Marsh S., Collie Duguid E. S., Li T., Liu X., McLeod H. L. Ethnic variation in the thymidylate synthase enhancer region polymorphism among Caucasian and Asian populations. Genomics, 58: 310-312, 1999.[Medline]
- Breivik J., Lothe R. A., Meling G. I., Rognum T. O., Borresen-Dale A. L., Gaudernack G. Different genetic pathways to proximal and distal colorectal cancer influenced by sex-related factors. Int. J. Cancer, 74: 664-669, 1997.[Medline]
- Wiencke J. K., Zheng S., Lafuente A., Lafuente M. J., Grudzen C., Wrensch M. R., Miike R., Ballesta A., Trias M. Aberrant methylation of p16INK4a in anatomic and gender-specific subtypes of sporadic colorectal cancer. Cancer Epidemiol. Biomark. Prev., 8: 501-506, 1999.[Abstract/Free Full Text]
- Hawkins N., Norrie M., Cheong K., Mokany E., Ku S. L., Meagher A., OConnor T., Ward R. CpG island methylation in sporadic colorectal cancers and its relationship to microsatellite instability. Gastroenterology, 122: 1376-1387, 2002.[Medline]
- van Rijnsoever M., Grieu F., Elsaleh H., Joseph D., Iacopetta B. Characterisation of colorectal cancers showing hypermethylation at multiple CpG islands. Gut, 51: 797-802, 2002.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
E. Goekkurt, S.-E. Al-Batran, J. T. Hartmann, U. Mogck, G. Schuch, M. Kramer, E. Jaeger, C. Bokemeyer, G. Ehninger, and J. Stoehlmacher
Pharmacogenetic Analyses of a Phase III Trial in Metastatic Gastroesophageal Adenocarcinoma With Fluorouracil and Leucovorin Plus Either Oxaliplatin or Cisplatin: A Study of the Arbeitsgemeinschaft Internistische Onkologie
J. Clin. Oncol.,
June 10, 2009;
27(17):
2863 - 2873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lurje, P. C. Manegold, Y. Ning, A. Pohl, W. Zhang, and H.-J. Lenz
Thymidylate synthase gene variations: predictive and prognostic markers
Mol. Cancer Ther.,
May 1, 2009;
8(5):
1000 - 1007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. F. Smit, S. A. Burgers, B. Biesma, H. J.M. Smit, P. Eppinga, A.-M. C. Dingemans, M. Joerger, J. H. Schellens, A. Vincent, N. van Zandwijk, et al.
Randomized Phase II and Pharmacogenetic Study of Pemetrexed Compared With Pemetrexed Plus Carboplatin in Pretreated Patients With Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
April 20, 2009;
27(12):
2038 - 2045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Goekkurt, S.-E. Al-Batran, U. Mogck, C. Pauligk, J. T. Hartmann, M. Kramer, E. Jaeger, G. Ehninger, and J. Stoehlmacher
Pharmacogenetic analyses of hematotoxicity in advanced gastric cancer patients receiving biweekly fluorouracil, leucovorin, oxaliplatin and docetaxel (FLOT): a translational study of the Arbeitsgemeinschaft Internistische Onkologie (AIO)
Ann. Onc.,
March 1, 2009;
20(3):
481 - 485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Ricart, J. D. Berlin, K. P. Papadopoulos, S. Syed, D. W. Drolet, C. Quaratino-Baker, J. Horan, J. Chick, W. Vermeulen, A. W. Tolcher, et al.
Phase I, Pharmacokinetic and Biological Correlative Study of OSI-7904L, a Novel Liposomal Thymidylate Synthase Inhibitor, and Cisplatin in Patients with Solid Tumors
Clin. Cancer Res.,
December 1, 2008;
14(23):
7947 - 7955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sharma, J. M. Hoskins, L. P. Rivory, M. Zucknick, R. London, C. Liddle, and S. J. Clarke
Thymidylate Synthase and Methylenetetrahydrofolate Reductase Gene Polymorphisms and Toxicity to Capecitabine in Advanced Colorectal Cancer Patients
Clin. Cancer Res.,
February 1, 2008;
14(3):
817 - 825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ruzzo, F. Graziano, F. Loupakis, E. Rulli, E. Canestrari, D. Santini, V. Catalano, R. Ficarelli, P. Maltese, R. Bisonni, et al.
Pharmacogenetic Profiling in Patients With Advanced Colorectal Cancer Treated With First-Line FOLFOX-4 Chemotherapy
J. Clin. Oncol.,
April 1, 2007;
25(10):
1247 - 1254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Zhuo, R. Madden, S. A. Elela, and B. Chabot
Modern origin of numerous alternatively spliced human introns from tandem arrays
PNAS,
January 16, 2007;
104(3):
882 - 886.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S Popat, Z Chen, D Zhao, H Pan, N Hearle, I Chandler, Y Shao, W Aherne, and R. Houlston
A prospective, blinded analysis of thymidylate synthase and p53 expression as prognostic markers in the adjuvant treatment of colorectal cancer
Ann. Onc.,
December 1, 2006;
17(12):
1810 - 1817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Brody, T. Hucl, E. Gallmeier, J. M. Winter, S. E. Kern, and K. M. Murphy
Genomic Copy Number Changes Affecting the Thymidylate Synthase (TYMS) Gene in Cancer: A Model for Patient Classification to Aid Fluoropyrimidine Therapy
Cancer Res.,
October 1, 2006;
66(19):
9369 - 9373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Hubner, K. R. Muir, J.-F. Liu, G. S. Sellick, R. F.A. Logan, M. Grainge, N. Armitage, I. Chau, R. S. Houlston, and The United Kingdom Colorectal Adenoma Prevention C
Folate metabolism polymorphisms influence risk of colorectal adenoma recurrence.
Cancer Epidemiol. Biomarkers Prev.,
September 1, 2006;
15(9):
1607 - 1613.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ruzzo, F. Graziano, K. Kawakami, G. Watanabe, D. Santini, V. Catalano, R. Bisonni, E. Canestrari, R. Ficarelli, E. T. Menichetti, et al.
Pharmacogenetic Profiling and Clinical Outcome of Patients With Advanced Gastric Cancer Treated With Palliative Chemotherapy
J. Clin. Oncol.,
April 20, 2006;
24(12):
1883 - 1891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Dotor, M. Cuatrecases, M. Martinez-Iniesta, M. Navarro, F. Vilardell, E. Guino, L. Pareja, A. Figueras, D. G. Mollevi, T. Serrano, et al.
Tumor Thymidylate Synthase 1494del6 Genotype As a Prognostic Factor in Colorectal Cancer Patients Receiving Fluorouracil-Based Adjuvant Treatment
J. Clin. Oncol.,
April 1, 2006;
24(10):
1603 - 1611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Graziano and K. Kawakami
Studying the Predictive/Prognostic Role of Thymidylate Synthase Genotypes in Patients With Colorectal Cancer: Is One Polymorphism Enough?
J. Clin. Oncol.,
October 1, 2005;
23(28):
7230 - 7231.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kawakami, F. Graziano, G. Watanabe, A. Ruzzo, D. Santini, V. Catalano, R. Bisonni, F. Arduini, I. Bearzi, S. Cascinu, et al.
Prognostic Role of Thymidylate Synthase Polymorphisms in Gastric Cancer Patients Treated with Surgery and Adjuvant Chemotherapy
Clin. Cancer Res.,
May 15, 2005;
11(10):
3778 - 3783.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Popat, R. Wort, and R. S. Houlston
Relationship Between Thymidylate Synthase (TS) Genotype and TS Expression: A Tissue Microarray Analysis of Colorectal Cancers
International Journal of Surgical Pathology,
April 1, 2005;
13(2):
127 - 133.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Carlini, N. J. Meropol, J. Bever, M. L. Andria, T. Hill, P. Gold, A. Rogatko, H. Wang, and R. L. Blanchard
UGT1A7 and UGT1A9 Polymorphisms Predict Response and Toxicity in Colorectal Cancer Patients Treated with Capecitabine/Irinotecan
Clin. Cancer Res.,
February 1, 2005;
11(3):
1226 - 1236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhang, Y. Cui, G. Kuang, Y. Li, N. Wang, R. Wang, W. Guo, D. Wen, L. Wei, F. Yu, et al.
Association of the thymidylate synthase polymorphisms with esophageal squamous cell carcinoma and gastric cardiac adenocarcinoma
Carcinogenesis,
December 1, 2004;
25(12):
2479 - 2485.
[Abstract]
[Full Text]
[PDF]
|
 |
|