| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
versus Hif-2
in Regulation of the Transcriptional Response to Hypoxia1
Cancer Research UK, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DU [H. M. S., J. M., A. L. H.], and Wellcome Trust Centre for Human Genetics, Oxford OX3 7BN [R. R., P. J. R.], United Kingdom
| ABSTRACT |
|---|
|
|
|---|
or Hif-2
and show markedly different cell type-specific effects on gene expression and cell migration. Remarkably, among a panel of hypoxia-inducible genes, responses were critically dependent on Hif-1
but not Hif-2
in both endothelial and breast cancer cells but critically dependent on Hif-2
in renal carcinoma cells. | Introduction |
|---|
|
|
|---|
subunits, Hif-1
and Hif-2
(also known as endothelial PER-ARNT-SIM domain protein 1) that dimerize with the constitutively expressed aryl hydrocarbon receptor nuclear translocator (also known as Hif-1ß; reviewed in Ref. 2
). Both Hif-
molecules are subject to similar regulatory processes involving enzymatic hydroxylation of conserved prolyl and asparaginyl residues that target them for degradation via the VHL ubiquitin E3 ligase complex (reviewed in Ref. 3
). Moreover, in transfection assays, both transcription factors activate a range of hypoxia response elements with similar efficacy (4
, 5)
.
Despite these striking similarities, genetic studies have provided firm evidence for nonredundant functions. Targeted inactivation of Hif-1
and Hif-2
in embryonic stem cells is associated with different patterns of response to hypoxia and low glucose stress (6)
, and different developmental defects are observed in Hif-1
-/- and Hif-2
-/- mouse embryos (for review see Ref. 3
). In part, differences may relate to distinct patterns of cellular expression. For instance, in the kidney, whereas both transcription factors are abundantly expressed, Hif-1
is the predominant form in epithelial cells, whereas Hif-2
is predominant in interstitial fibroblast and endothelial cells (7)
. However, many cancers and cell lines express both isoforms. The expression of the two Hif-
isoforms at similar levels in this setting might be predicted to lead to a level of redundancy. Nevertheless, overexpression of Hif-2
, but not Hif-1
, promoted growth of renal cell carcinoma cells (8
, 9)
yet inhibited growth of breast cells (10)
, suggesting distinct effects on biology. These findings raise important questions as to what extent Hif-1
and Hif-2
have overlapping or redundant transcriptional functions in the cancer setting, whether expression of particular Hif transcriptional targets are always linked to expression of a particular Hif-
isoforms, or whether transcriptional selectivity varies according to cell background.
We have used siRNAs to specifically inhibit Hif-1
and Hif-2
production in human breast and renal carcinoma cell lines and in a human endothelial cell line, which express differing levels of Hif-1
and Hif-2
, ranging from isolated expression of Hif-1
to isolated expression of Hif-2
. The role of each molecule on induction of specific transcriptional targets with a variety of functions in the hypoxic response was then investigated.
| Materials and Methods |
|---|
|
|
|---|
siRNA duplex targeted nucleotides 15211541 of the Hif-1
mRNA sequence (NM001530) and comprised of: sense 5'-CUGAUGACCAGCAACUUGAdTdT-3' and antisense 5'-UCAAGUUGCUGGUCAUCAGdTdT-3'. The Hif-2
siRNA duplex targeted nucleotides 12601280 of the Hif-2
mRNA sequence (NM001430) and comprised of sense 5'-CAGCAUCUUUGAUAGCAGUdTdT-3' and antisense 5'-ACUGCUAUCAAAGAUGCUGdTdT-3'. The inverted Hif-1
control duplex did not target any gene and comprised of sense 5'-AGUUCAACGACCAGUAGUCdTdT-3' and antisense 5'-GACUACUGGUCGUUGAdTdT-3'. Duplexes were prepared by mixing 50-µM concentrations of antisense and sense oligonucleotides with annealing buffer [30 mM HEPES (pH 7.0), 100 mM potassium acetate, and 2 mM magnesium acetate], heat denaturing for 1 min at 85°C, and annealing at 37°C for 1 h. Duplex formation was confirmed by electrophoresis through 5% low melting temperature agarose (NuSieve GTG; FMC Bioproducts, Rockland, ME). Additional siRNA duplexes used for confirmation of the specificity of particular effects were prepared as above and targeted to nucleotides 15101530 (AACGACACAGAAACTGATGAC) of the Hif-1
mRNA sequence and nucleotides 328348 (AAATCAGCTTCCTGCGAACAC) of the Hif-2
mRNA sequence.
Cell Culture.
MDA 435 cells, MDA 468 cells (breast cancer), 786-0 cells (renal cancer), and HUVECs (endothelial) were obtained from the Cancer Research United Kingdom cell service. Breast and renal cancer cells were grown in DMEM supplemented with 10% FCS (Globepharm), L-glutamine (2 µM), penicillin (50 IU/ml), and streptomycin sulfate (50 µg/ml). HUVECs were grown in the media supplemented as above but with 20% FCS plus endothelial cell growth supplement and heparin (Sigma) and grown on plates coated with 2% gelatin/PBS. Experiments were performed on dishes of cells in normoxia (humidified air with 5% CO2) or hypoxia [hypoxic conditions were generated in a Napco 7001 incubator (Precision Scientific) with 0.1% O2, 5% CO2, and balance N2].
siRNA Treatment of Cells.
Cells were plated onto 10-cm2 cell culture dishes and grown to 3050% confluence before transfection. The duplexes were diluted to give a final concentration of 20 nM in Opti-Mem I (Invitrogen life Technologies, San Diego, CA). Twenty-five µl of Oligofectamine transfection reagent (Invitrogen Life Technologies) were added, and the mixture incubated at room temperature for 25 min. The cells were rinsed with Opti-Mem I to remove any residual serum and incubated with the oligonucleotide duplexes in serum-free conditions for 4 h at 37°C. Serum was then added back to the culture, and cells were incubated for an additional 24 h before beginning an experiment.
RNA Preparation and RNase Protection Assay.
Cells were rinsed with PBS and drained thoroughly. RNA was extracted from the cells using the solution D method described by Chomczynski and Sacchi (12)
and assessed by absorbance at 260/280 nm. The RNase protection assay protocol and generation of 32P-labeled RNA probes to Hif-1
, Hif-2
, and U6 small nuclear RNA has been described previously (4)
. Protected fragments were resolved on an 8% polyacrylamide gel and analyzed on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Western Blotting.
Cells were washed thoroughly with PBS before being homogenized in a lysis buffer containing 8 M urea, 10% SDS, 1 M DTT, and protease inhibitors. Samples were electrophoresed on a 10% SDS-PAGE gel and transferred onto a polyvinylidene difluoride membrane (Millipore, Bedfordshire, United Kingdom). Proteins were detected using monoclonal antibodies to Hif-1
(Signal Transduction Laboratories), Hif-2
(4)
, CA9 (13)
, GLUT-1 (Alpha Diagnostic, San Antonio, TX), glyceraldehyde-3-phosphate dehydrogenase (Abcam, Cambridge, United Kingdom), and BNip3 (14)
at 1:1,000, 1:1,000, 1:500, 1:250, 1:2,000, and 1:20,000, respectively. As a loading control, a mouse monoclonal antibody to ß-tubulin (Sigma) was used at 1:20,000. Overnight primary antibody incubation was followed by incubation with goat antimouse or rabbit horseradish peroxidase (Dako) and enhanced chemiluminescence developing reagents (Amersham). Blots were exposed to film for between 30 s and 2 min.
Measurement of VEGF and uPAR.
Supernatant was harvested from treated cells and centrifuged to remove cell debris. Secreted VEGF and uPAR were measured in the supernatant using the respective Quantikine ELISA kit (R&D Systems, Abingdon, United Kingdom) as per the manufacturers instructions. The amount of VEGF and uPAR in the supernatant was normalized to the final number of cells in the dish from which it was harvested.
Cell Migration Assay.
Cells treated with siRNA as described above were incubated in 0.1% oxygen for 16 h, removed from the culture dish using 2 mM EDTA, and resuspended in 1% FCS media. A total of 200 µl of serum-free media containing 1.5 x 104 cells was placed into the top of migration chambers with 8-µm filters (24-well plate format; Falcon), which were standing in wells containing 700 µl of media containing 10% FCS. The cells were incubated at 37°C for 4 h, after which the chambers were removed from the wells and coded for analysis by a blinded observer. Cells that had migrated to the bottom of the filter were fixed with 2.5% glutaraldehyde for 15 min, rinsed thoroughly with PBS, and stained with 0.1% crystal violet for 2 min. The total number of cells on the bottom of each filter was counted under a microscope, and each experiment was performed in triplicate on at least three occasions.
| Results |
|---|
|
|
|---|
and Hif-2
.
or Hif-2
mRNAs for degradation and transfected these into cells 24 h before hypoxic stimulation. RNA extracted from the treated cells was subjected to RNAse Protection Assay analysis for Hif-1
and Hif-2
. MDA 468 and HUVECs expressed transcripts encoding both Hif-1
and Hif-2
(Fig. 1)
mRNA (Fig. 1)
mRNA (Fig. 1)
and Hif-2
mRNA specifically in that the Hif-1
siRNA did not affect the Hif-2
gene expression and vice versa (Fig. 1)
and Hif-2
siRNAs had no effect on the expression of either gene; the inverted Hif-1
siRNA was used as the control in all experiments described (Figs. 1
and Hif-2
was ablated. No cell toxicity was noted after transfection with either of the siRNAs or with Oligofectamine alone (described as the negative control). To confirm the specificity of the technique, siRNAs targeted to another region of the Hif-1
and Hif-2
mRNAs were synthesized and transfected into MDA 468 cells, which were then subjected to hypoxic stimulation. The results obtained with these siRNAs were the same as described above in respect to specificity of Hif-1
and Hif-2
targeting (data not shown).
|
|
|
|
and Hif-2
.
and Hif-2
in conferring such responses in different cell backgrounds, we analyzed the expression of CA9 (acid metabolism), BNip3 (cell death), GLUT-1 (glucose/energy metabolism), VEGF (angiogenesis), and uPAR (proteolytic pathway of invasion) in MDA 435 cells, MDA 468 cells (breast carcinoma), 786-0 cells (renal carcinoma), and HUVECs (endothelial) after treatment with Hif-1
and/or Hif-2
siRNA. Protein levels were measured using Western blot analysis (CA9, BNip3, and GLUT-1) or ELISA (VEGF and uPAR).
Analysis of the breast carcinoma cell lines revealed that MDA 468 cells expressed both Hif-1
and Hif-2
protein (Fig. 2)
, whereas MDA 435 cells expressed only Hif-1
protein (data not shown). In both cell lines, hypoxic induction of CA9, BNip3, GLUT-1, VEGF, and uPAR protein was inhibited by treatment with Hif-1
siRNA but not affected by Hif-2
siRNA. Silencing both Hif-1
and Hif-2
had the same effect as silencing with Hif-1
, and the inverted control siRNA had no effect on the expression of any of the genes (Fig. 2
; data not shown). The same results were obtained when MDA 468 cells were transfected with the confirmatory siRNAs (data not shown).
Similar to the MDA 468 cell lines, HUVECs expressed both Hif-1
and Hif-2
protein after hypoxic stimulus (Fig. 2)
. Hypoxia did not induce HUVECs to express CA9 or secrete VEGF but did increase the levels of expression of BNip3, GLUT-1, and uPAR. Pretreatment of HUVECs with siRNA to Hif-1
ablated the hypoxic induction of BNip3, GLUT-1, and uPAR, but Hif-2
siRNA treatment had no effect on protein production (Fig. 2)
.
The renal carcinoma cell line 786-0 expressed Hif-2
but not Hif-1
, and because this cell line lacks functional VHL, expression of Hif-2
was seen constitutively under normoxic conditions (Fig. 3)
. VEGF and GLUT-1 proteins were also constitutively expressed, but BNip3 and CA9 proteins were not expressed at detectable levels. uPAR was constitutively expressed by 786-0 cells but at 2-fold lower levels than by breast or endothelial cells. Treatment of cells with siRNA to Hif-2
reduced the expression of GLUT-1 and VEGF, whereas siRNA to Hif-1
had no effect (Fig. 3)
. Expression of uPAR was not affected by siRNA to Hif-1
or Hif-2
.
Cell Migration Induced by Hypoxia Is Affected by Pretreatment with siRNA to Hif-1
or Hif-2
Depending on the Cell Type.
Intratumoral hypoxia is correlated with increased risk of invasion in human cancer (1)
, and hypoxia increases the invasion of colon carcinoma cells (16)
. To elucidate which hypoxia-induced transcription factor is involved in this process, we analyzed MDA 468 and HUVE cells treated with siRNA for Hif-1
or Hif-2
and normoxia or hypoxia in a cell migration assay. Cells subjected to hypoxia showed increased migration compared with the cells that had remained in normoxia, and treatment with inverted siRNA or mock transfection had no effect on the migration response. In MDA 435 cells, the hypoxic response was inhibited by treatment with siRNA directed to Hif-1
but not to Hif-2
. However, in MDA 468 and HUVECs, hypoxically induced migration was inhibited by pretreatment of the cells with either Hif-1
or Hif-2
siRNA. Treatment of cells with both siRNAs inhibited the hypoxically induced migration response in both cell lines but not more than with either alone (Fig. 4)
.
| Discussion |
|---|
|
|
|---|
or Hif-2
. After treatment with siRNA, the expression of Hif-1
or Hif-2
mRNA and protein was greatly reduced under hypoxic conditions. The effects of these siRNAs were analyzed in two human breast carcinoma cell lines, a human endothelial cell line, and a human renal carcinoma cell line containing an inactivating mutation in VHL.
Our results indicate that in the breast carcinoma and endothelial cell lines, the major Hif-
isoform required for induction of a set of well-characterized hypoxic genes is Hif-1
. Surprisingly, even in cells expressing both Hif-
isoforms, Hif-2
did not substitute in regulating any of these genes when Hif-1
was inactivated. Nevertheless, functional analysis of the endothelial and breast carcinoma cell lines revealed that both Hif-1
and Hif-2
are required for hypoxia-induced cell migration in cell lines that express both proteins, suggesting that there are other actions of Hif-2
that have not been revealed in our studies of gene expression. Overall, however, the importance of Hif-1
in these cells is in concordance with other studies that have reported Hif-1
as a positive factor in tumor growth (17)
and carcinoma cell invasion (16)
in different cells. The hypothesis that Hif-1
is the major hypoxia-induced transcription factor involved in breast carcinogenesis is supported by evidence that one of the breast carcinoma cell lines used in this study has lost Hif-2
expression, and stable transfection of this cell line with Hif-2
resulted in its impaired growth as xenograft tumors compared with the parental line (10)
.
In contrast with the above results, we found that in the VHL-defective 786-0 renal carcinoma line, in which the native Hif-1
gene is not expressed, some of the hypoxia-inducible transcripts were now critically dependent of Hif-2
. VHL is required for proteolytic regulation of both Hif-1
and Hif-2
, and in VHL defective cells both isoforms are stabilized. However, there is an unusual bias toward enhanced Hif-2
mRNA expression in clear cell renal carcinoma that is not observed in the renal tubular epithelium from which these tumors are derived (7)
but arises during tumor development (18)
. This may be because of an additional action of VHL on the Hif system (19
, 20)
and/or additional non-VHL mediated actions on Hif
isoforms that arise during the oncogenic process. The current results suggest the existence of another distinct interface between the HIF system and renal carcinogenesis that makes connections between Hif-2
expression and certain hypoxia-inducible mRNAs. The finding that the Hif-2
pathway appears to be specifically activated in clear cell renal carcinogenesis by several steps strongly suggests a causal role for Hif-2
in development of the cancer. Interestingly, this is supported by comparison of results from two groups that have examined the expression of mutant forms of Hif-1
or Hif-2
that escape VHL-mediated destruction on the tumor suppressor effect of expressing wild-type VHL in renal cell carcinoma cells. These studies have shown that stabilized Hif-2
but not Hif-1
reverses VHL tumor suppressor function (8
, 9) .
In conclusion, these studies have, for the first time, directly compared functional inactivation of Hif-1
and Hif-2
in different cancer cell lines. The findings indicate that the actions are distinct and differ according to cell background and suggest that these differences are important in tumor development.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 H. M. S., J. M. and A. L. H. were funded by Cancer Research United Kingdom and P. J. R. by the Wellcome Trust. R. R. is a Rhodes scholar. ![]()
2 To whom requests for reprints should be addressed, at Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom. Phone: 44-1865-222457; Fax: 44-1865-222431; E-mail: harrisa{at}cancer.org.uk ![]()
3 The abbreviations used are: Hif, hypoxia-inducible factor; CA9, carbonic anhydrase 9; GLUT-1, glucose transporter-1; HUVEC, human umbilical vein endothelial cell; siRNA, short interfering RNA; uPAR, urokinase-type plasminogen activator receptor; VEGF, vascular endothelial growth factor; VHL, von Hippel-Lindau. ![]()
Received 7/ 7/03. Revised 8/12/03. Accepted 8/15/03.
| REFERENCES |
|---|
|
|
|---|
. Blood, 92: 2260-2268, 1998.
in response to hypoxia: their stabilisation and redox signal-induced interaction with CBP/p300. EMBO J., 18: 1905-1914, 1999.[Medline]
is involved in the apoptotic response to hypoglycemia but not to hypoxia. J. Biol. Chem., 276: 39192-39196, 2001.
and -2
in hypoxic and ischemic rat kidneys. J. Am. Soc. Nephrol., 13: 1974-1976, 2002.
to the phenotype of VHL loss in renal cell carcinoma. Cancer Cell, 1: 247-255, 2002.[Medline]
and HIF-2
expression to vascular endothelial growth factor induction and hypoxia survival in human breast cancer cell lines. Cancer Res., 60: 7106-7113, 2000.
is a positive factor in solid tumor growth. Cancer Res., 60: 4010-4015, 2000.
and HIF-2
under normoxic conditions in renal carcinoma cells by von Hippel-Lindau tumor suppressor gene loss function. Oncogene, 19: 5435-5443, 2000.[Medline]
This article has been cited by other articles:
![]() |
S. Kroening, E. Neubauer, J. Wessel, M. Wiesener, and M. Goppelt-Struebe Hypoxia interferes with connective tissue growth factor (CTGF) gene expression in human proximal tubular cell lines Nephrol. Dial. Transplant., November 1, 2009; 24(11): 3319 - 3325. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kikuchi, M. S. Pino, M. Zeng, S. Shirasawa, and D. C. Chung Oncogenic KRAS and BRAF Differentially Regulate Hypoxia-Inducible Factor-1{alpha} and -2{alpha} in Colon Cancer Cancer Res., November 1, 2009; 69(21): 8499 - 8506. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gunaratnam and J. V. Bonventre HIF in Kidney Disease and Development J. Am. Soc. Nephrol., September 1, 2009; 20(9): 1877 - 1887. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Asplund, G. Ostergren-Lunden, G. Camejo, P. Stillemark-Billton, and G. Bondjers Hypoxia increases macrophage motility, possibly by decreasing the heparan sulfate proteoglycan biosynthesis J. Leukoc. Biol., August 1, 2009; 86(2): 381 - 388. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Fang, R. Hughes, C. Murdoch, S. B. Coffelt, S. K. Biswas, A. L. Harris, R. S. Johnson, H. Z. Imityaz, M. C. Simon, E. Fredlund, et al. Hypoxia-inducible factors 1 and 2 are important transcriptional effectors in primary macrophages experiencing hypoxia Blood, July 23, 2009; 114(4): 844 - 859. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Mole, C. Blancher, R. R. Copley, P. J. Pollard, J. M. Gleadle, J. Ragoussis, and P. J. Ratcliffe Genome-wide Association of Hypoxia-inducible Factor (HIF)-1{alpha} and HIF-2{alpha} DNA Binding with Expression Profiling of Hypoxia-inducible Transcripts J. Biol. Chem., June 19, 2009; 284(25): 16767 - 16775. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Michaud, G. A. Robitaille, J.-P. Gratton, and D. E. Richard Sphingosine-1-Phosphate: A Novel Nonhypoxic Activator of Hypoxia-Inducible Factor-1 in Vascular Cells Arterioscler Thromb Vasc Biol, June 1, 2009; 29(6): 902 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Burkitt, S. Y. Chun, D. T. Dang, and L. H. Dang Targeting both HIF-1 and HIF-2 in human colon cancer cells improves tumor response to sunitinib treatment Mol. Cancer Ther., May 1, 2009; 8(5): 1148 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lakhal, N. P. Talbot, A. Crosby, C. Stoepker, A. R. M. Townsend, P. A. Robbins, C. W. Pugh, P. J. Ratcliffe, and D. R. Mole Regulation of growth differentiation factor 15 expression by intracellular iron Blood, February 12, 2009; 113(7): 1555 - 1563. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rohwer, M. Welzel, K. Daskalow, D. Pfander, B. Wiedenmann, K. Detjen, and T. Cramer Hypoxia-Inducible Factor 1{alpha} Mediates Anoikis Resistance via Suppression of {alpha}5 Integrin Cancer Res., December 15, 2008; 68(24): 10113 - 10120. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Helczynska, A.-M. Larsson, L. Holmquist Mengelbier, E. Bridges, E. Fredlund, S. Borgquist, G. Landberg, S. Pahlman, and K. Jirstrom Hypoxia-Inducible Factor-2{alpha} Correlates to Distant Recurrence and Poor Outcome in Invasive Breast Cancer Cancer Res., November 15, 2008; 68(22): 9212 - 9220. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-B. Han, H. Ren, H. Zhao, Y. Chi, K. Chen, B. Zhou, Y.-j. Liu, L. Zhang, B. Xu, B. Liu, et al. Hypoxia-inducible factor (HIF)-1{alpha} directly enhances the transcriptional activity of stem cell factor (SCF) in response to hypoxia and epidermal growth factor (EGF) Carcinogenesis, October 1, 2008; 29(10): 1853 - 1861. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hervouet, A. Cizkova, J. Demont, A. Vojtiskova, P. Pecina, N. L.W. Franssen-van Hal, J. Keijer, H. Simonnet, R. Ivanek, S. Kmoch, et al. HIF and reactive oxygen species regulate oxidative phosphorylation in cancer Carcinogenesis, August 1, 2008; 29(8): 1528 - 1537. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Taguchi, K. Yanagisawa, M. Tanaka, K. Cao, Y. Matsuyama, H. Goto, and T. Takahashi Identification of Hypoxia-Inducible Factor-1{alpha} as a Novel Target for miR-17-92 MicroRNA Cluster Cancer Res., July 15, 2008; 68(14): 5540 - 5545. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Basu, A. G. Contreras, D. Datta, E. Flynn, L. Zeng, H. T. Cohen, D. M. Briscoe, and S. Pal Overexpression of Vascular Endothelial Growth Factor and the Development of Post-Transplantation Cancer Cancer Res., July 15, 2008; 68(14): 5689 - 5698. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Gerber and J. S. Pober IFN-{alpha} Induces Transcription of Hypoxia-Inducible Factor-1{alpha} to Inhibit Proliferation of Human Endothelial Cells J. Immunol., July 15, 2008; 181(2): 1052 - 1062. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamashita, K. Ohneda, M. Nagano, C. Miyoshi, N. Kaneko, Y. Miwa, M. Yamamoto, O. Ohneda, and Y. Fujii-Kuriyama Hypoxia-inducible Transcription Factor-2{alpha} in Endothelial Cells Regulates Tumor Neovascularization through Activation of Ephrin A1 J. Biol. Chem., July 4, 2008; 283(27): 18926 - 18936. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Puppo, F. Battaglia, C. Ottaviano, S. Delfino, D. Ribatti, L. Varesio, and M. C. Bosco Topotecan inhibits vascular endothelial growth factor production and angiogenic activity induced by hypoxia in human neuroblastoma by targeting hypoxia-inducible factor-1{alpha} and -2{alpha} Mol. Cancer Ther., July 1, 2008; 7(7): 1974 - 1984. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Champion, M. Guinea, V. Dammai, and T. Hsu Endothelial Function of von Hippel-Lindau Tumor Suppressor Gene: Control of Fibroblast Growth Factor Receptor Signaling Cancer Res., June 15, 2008; 68(12): 4649 - 4657. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Seifeddine, A. Dreiem, E. Blanc, M.-C. Fulchignoni-Lataud, M.-A. L. F. Belda, F. Lecuru, T. H. Mayi, N. Mazure, V. Favaudon, C. Massaad, et al. Hypoxia Down-regulates CCAAT/Enhancer Binding Protein-{alpha} Expression in Breast Cancer Cells Cancer Res., April 1, 2008; 68(7): 2158 - 2165. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Battaglia, S. Delfino, E. Merello, M. Puppo, R. Piva, L. Varesio, and M. C. Bosco Hypoxia transcriptionally induces macrophage-inflammatory protein-3{alpha}/CCL-20 in primary human mononuclear phagocytes through nuclear factor (NF)-{kappa}B J. Leukoc. Biol., March 1, 2008; 83(3): 648 - 662. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Carroll and M. Ashcroft Regulation of Angiogenic Factors by HDM2 in Renal Cell Carcinoma Cancer Res., January 15, 2008; 68(2): 545 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sathornsumetee, Y. Cao, J. E. Marcello, J. E. Herndon II, R. E. McLendon, A. Desjardins, H. S. Friedman, M. W. Dewhirst, J. J. Vredenburgh, and J. N. Rich Tumor Angiogenic and Hypoxic Profiles Predict Radiographic Response and Survival in Malignant Astrocytoma Patients Treated With Bevacizumab and Irinotecan J. Clin. Oncol., January 10, 2008; 26(2): 271 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Martens, K. M. Kirschner, C. Warnecke, and H. Scholz Hypoxia-inducible Factor-1 (HIF-1) Is a Transcriptional Activator of the TrkB Neurotrophin Receptor Gene J. Biol. Chem., May 11, 2007; 282(19): 14379 - 14388. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kojima, T. Tanaka, R. Inagi, H. Kato, T. Yamashita, A. Sakiyama, O. Ohneda, N. Takeda, M. Sata, T. Miyata, et al. Protective Role of Hypoxia-Inducible Factor-2{alpha} against Ischemic Damage and Oxidative Stress in the Kidney J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1218 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shinojima, M. Oya, A. Takayanagi, R. Mizuno, N. Shimizu, and M. Murai Renal cancer cells lacking hypoxia inducible factor (HIF)-1{alpha} expression maintain vascular endothelial growth factor expression through HIF-2{alpha} Carcinogenesis, March 1, 2007; 28(3): 529 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Viemann, M. Schmidt, K. Tenbrock, S. Schmid, V. Muller, K. Klimmek, S. Ludwig, J. Roth, and M. Goebeler The Contact Allergen Nickel Triggers a Unique Inflammatory and Proangiogenic Gene Expression Pattern via Activation of NF-{kappa}B and Hypoxia-Inducible Factor-1{alpha} J. Immunol., March 1, 2007; 178(5): 3198 - 3207. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. An and M. B. Rettig Epidermal growth factor receptor inhibition sensitizes renal cell carcinoma cells to the cytotoxic effects of bortezomib Mol. Cancer Ther., January 1, 2007; 6(1): 61 - 69. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Asikainen, N. S. Waleh, B. K. Schneider, R. I. Clyman, and C. W. White Enhancement of angiogenic effectors through hypoxia-inducible factor in preterm primate lung in vivo Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L588 - L595. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Guzy and P. T. Schumacker Oxygen sensing by mitochondria at complex III: the paradox of increased reactive oxygen species during hypoxia Exp Physiol, September 1, 2006; 91(5): 807 - 819. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaluz, M. Kaluzova, and E. J. Stanbridge Proteasomal Inhibition Attenuates Transcriptional Activity of Hypoxia-Inducible Factor 1 (HIF-1) via Specific Effect on the HIF-1{alpha} C-Terminal Activation Domain Mol. Cell. Biol., August 1, 2006; 26(15): 5895 - 5907. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Esteban, S. K. Harten, M. G. Tran, and P. H. Maxwell Formation of Primary Cilia in the Renal Epithelium Is Regulated by the von Hippel-Lindau Tumor Suppressor Protein J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1801 - 1806. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zheng, J. L. Ruas, R. Cao, F. A. Salomons, Y. Cao, L. Poellinger, and T. Pereira Cell-Type-Specific Regulation of Degradation of Hypoxia-Inducible Factor 1{alpha}: Role of Subcellular Compartmentalization Mol. Cell. Biol., June 15, 2006; 26(12): 4628 - 4641. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Carroll and M. Ashcroft Role of Hypoxia-Inducible Factor (HIF)-1{alpha} versus HIF-2{alpha} in the Regulation of HIF Target Genes in Response to Hypoxia, Insulin-Like Growth Factor-I, or Loss of von Hippel-Lindau Function: Implications for Targeting the HIF Pathway. Cancer Res., June 15, 2006; 66(12): 6264 - 6270. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Elvidge, L. Glenny, R. J. Appelhoff, P. J. Ratcliffe, J. Ragoussis, and J. M. Gleadle Concordant Regulation of Gene Expression by Hypoxia and 2-Oxoglutarate-dependent Dioxygenase Inhibition: THE ROLE OF HIF-1{alpha}, HIF-2{alpha}, AND OTHER PATHWAYS J. Biol. Chem., June 2, 2006; 281(22): 15215 - 15226. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Okuyama, B. Krishnamachary, Y. F. Zhou, H. Nagasawa, M. Bosch-Marce, and G. L. Semenza Expression of Vascular Endothelial Growth Factor Receptor 1 in Bone Marrow-derived Mesenchymal Cells Is Dependent on Hypoxia-inducible Factor 1 J. Biol. Chem., June 2, 2006; 281(22): 15554 - 15563. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Aprelikova, M. Wood, S. Tackett, G. V.R. Chandramouli, and J. C. Barrett Role of ETS Transcription Factors in the Hypoxia-Inducible Factor-2 Target Gene Selection Cancer Res., June 1, 2006; 66(11): 5641 - 5647. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Esteban, M. G.B. Tran, S. K. Harten, P. Hill, M. C. Castellanos, A. Chandra, R. Raval, T. S. O'Brien, and P. H. Maxwell Regulation of E-cadherin Expression by VHL and Hypoxia-Inducible Factor. Cancer Res., April 1, 2006; 66(7): 3567 - 3575. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dayan, D. Roux, M. C. Brahimi-Horn, J. Pouyssegur, and N. M. Mazure The Oxygen Sensor Factor-Inhibiting Hypoxia-Inducible Factor-1 Controls Expression of Distinct Genes through the Bifunctional Transcriptional Character of Hypoxia-Inducible Factor-1{alpha}. Cancer Res., April 1, 2006; 66(7): 3688 - 3698. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Knowles, D. R. Mole, P. J. Ratcliffe, and A. L. Harris Normoxic Stabilization of Hypoxia-Inducible Factor-1{alpha} by Modulation of the Labile Iron Pool in Differentiating U937 Macrophages: Effect of Natural Resistance-Associated Macrophage Protein 1. Cancer Res., March 1, 2006; 66(5): 2600 - 2607. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Koukourakis, S. M. Bentzen, A. Giatromanolaki, G. D. Wilson, F. M. Daley, M. I. Saunders, S. Dische, E. Sivridis, and A. L. Harris Endogenous Markers of Two Separate Hypoxia Response Pathways (hypoxia inducible factor 2 alpha and carbonic anhydrase 9) Are Associated With Radiotherapy Failure in Head and Neck Cancer Patients Recruited in the CHART Randomized Trial J. Clin. Oncol., February 10, 2006; 24(5): 727 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Cowden Dahl, B. H. Fryer, F. A. Mack, V. Compernolle, E. Maltepe, D. M. Adelman, P. Carmeliet, and M. C. Simon Hypoxia-Inducible Factors 1{alpha} and 2{alpha} Regulate Trophoblast Differentiation Mol. Cell. Biol., December 1, 2005; 25(23): 10479 - 10491. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Semenza Involvement of Hypoxia-Inducible Factor 1 in Pulmonary Pathophysiology Chest, December 1, 2005; 128(6_suppl): 592S - 594S. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Semenza Involvement of Hypoxia-Inducible Factor 1 in Pulmonary Pathophysiology Chest, December 1, 2005; 128(6_suppl): 592S - 594S. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Sears and G. Hoppe Triamcinolone Acetonide Destabilizes VEGF mRNA in Muller Cells under Continuous Cobalt Stimulation Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4336 - 4341. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Patel, J.-L. Li, D. Generali, R. Poulsom, D. W. Cranston, and A. L. Harris Up-regulation of Delta-like 4 Ligand in Human Tumor Vasculature and the Role of Basal Expression in Endothelial Cell Function Cancer Res., October 1, 2005; 65(19): 8690 - 8697. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bilton, N. Mazure, E. Trottier, M. Hattab, M.-A. Dery, D. E. Richard, J. Pouyssegur, and M. C. Brahimi-Horn Arrest-defective-1 Protein, an Acetyltransferase, Does Not Alter Stability of Hypoxia-inducible Factor (HIF)-1{alpha} and Is Not Induced by Hypoxia or HIF J. Biol. Chem., September 2, 2005; 280(35): 31132 - 31140. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. An and M. B. Rettig Mechanism of von Hippel-Lindau Protein-Mediated Suppression of Nuclear Factor kappa B Activity Mol. Cell. Biol., September 1, 2005; 25(17): 7546 - 7556. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Raval, K. W. Lau, M. G. B. Tran, H. M. Sowter, S. J. Mandriota, J.-L. Li, C. W. Pugh, P. H. Maxwell, A. L. Harris, and P. J. Ratcliffe Contrasting Properties of Hypoxia-Inducible Factor 1 (HIF-1) and HIF-2 in von Hippel-Lindau-Associated Renal Cell Carcinoma Mol. Cell. Biol., July 1, 2005; 25(13): 5675 - 5686. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Smith, L. Gunaratnam, M. Morley, A. Franovic, K. Mekhail, and S. Lee Silencing of Epidermal Growth Factor Receptor Suppresses Hypoxia-Inducible Factor-2-Driven VHL-/- Renal Cancer Cancer Res., June 15, 2005; 65(12): 5221 - 5230. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Rankin, D. F. Higgins, J. A. Walisser, R. S. Johnson, C. A. Bradfield, and V. H. Haase Inactivation of the Arylhydrocarbon Receptor Nuclear Translocator (Arnt) Suppresses von Hippel-Lindau Disease-Associated Vascular Tumors in Mice Mol. Cell. Biol., April 15, 2005; 25(8): 3163 - 3172. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Wang, D. A. Davis, M. Haque, L. E. Huang, and R. Yarchoan Differential Gene Up-Regulation by Hypoxia-Inducible Factor-1{alpha} and Hypoxia-Inducible Factor-2{alpha} in HEK293T Cells Cancer Res., April 15, 2005; 65(8): 3299 - 3306. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Covello, M. C. Simon, and B. Keith Targeted Replacement of Hypoxia-Inducible Factor-1{alpha} by a Hypoxia-Inducible Factor-2{alpha} Knock-in Allele Promotes Tumor Growth Cancer Res., March 15, 2005; 65(6): 2277 - 2286. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A.J. Kempf, M. Lebiedziejewski, K. Alitalo, J.-H. Walzlein, U. Ehehalt, J. Fiebig, S. Huber, B. Schutt, C. A. Sander, S. Muller, et al. Activation of Hypoxia-Inducible Factor-1 in Bacillary Angiomatosis: Evidence for a Role of Hypoxia-Inducible Factor-1 in Bacterial Infections Circulation, March 1, 2005; 111(8): 1054 - 1062. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Eisenhofer, T-T Huynh, K Pacak, F M Brouwers, M M Walther, W M Linehan, P J Munson, M Mannelli, D S Goldstein, and A G Elkahloun Distinct gene expression profiles in norepinephrine- and epinephrine-producing hereditary and sporadic pheochromocytomas: activation of hypoxia-driven angiogenic pathways in von Hippel-Lindau syndrome Endocr. Relat. Cancer, December 1, 2004; 11(4): 897 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. P. Stolze, Y.-M. Tian, R. J. Appelhoff, H. Turley, C. C. Wykoff, J. M. Gleadle, and P. J. Ratcliffe Genetic Analysis of the Role of the Asparaginyl Hydroxylase Factor Inhibiting Hypoxia-inducible Factor (HIF) in Regulating HIF Transcriptional Target Genes J. Biol. Chem., October 8, 2004; 279(41): 42719 - 42725. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Acker and H. Acker Cellular oxygen sensing need in CNS function: physiological and pathological implications J. Exp. Biol., August 15, 2004; 207(18): 3171 - 3188. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Semenza Hydroxylation of HIF-1: Oxygen Sensing at the Molecular Level Physiology, August 1, 2004; 19(4): 176 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Takeda, K. Maemura, Y. Imai, T. Harada, D. Kawanami, T. Nojiri, I. Manabe, and R. Nagai Endothelial PAS Domain Protein 1 Gene Promotes Angiogenesis Through the Transactivation of Both Vascular Endothelial Growth Factor and Its Receptor, Flt-1 Circ. Res., July 23, 2004; 95(2): 146 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Uchida, F. Rossignol, M. A. Matthay, R. Mounier, S. Couette, E. Clottes, and C. Clerici Prolonged Hypoxia Differentially Regulates Hypoxia-inducible Factor (HIF)-1{alpha} and HIF-2{alpha} Expression in Lung Epithelial Cells: IMPLICATION OF NATURAL ANTISENSE HIF-1{alpha} J. Biol. Chem., April 9, 2004; 279(15): 14871 - 14878. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zimmer, D. Doucette, N. Siddiqui, and O. Iliopoulos Inhibition of Hypoxia-Inducible Factor Is Sufficient for Growth Suppression of VHL-/- Tumors Mol. Cancer Res., February 1, 2004; 2(2): 89 - 95. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |