Cancer Research Versailles No Abst  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niho, N.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niho, N.
Right arrow Articles by Wakabayashi, K.
[Cancer Research 63, 6090-6095, September 15, 2003]
© 2003 American Association for Cancer Research


Epidemiology and Prevention

Concomitant Suppression of Hyperlipidemia and Intestinal Polyp Formation in Apc-deficient Mice by Peroxisome Proliferator-activated Receptor Ligands1

Naoko Niho2, Mami Takahashi, Tomohiro Kitamura, Yutaka Shoji, Masaki Itoh, Tetsuo Noda, Takashi Sugimura and Keiji Wakabayashi

Cancer Prevention Division, National Cancer Center Research Institute, Tokyo 104-0045 [N. N., M. T., T. K., Y. S., T. S., K. W.]; Cell Biology Department, Cancer Institute, Tokyo 170-8455 [M. I., T. N.]; Oncology Department, Jikei University School of Medicine, Tokyo 105-8461 [M. I.]; and The Core Research for Evolutional Science and Technology Program, Japan Science and Technology Corporation, Kawaguchi 332-0012 [T. N.], Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Epidemiological studies have shown a positive association of colon cancer with hyperlipidemia. Furthermore, signaling generated by peroxisome proliferator-activated receptor (PPAR) {alpha} and {gamma} ligands, suggested to be candidate tumor preventive agents, has been shown to lower serum triglyceride levels. In the present study, we assessed hyperlipidemia in Apc-deficient mice, model animals for human familial adenomatous polyposis, and examined the effects of pioglitazone and bezafibrate, respectively, PPAR{gamma} and PPAR{alpha} agonists, on both hyperlipidemia and intestinal polyposis. Serum lipid levels in Apc1309 mice and Min mice from 6 to 15 weeks of age were measured. Although serum levels of triglyceride and cholesterol were low in both Apc1309 and wild-type mice at 6 weeks, triglycerides were elevated 10-fold in Apc1309 mice by the age of 12 weeks but not in their wild-type counterparts. Cholesterol was also increased significantly, and marked centrilobular-restricted steatosis was observed in the livers of aged Apc1309 mice. Similar findings were observed for Min mice at 15 weeks of age. Moreover, lipoprotein lipase mRNA levels in the liver and small intestine of Apc1309 and Min mice were demonstrated to be lower than those in wild-type mice. Treatment of Apc1309 mice with 100 and 200 ppm pioglitazone or bezafibrate for 6 weeks from 6 weeks of age caused dose-dependent reduction in serum triglycerides and cholesterol, along with reduction in the numbers of intestinal polyps to 67% of the control value. The present study clearly demonstrated a hyperlipidemic state in Apc gene-deficient mice and a potential of PPAR{alpha} and PPAR{gamma} ligands to suppress both hyperlipidemia and polyp formation. Hyperlipidemia in these mice may thus be associated with their intestinal lesion development.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The risk of colon cancer appears to be elevated by a high fat diet (1) , and epidemiological studies have shown a clear association with serum triglycerides and cholesterol (2 , 3) . It has been reported that reduction of cholesterol levels by HMG-CoA reductase inhibitors can suppress colon carcinogenesis (4) . A decrease in levels of triglycerides may also reduce colon carcinogenesis.

PPARs3 are ligand-activated transcription factors belonging to the nuclear hormone receptor superfamily (5 , 6) . Three PPAR isotypes have been identified: {alpha}, {delta} (ß), and {gamma}. PPAR{gamma} is highly expressed in fat tissue with important roles in adipocyte differentiation and lipid storage (7) . PPAR{gamma} is also expressed in a number of epithelial neoplasms, including examples in the colon, breast, and prostate (6) . PPAR{gamma} ligand thiazolidinediones, including troglitazone and rosiglitazone, and the tyrosine analogue GW7845 can induce apoptosis and adipogenic differentiation and inhibit tumor growth both in vitro and in vivo (8, 9, 10) . It is further known that the PPAR{gamma} ligand pioglitazone, another thiazolidinedione, inhibits the growth of human renal cell carcinoma, hepatocellular carcinoma, gastric cancer, and salivary gland cancer cells in vitro (11, 12, 13, 14) . PPAR{alpha} is predominantly expressed in liver, heart, kidney, intestinal mucosa, and brown adipose tissue, all with high catabolic rates of fatty acids and peroxisomal metabolism (5) , and a PPAR{alpha} ligand, Wy-14,643, is reported to reduce 7,12-dimethylbenz(a)anthracene-induced mammary gland tumor development in rats (15) .

Pioglitazone is a potent PPAR{gamma} agonist and a weak PPAR{alpha} agonist, and bezafibrate is a specific PPAR{alpha} agonist (16) . These ligands improve hypertriglyceridemia and hypercholesterolemia via induction of adipocyte-specific genes, such as LPL (17) . Recently, it was reported that 100 and 200 ppm pioglitazone, bezafibrate, or troglitazone in the diet can suppress formation of dextran sodium sulfate/AOM-induced ACF, putative preneoplastic lesions, in the rat colon (18) . On the other hand, it has been reported that high doses of troglitazone and rosiglitazone promote polyp formation in the Min mouse colon (19 , 20) .

The Apc1309 (C57BL/6JApc/Apc{Delta}1309) mouse, an animal model of human FAP, develops numerous polyps in the intestinal tract because of a truncation mutation in the adenomatous polyposis coli (Apc) gene (Apc1309; Ref. 21 ). It is considered to have advantages for investigation of intestinal carcinogenesis and evaluation of anticancer and chemopreventive agents, as with other FAP model mice, such as ApcMin (Min), Apc{Delta}716, and Apc1638 mice (22, 23, 24) . In the present study, we assessed hyperlipidemia in Apc1309 and Min mice by measuring serum levels of lipids and observed age-dependent increase of triglycerides, total cholesterol, and FFAs. As a possible cause, we found decreases of LPL mRNA levels in the liver and small intestine. We also investigated the effects of 100 or 200 ppm of pioglitazone and bezafibrate in the diet on both hyperlipidemia and intestinal polyposis in Apc1309 mice and demonstrated concomitant reduction in both. On the basis of these results for Apc gene-deficient mice, possible involvement of hyperlipidemia in intestinal polyp formation is proposed.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Chemicals.
Progeny of C57BL/6JApc/Apc{Delta}1309 mice (Apc1309 mice), produced by a gene knockout method and bred by artificial insemination (21 , 25) , were obtained from CLEA Japan (Tokyo, Japan) at 5 weeks of age. Genotyping was performed using a three-oligonucleotide combination: 5'-TCAAGGTGCAGTTCATTATCATCACTG-3'; 5'-CTTCAGTTGCAGGATCTTCAGCTGACC-3'; and 5'-GCTAAAGCGCATGCTCCAGACTGCCTTG-3'. Genomic tail DNA was subjected to the PCR with the primers to amplify Apc alleles through 35 cycles of 94°C at 5 s, 62°C at 30 s, and 72°C at 30 s. Reaction products of 243 and 155 bp represent the Apc{Delta}1309 knockout and wild-type alleles, respectively. C57BL/6-ApcMin/+ mice (Min mice) were purchased from The Jackson Laboratory (Bar Harbor, ME) and also genotyped according to the method described previously (26) . Heterozygotes of these strains and wild-type (C57BL/6J) mice were acclimated to laboratory conditions for 1 week. Three to five mice were housed per plastic cage, with sterilized softwood chips as bedding, in a barrier-sustained animal room, air-conditioned at 24 ± 2°C and 55% humidity, on a 12-h light/dark cycle. Body weights and food consumption were measured weekly. The PPAR{gamma} ligand pioglitazone {(±)-5-[4-[2-(5-ethyl-2-pyridyl)ethoxy]benzyl]thiazolidine-2,4-dione monohydrochloride} was kindly provided by Takeda Chemical Industries, Ltd. (Osaka, Japan), and the PPAR{alpha} ligand bezafibrate {2-[4-(2-[4-chlorobenzamido]ethyl)phenoxy]-2-methylpropanoic acid} was purchased from Sigma Chemical (St. Louis, MO). These compounds were well mixed with powdered basal diet AIN-76A (CLEA Japan) at concentrations of 100 and 200 ppm.

Experimental Design.
To assess change in serum lipid levels with aging, female Apc1309 and wild-type mice were randomly divided into four groups, each consisting of five animals, and fed a basal diet from 5 to 12 weeks of age. For comparison, female Min mice were randomly divided into three groups, each consisting of three or four mice, and fed a basal diet from 5 to 15 weeks of age. To investigate the effects of pioglitazone and bezafibrate on both hyperlipidemia and intestinal polyposis, 6–10 male Apc1309 mice were given 0 (control), 100 or 200 ppm pioglitazone, or bezafibrate in the diet for 6 weeks, starting from 6 weeks of age. The doses were selected according to the results of a previous study, in which 100 ppm pioglitazone and bezafibrate in the diet suppressed formation of dextran sodium sulfate/AOM-induced ACF (18) . Food and water were available ad libitum. At the sacrifice time points, animals were anesthetized with ether, and blood samples were collected from the abdominal aorta. Various serum parameters, including triglycerides, total cholesterol, and FFAs, were measured, as reported previously (27, 28, 29) . Livers were removed, fixed in 10% phosphate-buffered formalin (pH 7.4), and embedded in paraffin. Sections were prepared and stained with H&E for assessment of histopathological features. The experimental protocol was approved by the Institutional Ethics Review Committee for animal experimentation.

Intestinal Polyp Assessment.
The intestinal tract was removed and divided into four sections, the colon and three segments of small intestine: (a) the duodenum (~4 cm in length; proximal) and the (b) proximal (middle) and (c) distal halves of the remainder (distal). All were opened longitudinally and fixed flat between sheets of filter paper in 10% phosphate-buffered formalin. The numbers and sizes of polyps as well as their distribution in the intestine were determined with a stereoscopic microscope, as described previously (30) .

RT-PCR Analysis.
Samples of normal and polyp tissue from small intestine and liver of mice (n = 3–4 each) were quickly deep frozen in liquid nitrogen and stored at -80°C. Total RNA was isolated using Isogen (Nippon Gene, Tokyo, Japan); then RNA was purified with DNase (Invitrogen, Leek, the Netherlands) according to the manufacturer’s instructions. cDNA was synthesized with 3 µg of total RNA in a final volume of 20 µl using an Omniscript RT Kit (Qiagen GmbH, Hilden, Germany) and an oligo(dT) primer. PCR amplification of 1 µl of cDNA was carried out in a final volume of 10 µl with a Perkin-Elmer GeneAmp PCR System 9600 (Perkin-Elmer Applied Biosystems, Foster City, CA) or an MJ Research PTC-200 DNA Engine (MJ Research, Inc., Waltham, MA), using a HotStarTaq (Qiagen). As an internal control to confirm the integrity of the isolated mRNA, ß-actin (5'-primer: AACACCCCAGCCATGTACG, 3'-primer: CGCTCAGGAGGAGCAATGA) was used. PCR was performed with specific primers for mice LPL (31) , acyl-CoA oxidase (32) , very long-chain acyl-CoA synthetase (33) , carnitine palmitoyl transferase I (34) , FAS (31) , acetyl-CoA carboxylase (31) , stearoyl-CoA desaturase-1 (31) , phosphoenolpyruvate carboxykinase (35) , apolipoprotein A-I (apoA-I) (31) and apolipoprotein C-III (apoC-III) (5': TCTTGGCTCTCCTGGCATC, 3': TGGAGTTGGTTGGTCCTCAG). Cycling conditions were as follows: 94°C for 20 s, 57.8°C-65.4°C for 30 s, and 72°C for 80 s, for 33 cycles (except 40 cycles for FAS and acetyl-CoA carboxylase and 25 cycles for ß-actin) after an initial step of 95°C for 15 min. A final elongation step of 72°C for 10 min completed the PCR. The products were then analyzed by 2% agarose gel electrophoresis.

Immunohistochemistry.
Expression and localization of PPAR{gamma} and PPAR{alpha} in the small intestine were examined with rabbit polyclonal antibodies against each antigen using an avidin biotin complex method. Briefly, paraffin-embedded sections were deparaffinized and pretreated by heating in a microwave oven in 10 mM citrate buffer at pH 6.0 for 20 min. Nonspecific endogenous peroxidase activity was blocked by exposure to 0.5% hydrogen peroxide in methanol for 15 min, and masking was conducted with 5% normal goat serum in PBS containing 0.5% casein for 30 min. Incubation with anti-PPAR{gamma} (clone H-100; Santa Cruz Biotechnology, Santa Cruz, CA) and anti-PPAR{alpha} (clone H-98; Santa Cruz Biotechnology) was performed at 4°C, overnight. This step was followed by sequential incubation with biotin-labeled goat anti-rabbit IgG and avidin biotin complex reagents (Vector Laboratories, Burlingame, CA).

Statistical Analysis.
The data for blood biochemistry and polyp formation are expressed as mean ± SE, and their statistical analysis was performed with Student’s t test. Ps < 0.05 were considered to be significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Elevation of Serum Lipid Levels in Apc Gene-deficient Mice.
Changes of serum lipid levels with ages were determined in female Apc1309 and wild-type mice. No significant differences were evident at 6 weeks of age. However, triglyceride levels were dramatically increased in Apc1309 mice thereafter (Fig. 1A)Citation , the average value at 12 weeks of age (618.2 ± 161.5 mg/dl) being almost 10 times higher than that at 6 weeks (72.0 ± 12.6 mg/dl). No such increase was observed in their wild-type counterparts. Total cholesterol in Apc1309 mice also significantly increased between 6 and 12 weeks of age (Fig. 1B)Citation , from 87.0 ± 3.2 mg/dl to 162.4 ± 33.0 mg/dl in contrast to the 70.2 ± 8.8 mg/dl to 79.6 ± 13.7 mg/dl found for the wild type. Significant changes in FFA levels also occurred with age (Fig. 1C)Citation . Serum lipid levels in male Apc1309 mice aged 12 weeks were almost the same as those in female Apc1309 mice at the same age (Fig. 2, A–C)Citation . Histopathologically, centrilobular-restricted steatosis was observed in the livers of all Apc1309 mice at 12 weeks of age, with numerous microvesicular fatty droplets in the cytoplasm of parenchymal cells (data not shown). Steatosis observed in Apc1309 mice was confirmed by staining frozen sections with Oil Red O. Wild-type mice exhibited no fatty change. The above observations indicate that Apc1309 mice develop hyperlipidemia as they age, the severity not differing between males and females.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Age-dependent increase of serum lipid levels in Apc1309 and Min mice. A–C, serum lipid levels in female Apc1309 (closed box) and wild-type (open box) mice at 6, 8, 10, and 12 weeks of age. D–F, serum lipid levels in female Min mice at 8, 11, and 15 weeks of age. A and D, triglycerides; B and E, total cholesterol; C and F, FFAs. Data expressed are means; bars, SE.

 


View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Suppression of serum lipid levels in Apc1309 mice by pioglitazone and bezafibrate. A–F, serum lipid levels in male Apc1309 mice at 12 weeks of age given diet containing pioglitazone (A–C) or bezafibrate (D–F) at doses of 0, 100, and 200 ppm for 6 weeks. A and D, triglycerides; B and E, total cholesterol; C and F, FFAs. Data expressed are means; bars, SE.

 
In Min mice, triglyceride and FFA levels also increased dramatically with age (Fig. 1, D–F)Citation . Values for triglycerides in the serum of female Min mice at 8 and 15 weeks of age were 40.3 ± 6.2 and 377.3 ± 136.1 mg/dl, those for total cholesterol were 83.7 ± 6.3 and 107.8 ± 15.6 mg/dl, and those for FFAs were 1.0 ± 0.1 and 3.1 ± 0.4 mEQ/liter, respectively. Histopathologically, centrilobular-restricted steatosis was apparent in the livers of the mice aged 15 weeks (data not shown).

Other serum biological parameters, such as glucose, aspartate aminotransferase, alanine aminotransferase, lactate dehydrogenase, and alkaline phosphatase, did not differ between groups of Apc-deficient mice, of either Apc1309 or Min strains, and wild-type mice at 6–15 weeks of age (data not shown).

Depression of Serum Lipid Levels in Apc1309 Mice by Pioglitazone and Bezafibrate.
Administration of pioglitazone or bezafibrate did not affect food intake or behavior of Apc1309 mice. Final body weights in the 100 and 200 ppm pioglitazone-treated group were increased to 113–115% of those in the basal diet group, and those in bezafibrate-treated groups to 118–122%. Serum levels of triglycerides at 12 weeks of age decreased dose dependently, being reduced 44 and 50% by 100 and 200 ppm of pioglitazone, respectively (Fig. 2A)Citation . The levels of total cholesterol were also decreased by 15 and 28%, respectively, and administration of pioglitazone caused a 27% decrease in FFA levels in both 100 and 200 ppm groups, although significance was not attained (Fig. 2, B and C)Citation . Administration of bezafibrate reduced serum levels of triglycerides, dose dependently, by 30 and 55% (P < 0.05) at 100 and 200 ppm, respectively (Fig. 2D)Citation . The levels of total cholesterol and FFA showed a tendency for decrease by 6–18% (Fig. 2, E and F)Citation . The severity of hepatic steatosis was clearly decreased in Apc1309 mice after treatment with pioglitazone and bezafibrate at doses of 100 and 200 ppm (data not shown).

Suppression of Intestinal Polyp Formation in Apc1309 Mice by Pioglitazone and Bezafibrate.
A suppressive effect of pioglitazone and bezafibrate on intestinal polyp development was also found. Most polyps were located in the small intestine, with only a few apparent in the colons of control and pioglitazone or bezafibrate-treated animals (Table 1)Citation . The total numbers of polyps in the groups treated with pioglitazone at 100 and 200 ppm were reduced to 67% (P < 0.05) of the value for the control group, in both cases. The numbers of polyps in the distal parts of the small intestine in Apc1309 mice fed diet containing 100 ppm pioglitazone were 64% (P < 0.05) of the control values, and those in the proximal and middle parts of the small intestine in the mice treated with 200 ppm pioglitazone were 58% (P < 0.05) and 61% (P < 0.01), respectively. Dietary administration of 100 and 200 ppm bezafibrate reduced the total numbers of polyps to 87 and 75% (P < 0.05), respectively, of the value for the control group. The numbers of polyps in the proximal, middle, and distal parts of the small intestine in Apc1309 mice treated with 100 and 200 ppm bezafibrate were reduced to 73–96% of the control values, respectively, although these values were not statistically significant.


View this table:
[in this window]
[in a new window]

 
Table 1 Data for intestinal polyps in Apc1309 mice treated with PPAR ligandsa

 
The size distribution of intestinal polyps in the basal diet and pioglitazone or bezafibrate-treated groups was investigated. Treatment with 100 and 200 ppm pioglitazone reduced the numbers of polyps measuring >=1 and >=0.5 mm in diameter, respectively (Fig. 3A)Citation . On the other hand, 100 and 200 ppm bezafibrate reduced the numbers of polyps, especially 0.5–1.5 mm in diameter (Fig. 3B)Citation .



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Effects of pioglitazone (A) and bezafibrate (B) on size distribution of intestinal polyps in Apc1309 mice. Apc1309 mice were fed basal diet (closed box) or diet containing 100 ppm (open box) or 200 ppm (cross-hatched box) pioglitazone or bezafibrate for 6 weeks. Polyps were grouped at intervals of 0.5 mm according to their diameters. The number of polyps/mouse in each size class is expressed as the means; bars, SE.

 
Alterations of Metabolic Enzyme mRNA Expression in the Liver and Small Intestine of Apc-deficient Mice.
To approach the mechanisms of how heterozygous mutations in the mouse Apc gene lead to dramatic changes in serum lipids, especially triglycerides, with age, we investigated liver and small intestine expression levels of mRNAs encoding metabolic enzymes involved in hydrolysis of triglycerides, lipogenesis, ß-oxidation, and glucose homeostasis. In the liver and small intestine of Apc1309 mice at 6, 8, and 12 weeks of age, there was no obvious variation in their mRNA levels for the lipogenic genes, including FAS and stearoyl-CoA desaturase-1; ß-oxidation genes, including acyl-CoA oxidase and carnitine palmitoyl transferase 1; and gluconeogenesis genes, including phosphoenolpyruvate carboxykinase, as compared with the wild-type counterparts. Similarly, the expression levels for these genes were not different between Min and wild-type mice at any age. On the other hand, the liver mRNA levels for LPL, which catalyze the hydrolysis of triglycerides in lipoprotein particles into fatty acids and monoacylglycerol (17) , were clearly lowered in Apc1309 mice at 6, 8, and 12 and in Min mice at 8, 11, and 15 weeks of age, and the degree of decrease was the most evident at 12 and 15 weeks of age, respectively (Fig. 4A)Citation . A similar shift was also evident for the small intestinal mRNA level (Fig. 4B)Citation . Between normal mucosa and polyp tissue of Apc1309 mice, there were no differences in LPL mRNA levels. We also measured both apoA-I and apoC-III, which are pivotal in metabolism of high-density lipoproteins and very low-density lipoproteins, respectively, but hepatic values for mRNAs were similar in all mouse strains, independent of the age. Administration of 100 and 200 ppm pioglitazone or bezafibrate raised the hepatic mRNA levels of LPL in Apc1309 mice (Fig. 5, A and B)Citation . A similar up-regulation was also evident for the small intestinal mRNA levels, although the degree of elevation was small (data not shown).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Decrease of LPL mRNA expression in the liver and small intestine of Apc1309 and Min mice. A, RT-PCR analysis of LPL mRNA expression in the liver of Apc1309 mice at 12 weeks of age and Min mice at 15 weeks of age. Wild-type mice for comparison were the same ages in each case. B, RT-PCR analysis of LPL mRNA expression in the normal mucosa (N) and polyp (P) of small intestine of Apc1309 and wild-type mice at 12 weeks of age. Data are representative of three separate experiments.

 


View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Increase of LPL mRNA in the livers of Apc1309 mice attributable to pioglitazone and bezafibrate. RT-PCR analysis of LPL mRNA expression in the livers of Apc1309 mice at 12 weeks of age given diet containing pioglitazone (A) or bezafibrate (B) at doses of 0, 100, and 200 ppm for 6 weeks. Wild-type mice for comparison were the same ages in each case. Data are representative of three separate experiments.

 
PPAR{gamma} and PPAR{alpha} Expression in Small Intestinal Polyps.
The presence of PPAR{gamma} in the small intestines of female Apc1309 mice at 12 weeks of age was immunohistochemically confirmed in polyp epithelium and normal crypt epithelial cells. Diffuse staining of PPAR{gamma} of epithelial cells of polyps and the bases of crypts was evident in the cytoplasm and nuclei (data not shown). Localization and staining intensity of PPAR{gamma} in small intestinal epithelium of the wild-type mice was the same as in normal epithelium in Apc1309 mice. The expression pattern of PPAR{alpha} was also similar to that for PPAR{gamma}. In the case of Min mice at 15 weeks of age, the localization and staining intensity of PPAR{gamma} and PPAR{alpha} in small intestinal epithelium were also the same as in Apc1309 mice. Control sections without primary antibodies showed no staining. Administration of pioglitazone or bezafibrate did not significantly alter the expression or localization of PPAR{gamma} and PPAR{alpha} in polyps and normal mucosa of Apc1309 mice when compared with the nontreated group.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study clearly demonstrated a hyperlipidemic state in two strains of FAP model mice. The levels of serum lipids, especially triglycerides, were thus dramatically increased with age in both Apc1309 and Min cases, with marked centrilobular-restricted steatosis observed in the livers. Moreover, LPL mRNA levels in the livers and small intestines of these mice were markedly lower than those of wild-type mice. Administration of the PPAR{gamma} ligand, pioglitazone, or the PPAR{alpha} ligand, bezafibrate, reduced both the serum level of triglycerides and intestinal polyp formation in the Apc1309 mice. The mRNA levels of LPL in the liver and small intestine were increased by pioglitazone or bezafibrate. It is therefore speculated that low levels of LPL mRNA expression may be associated with hyperlipidemia in Apc1309 and Min mice and involved in intestinal polyp development.

It has been reported that there are no accompanying increases in serum triglycerides and total cholesterol in rats with colon tumors induced by 1,2-dimethylhydrazine (36) . We also confirmed no changes of serum lipid levels in C57BL/6 mice with colon tumors induced by AOM (data not shown). Therefore, tumor development itself may not cause hyperlipidemia. The deficiency in the Apc gene may be related not only to development of intestinal polyps but also to hyperlipidemia via decreased LPL gene expression. Inactivation of normal Apc function leads to accumulation of ß-catenin and activation of the Wnt signaling pathway, in which the complex of ß-catenin and the T-cell factor acts as a transcriptional factor. Thus far, c-myc, cyclin D1, matrilysin, MDR1, gastrin, Id2, and PPAR{delta} have been identified as target genes of Wnt signaling relevant to carcinogenesis (37, 38, 39, 40) . At present, the biological relationship between Apc deficiency and severe hyperlipidemic state is uncertain, but a report has been published that Wnt signaling maintains preadipocytes in an undifferentiated state through inhibition of the adipogenic transcription factors, CCAAT/enhancer binding protein {alpha}, and PPAR{gamma} (41) . Moreover, transcriptional induction of the LPL gene has been reported to be mediated through binding of PPAR-retinoid X receptor heterodimers to the functional PPRE sequence in the LPL gene promoter (17) . LPL catalyzes the rate-limiting step for clearance of triglycerides from the blood (17) , and decrease of LPL mRNA levels results in elevation of serum lipid levels. Regarding lipid lowering drugs, fibrates predominantly affect liver LPL production through activation of PPAR{alpha} (17) . Moreover, the present study clearly showed that pioglitazone, as well as bezafibrate, raises the hepatic mRNA levels of LPL. It is therefore speculated that both PPAR {alpha} and {gamma} ligands might improve hyperlipidemia of Apc-deficient mice via increase of LPL mRNA levels in the liver.

On the other hand, different patterns of suppressive effects of polyp formation in Apc1309 mice were observed between PPAR {alpha} and {gamma} ligands, i.e., numbers of polyps were reduced to a great extent by pioglitazone than by bezafibrate. Moreover, treatment with pioglitazone reduced the numbers of polyps of each size class, and bezafibrate only affected those with small sizes. These results suggested that pioglitazone might have additional mechanisms of suppression of intestinal polyp formation through PPAR{gamma}. Recently, Girnun et al. (42) reported that Ppar{gamma}+/- mice exhibit greater ß-catenin levels than Ppar{gamma}+/+ mice, and a greater incidence of colon cancer was observed after treatment with AOM. Thus, PPAR{gamma} may act as a suppressor of the Wnt pathway, and the decreases of polyp numbers in Apc1309 mice by pioglitazone in the present study might be resulted from such suppression. Girnun et al. (42) also reported no difference in the number of colon tumors between Apc+/1638N:Ppar{gamma}+/- and Apc+/1638N:Ppar{gamma}+/+ mice at 65 weeks of age. However, the authors did not mention the serum lipid levels of these animals. Moreover, in contrast to Apc1309 and Min mice, the incidence and multiplicity of intestinal polyps in Apc+/1638N mice are very small (24) . It is therefore speculated that the change of lipid metabolism in Apc-deficient mice may differ between strains, associated with the severity of polyp formation. A hyperlipidemic state could enhance the growth of intestinal polyps, and improvement of hyperlipidemia by treatment with PPAR ligands might thus reduce their size in Apc1309 mice. Furthermore, it has been reported that indomethacin, a nonsteroidal anti-inflammatory drug and cyclooxygenase inhibitor that suppresses intestinal polyp development in Min mice (43) , can activate PPAR{alpha} and {gamma} in vitro (44) . The relation between Apc deficiency and changes of lipid metabolism with age and the influence of hyperlipidemia on intestinal polyp development are now under detailed investigation in our laboratory.

It has been reported that polyp formation in the colon of the Min mice is enhanced by 2000 ppm or 150 mg/kg troglitazone, whereas that in the small intestine is not affected (19 , 20) . In the present study, such promotion of colon polyp formation was not observed in Apc1309 mice treated with 100 and 200 ppm pioglitazone. Indeed, a clear suppressive effect on small intestinal polyp development was evident in these groups. Chemically induced ACF formation in the rat colon has also been shown to be suppressed by treatment with 100 ppm troglitazone and 100 ppm pioglitazone (18) . Our preliminary study with a wide range of pioglitazone doses (50, 100, 200, 400, 800, and 1600 ppm in diet) in Apc1309 mice confirmed that small intestinal polyp development was suppressed at doses of 100 and 200 ppm and that the numbers of polyp in the colon and the small intestine were not increased up to 1600 ppm. It has been reported that low doses of PPAR{gamma} ligands are tumor promotive, whereas they are tumor suppressive at higher levels in beast cancer cells (45) . Dose response effects of pioglitazone across a wide range on intestinal polyp formation in Min mice are also now under investigation in our laboratory.

In conclusion, the present study demonstrated that the PPAR ligands, pioglitazone and bezafibrate, have the potential to suppress both hyperlipidemia and polyp formation in Apc gene knockout mice. It is very important to now elucidate the mechanisms underlying the hypertriglyceridemia in FAP model mice and the roles of PPAR{gamma} and/or PPAR{alpha} in intestinal polyp development.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grants-in-Aid for Cancer Research, for the Second-Term Comprehensive 10-Year Strategy for Cancer Control, and for the Research on Advanced Medical Technology from the Ministry of Health, Labour, and Welfare of Japan. Back

2 To whom requests for reprints should be addressed, at the Cancer Prevention Division, National Cancer Center Research Institute, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan. Phone: 81-3-3547-5271; E-mail: nniho{at}gan2.ncc.go.jp Back

3 The abbreviations used are: PPAR, peroxisome proliferator-activated receptor; LPL, lipoprotein lipase; AOM, azoxymethane; RT-PCR, reverse transcription-PCR; ACF, aberrant crypt foci; FAS, fatty acid synthase; FAP, familial adenomatous polyposis; FFA, free fatty acid. Back

Received 10/22/02. Revised 6/16/03. Accepted 7/17/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bruce W. R., Wolever T. M., Giacca A. Mechanisms linking diet and colorectal cancer: the possible role of insulin resistance. Nutr. Cancer, 37: 19-26, 2000.[Medline]
  2. McKeown-Eyssen G. E. Epidemiology of colorectal cancer revisited: are serum triglycerides and/or plasma glucose associated with risk?. Cancer Epidemiol. Biomark. Prev., 3: 687-695, 1994.[Abstract]
  3. Jarvinen R., Knekt P., Hakulinen T., Rissanen H., Heliovaara M. Dietary fat, cholesterol and colorectal cancer in a prospective study. Br. J. Cancer, 85: 357-361, 2001.[Medline]
  4. Agarwal B., Rao C. V., Bhendwal S., Ramey W. R., Shirin H., Reddy B. S., Holt P. R. Lovastatin augments sulindac-induced apoptosis in colon cancer cells and potentiates chemopreventive effects of sulindac. Gastroenterology, 117: 838-847, 1999.[Medline]
  5. Schoonjans K., Staels B., Auwerx J. The peroxisome proliferator activated receptors (PPARs) and their effects on lipid metabolism and adipocyte differentiation. Biochim. Biophys. Acta, 1302: 93-109, 1996.[Medline]
  6. Rosen E. D., Spiegelman B. M. PPAR{gamma}: a nuclear regulator of metabolism, differentiation, and cell growth. J. Biol. Chem., 276: 37731-37734, 2001.[Free Full Text]
  7. Tontonoz P., Singer S., Forman B. M., Sarraf P., Fletcher J. A., Fletcher C. D., Brun R. P., Mueller E., Altiok S., Oppenheim H., Evans R. M., Spiegelman B. M. Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor {gamma} and the retinoid X receptor. Proc. Natl. Acad. Sci. USA, 94: 237-241, 1997.[Abstract/Free Full Text]
  8. Sarraf P., Mueller E., Jones D., King F. J., DeAngelo D. J., Partridge J. B., Holden S. A., Chen L. B., Singer S., Fletcher C., Spiegelman B. M. Differentiation and reversal of malignant changes in colon cancer through PPAR{gamma}. Nat. Med., 4: 1046-1052, 1998.[Medline]
  9. Suh N., Wang Y., Williams C. R., Risingsong R., Gilmer T., Willson T. M., Sporn M. B. A new ligand for the peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}), GW7845, inhibits rat mammary carcinogenesis. Cancer Res., 59: 5671-5673, 1999.[Abstract/Free Full Text]
  10. Mueller E., Smith M., Sarraf P., Kroll T., Aiyer A., Kaufman D. S., Oh W., Demetri G., Figg W. D., Zhou X. P., Eng C., Spiegelman B. M., Kantoff P. W. Effects of ligand activation of peroxisome proliferator-activated receptor {gamma} in human prostate cancer. Proc. Natl. Acad. Sci. USA, 97: 10990-10995, 2000.[Abstract/Free Full Text]
  11. Inoue K., Kawahito Y., Tsubouchi Y., Kohno M., Yoshimura R., Yoshikawa T., Sano H. Expression of peroxisome proliferator-activated receptor {gamma} in renal cell carcinoma and growth inhibition by its agonists. Biochem. Biophys. Res. Commun., 287: 727-732, 2001.[Medline]
  12. Rumi M., Sato H., Ishihara S., Kawashima K., Hamamoto S., Kazumori H., Okuyama T., Fukuda R., Nagasue N., Kinoshita Y. Peroxisome proliferator-activated receptor {gamma} ligand-induced growth inhibition of human hepatocellular carcinoma. Br. J. Cancer, 84: 1640-1647, 2001.[Medline]
  13. Takahashi N., Okumura T., Motomura W., Fujimoto Y., Kawabata I., Kohgo Y. Activation of PPAR{gamma} inhibits cell growth and induces apoptosis in human gastric cancer cells. FEBS. Lett., 455: 135-139, 1999.[Medline]
  14. Begum N. M., Nakashiro K., Kawamata H., Uchida D., Shintani S., Ikawa Y., Sato M., Hamakawa H. Expression of peroxisome proliferator-activated receptor {gamma} and the growth inhibitory effect of its synthetic ligands in human salivary gland cancer cell lines. Int. J. Oncol., 20: 599-605, 2002.[Medline]
  15. Pighetti G. M., Novosad W., Nicholson C., Hitt D. C., Hansens C., Hollingsworth A. B., Lerner M. L., Brackett D., Lightfoot S. A., Gimbl J. M. Therapeutic treatment of DMBA-induced mammary tumors with PPAR ligands. Anticancer Res., 21: 825-829, 2001.[Medline]
  16. Sakamoto J., Kimura H., Moriyama S., Odaka H., Momose Y., Sugiyama Y., Sawada H. Activation of human peroxisome proliferator-activated receptor (PPAR) subtypes by pioglitazone. Biochem. Biophys. Res. Commun., 278: 704-711, 2000.[Medline]
  17. Schoonjans K., Peinado-Onsurbe J., Lefebvre A. M., Heyman R. A., Briggs M., Deeb S., Staels B., Auwerx J. PPAR{alpha} and PPAR{gamma} activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J., 15: 5336-5348, 1996.[Medline]
  18. Tanaka T., Kohno H., Yoshitani S., Takashima S., Okumura A., Murakami A., Hosokawa M. Ligands for peroxisome proliferator-activated receptors {alpha} and {gamma} inhibit chemically induced colitis and formation of aberrant crypt foci in rats. Cancer Res., 61: 2424-2428, 2001.[Abstract/Free Full Text]
  19. Lefebvre A. M., Chen I., Desreumaux P., Najib J., Fruchart J. C., Geboes K., Briggs M., Heyman R., Auwerx J. Activation of the peroxisome proliferator-activated receptor {gamma} promotes the development of colon tumors in C57BL/6J-APCMin/+ mice. Nat. Med., 4: 1053-1057, 1998.[Medline]
  20. Saez E., Tontonoz P., Nelson M. C., Alvarez J. G., Ming U. T., Baird S. M., Thomazy V. A., Evans R. M. Activators of the nuclear receptor PPAR{gamma} enhance colon polyp formation. Nat. Med., 4: 1058-1061, 1998.[Medline]
  21. Quesada C. F., Kimata H., Mori M., Nishimura M., Tsuneyoshi T., Baba S. Piroxicam and acarbose as chemopreventive agents for spontaneous intestinal adenomas in APC gene 1309 knockout mice. Jpn. J. Cancer Res., 89: 392-396, 1998.[Medline]
  22. Moser A. R., Pitot H. C., Dove W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science (Wash. DC), 247: 322-324, 1990.[Abstract/Free Full Text]
  23. Oshima M., Oshima H., Kitagawa K., Kobayashi M., Itakura C., Taketo M. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene. Proc. Natl. Acad. Sci. USA, 92: 4482-4486, 1995.[Abstract/Free Full Text]
  24. Fodde R., Edelmann W., Yang K., van Leeuwen C., Carlson C., Renault B., Breukel C., Alt E., Lipkin M., Khan P. M., Kucherlapati R. A targeted chain-termination mutation in the mouse Apc gene results in multiple intestinal tumors. Proc. Natl. Acad. Sci. USA, 91: 8969-8973, 1994.[Abstract/Free Full Text]
  25. Kitamura T., Kawamori T., Uchiya N., Itoh M., Noda T., Matsuura M., Sugimura T., Wakabayashi K. Inhibitory effects of mofezolac, a cyclooxygenase-1 selective inhibitor, on intestinal carcinogenesis. Carcinogenesis (Lond.), 23: 1463-1466, 2002.[Abstract/Free Full Text]
  26. Su L. K., Kinzler K. W., Vogelstein B., Preisinger A. C., Moser A. R., Luongo C., Gould K. A., Dove W. F. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science (Wash. DC), 256: 668-670, 1992.[Abstract/Free Full Text]
  27. Tamaoku K., Ueno K., Akiura K., Ohkura Y. New water-soluble hydrogen donors for the enzymatic photometric determination of hydrogen peroxide. II. N-ethyl-N-(2-hydroxy-3-sulfopropyl)aniline derivatives. Chem. Pharm. Bull., 30: 2492-2497, 1982.
  28. Richmond W. Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic assay of total cholesterol in serum. Clin. Chem., 19: 1350-1356, 1973.[Abstract]
  29. Sugo S., Matsumoto Y., Yamaoka T., Sakurabayashi I. Improved enzymatic method for determining free fatty acids in serum, with use of 3-octenoic acid. Clin. Chem., 36: 163 1990.[Free Full Text]
  30. Watanabe K., Kawamori T., Nakatsugi S., Ohta T., Ohuchida S., Yamamoto H., Maruyama T., Kondo K., Ushikubi F., Narumiya S., Sugimura T., Wakabayashi K. Role of the prostaglandin E receptor subtype EP1 in colon carcinogenesis. Cancer Res., 59: 5093-5096, 1999.[Abstract/Free Full Text]
  31. Shimano H., Horton J. D., Hammer R. E., Shimomura I., Brown M. S., Goldstein J. L. Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J. Clin. Investig., 98: 1575-1584, 1996.[Medline]
  32. Fan C. Y., Pan J., Chu R., Lee D., Kluckman K. D., Usuda N., Singh I., Yeldandi A. V., Rao M. S., Maeda N., Reddy J. K. Hepatocellular and hepatic peroxisomal alterations in mice with a disrupted peroxisomal fatty acyl-coenzyme A oxidase gene. J. Biol. Chem., 271: 24698-24710, 1996.[Abstract/Free Full Text]
  33. Heinzer A. K., Kemp S., Lu J. F., Watkins P. A., Smith K. D. Mouse very long-chain acyl-CoA synthetase in X-linked adrenoleukodystrophy. J. Biol. Chem., 277: 28765-28773, 2002.[Abstract/Free Full Text]
  34. Chao L., Marcus-Samuels B., Mason M. M., Moitra J., Vinson C., Arioglu E., Gavrilova O., Reitman M. L. Adipose tissue is required for the antidiabetic, but not for the hypolipidemic, effect of thiazolidinediones. J. Clin. Investig., 106: 1221-1228, 2000.[Medline]
  35. Devine J. H., Eubank D. W., Clouthier D. E., Tontonoz P., Spiegelman B. M., Hammer R. E., Beale E. G. Adipose expression of the phosphoenolpyruvate carboxykinase promoter requires peroxisome proliferator-activated receptor {gamma} and 9-cis-retinoic acid receptor binding to an adipocyte-specific enhancer in vivo. J. Biol. Chem., 274: 13604-13612, 1999.[Abstract/Free Full Text]
  36. Barton T. P., Cruse J. P., Lewin M. R. Changes in serum lipids related to the presence of experimental colon cancer. Br. J. Cancer, 56: 451-454, 1987.[Medline]
  37. Crawford H. C., Fingleton B. M., Rudolph-Owen L. A., Goss K. J., Rubinfeld B., Polakis P., Matrisian L. M. The metalloproteinase matrilysin is a target of ß-catenin transactivation in intestinal tumors. Oncogene, 18: 2883-2891, 1999.[Medline]
  38. Yamada T., Takaoka A. S., Naishiro Y., Hayashi R., Maruyama K., Maesawa C., Ochiai A., Hirohashi S. Transactivation of the multidrug resistance 1 gene by T-cell factor 4/ß-catenin complex in early colorectal carcinogenesis. Cancer Res., 60: 4761-4766, 2000.[Abstract/Free Full Text]
  39. Koh T. J., Bulitta C. J., Fleming J. V., Dockray G. J., Varro A., Wang T. C. Gastrin is a target of the ß-catenin/TCF-4 growth-signaling pathway in a model of intestinal polyposis. J. Clin. Investig., 106: 533-539, 2000.[Medline]
  40. Rockman S. P., Currie S. A., Ciavarella M., Vincan E., Dow C., Thomas R. J., Phillips W. A. Id2 is a target of the ß-catenin/T cell factor pathway in colon carcinoma. J. Biol. Chem., 276: 45113-45119, 2001.[Abstract/Free Full Text]
  41. Ross S. E., Hemati N., Longo K. A., Bennett C. N., Lucas P. C., Erickson R. L., MacDougald O. A. Inhibition of adipogenesis by Wnt signaling. Science (Wash. DC), 289: 950-953, 2000.[Abstract/Free Full Text]
  42. Girnun G. D., Smith W. M., Drori S., Sarraf P., Mueller E., Eng C., Nambiar P., Rosenberg D. W., Bronson R. T., Edelmann W., Kucherlapati R., Gonzalez F. J., Spiegelman B. M. APC-dependent suppression of colon carcinogenesis by PPAR{gamma}. Proc. Natl. Acad. Sci. USA, 99: 13771-13776, 2002.[Abstract/Free Full Text]
  43. Chiu C. H., McEntee M. F., Whelan J. Discordant effect of aspirin and indomethacin on intestinal tumor burden in Apc(Min/+)mice. Prostaglandins Leukot. Essent. Fatty Acids, 62: 269-275, 2000.[Medline]
  44. Lehmann J. M., Lenhard J. M., Oliver B. B., Ringold G. M., Kliewer S. A. Peroxisome proliferator-activated receptors {alpha} and {gamma} are activated by indomethacin and other non-steroidal anti-inflammatory drugs. J. Biol. Chem., 272: 3406-3410, 1997.[Abstract/Free Full Text]
  45. Clay C. E., Namen A. M., Atsumi G., Trimboli A. J., Fonteh A. N., High K. P., Chilton F. H. Magnitude of peroxisome proliferator-activated receptor-{gamma} activation is associated with important and seemingly opposite biological responses in breast cancer cells. J. Investig. Med., 49: 413-420, 2001.[Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
K. Yamaguchi, M. Cekanova, M. F. McEntee, J.-H. Yoon, S. M. Fischer, I. B. Renes, I. Van Seuningen, and S. J. Baek
Peroxisome proliferator-activated receptor ligand MCC-555 suppresses intestinal polyps in ApcMin/+ mice via extracellular signal-regulated kinase and peroxisome proliferator-activated receptor-dependent pathways
Mol. Cancer Ther., September 1, 2008; 7(9): 2779 - 2787.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. Miyamoto, Y. Yasui, T. Tanaka, H. Ohigashi, and A. Murakami
Suppressive effects of nobiletin on hyperleptinemia and colitis-related colon carcinogenesis in male ICR mice
Carcinogenesis, May 1, 2008; 29(5): 1057 - 1063.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Mutoh, N. Niho, M. Komiya, M. Takahashi, R. Ohtsubo, K. Nakatogawa, K. Ueda, T. Sugimura, and K. Wakabayashi
Plasminogen activator inhibitor-1 (Pai-1) blockers suppress intestinal polyp formation in Min mice
Carcinogenesis, April 1, 2008; 29(4): 824 - 829.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. N. Ealey, S. Lu, D. Lau, and M. C. Archer
Reduced susceptibility of muscle-specific insulin receptor knockout mice to colon carcinogenesis
Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G679 - G686.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Panigrahy, A. Kaipainen, S. Huang, C. E. Butterfield, C. M. Barnes, M. Fannon, A. M. Laforme, D. M. Chaponis, J. Folkman, and M. W. Kieran
PPAR{alpha} agonist fenofibrate suppresses tumor growth through direct and indirect angiogenesis inhibition
PNAS, January 22, 2008; 105(3): 985 - 990.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
K. Sakano, M. Takahashi, M. Mutoh, N. Niho, M. Komiya, H. Sato, T. Tanaka, T. Sugimura, and K. Wakabayashi
Enhanced thyroid carcinogenicity of N-nitrosobis(2-oxopropyl)amine in Otsuka Long-Evans Tokushima Fatty rats, a model of type II diabetes mellitus
Carcinogenesis, October 1, 2007; 28(10): 2193 - 2198.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
W. Su, C. R. Bush, B. M. Necela, S. R. Calcagno, N. R. Murray, A. P. Fields, and E. A. Thompson
Differential expression, distribution, and function of PPAR-{gamma} in the proximal and distal colon
Physiol Genomics, August 20, 2007; 30(3): 342 - 353.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. R. Bush, J. M. Havens, B. M. Necela, W. Su, L. Chen, M. Yanagisawa, P. Z. Anastasiadis, R. Guerra, B. A. Luxon, and E. A. Thompson
Functional Genomic Analysis Reveals Cross-talk between Peroxisome Proliferator-activated Receptor {gamma} and Calcium Signaling in Human Colorectal Cancer Cells
J. Biol. Chem., August 10, 2007; 282(32): 23387 - 23401.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y. Takeuchi, M. Takahashi, K. Sakano, M. Mutoh, N. Niho, M. Yamamoto, H. Sato, T. Sugimura, and K. Wakabayashi
Suppression of N-nitrosobis(2-oxopropyl)amine-induced pancreatic carcinogenesis in hamsters by pioglitazone, a ligand of peroxisome proliferator-activated receptor {gamma}
Carcinogenesis, August 1, 2007; 28(8): 1692 - 1696.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pozzi, M. R. Ibanez, A. E. Gatica, S. Yang, S. Wei, S. Mei, J. R. Falck, and J. H. Capdevila
Peroxisomal Proliferator-activated Receptor-{alpha}-dependent Inhibition of Endothelial Cell Proliferation and Tumorigenesis
J. Biol. Chem., June 15, 2007; 282(24): 17685 - 17695.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. Govindarajan, L. Ratnasinghe, D. L. Simmons, E. R. Siegel, M. V. Midathada, L. Kim, P. J. Kim, R. J. Owens, and N. P. Lang
Thiazolidinediones and the Risk of Lung, Prostate, and Colon Cancer in Patients With Diabetes
J. Clin. Oncol., April 20, 2007; 25(12): 1476 - 1481.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Chintharlapalli, S. Papineni, and S. Safe
1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methanes inhibit colon cancer cell and tumor growth through PPAR{gamma}-dependent and PPAR{gamma}-independent pathways
Mol. Cancer Ther., May 1, 2006; 5(5): 1362 - 1370.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. A. Peraza, A. D. Burdick, H. E. Marin, F. J. Gonzalez, and J. M. Peters
The Toxicology of Ligands for Peroxisome Proliferator-Activated Receptors (PPAR)
Toxicol. Sci., April 1, 2006; 90(2): 269 - 295.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
M. Mutoh, T. Akasu, M. Takahashi, N. Niho, T. Yoshida, T. Sugimura, and K. Wakabayashi
Possible Involvement of Hyperlipidemia in Increasing Risk of Colorectal Tumor Development in Human Familial Adenomatous Polyposis
Jpn. J. Clin. Oncol., March 1, 2006; 36(3): 166 - 171.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. S. Kota, C. V. Ramana, F. A. Tenorio, R. I. Enelow, and J. C. Rutledge
Differential Effects of Lipoprotein Lipase on Tumor Necrosis Factor-{alpha} and Interferon-{gamma}-mediated Gene Expression in Human Endothelial Cells
J. Biol. Chem., September 2, 2005; 280(35): 31076 - 31084.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Niho, M. Mutoh, M. Takahashi, K. Tsutsumi, T. Sugimura, and K. Wakabayashi
Concurrent suppression of hyperlipidemia and intestinal polyp formation by NO-1886, increasing lipoprotein lipase activity in Min mice
PNAS, February 22, 2005; 102(8): 2970 - 2974.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L Hilakivi-Clarke, C Wang, M Kalil, R Riggins, and R G Pestell
Nutritional modulation of the cell cycle and breast cancer
Endocr. Relat. Cancer, December 1, 2004; 11(4): 603 - 622.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Hulit, C. Wang, Z. Li, C. Albanese, M. Rao, D. Di Vizio, S. Shah, S. W. Byers, R. Mahmood, L. H. Augenlicht, et al.
Cyclin D1 Genetic Heterozygosity Regulates Colonic Epithelial Cell Differentiation and Tumor Number in ApcMin Mice
Mol. Cell. Biol., September 1, 2004; 24(17): 7598 - 7611.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Chintharlapalli, R. Smith III, I. Samudio, W. Zhang, and S. Safe
1,1-Bis(3'-indolyl)-1-(p-substitutedphenyl)methanes Induce Peroxisome Proliferator-Activated Receptor {gamma}-Mediated Growth Inhibition, Transactivation, and Differentiation Markers in Colon Cancer Cells
Cancer Res., September 1, 2004; 64(17): 5994 - 6001.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. H. Itzkowitz and X. Yio
Inflammation and Cancer IV. Colorectal cancer in inflammatory bowel disease: the role of inflammation
Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G7 - G17.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niho, N.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niho, N.
Right arrow Articles by Wakabayashi, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online