Cancer Research Cell Death Mechanisms and Cancer Therapy  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sowter, H. M.
Right arrow Articles by Harris, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sowter, H. M.
Right arrow Articles by Harris, A. L.
[Cancer Research 63, 6130-6134, October 1, 2003]
© 2003 American Association for Cancer Research


Advances in Brief

Predominant Role of Hypoxia-Inducible Transcription Factor (Hif)-1{alpha} versus Hif-2{alpha} in Regulation of the Transcriptional Response to Hypoxia1

Heidi M. Sowter, Raju Raval, John Moore, Peter J. Ratcliffe and Adrian L. Harris2

Cancer Research UK, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DU [H. M. S., J. M., A. L. H.], and Wellcome Trust Centre for Human Genetics, Oxford OX3 7BN [R. R., P. J. R.], United Kingdom


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Tumor hypoxia induces the up-regulation of a gene program associated with angiogenesis, glycolysis, adaptation to pH, and apoptosis via the hypoxia-inducible transcription factors (Hifs) 1 and 2. Disruption of this pathway has been proposed as a cancer therapy. Here, we use short interfering RNAs to compare specific inactivation of Hif-1{alpha} or Hif-2{alpha} and show markedly different cell type-specific effects on gene expression and cell migration. Remarkably, among a panel of hypoxia-inducible genes, responses were critically dependent on Hif-1 {alpha} but not Hif-2 {alpha} in both endothelial and breast cancer cells but critically dependent on Hif-2 {alpha} in renal carcinoma cells.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Hypoxia is an important process in the progression and treatment resistance of many human cancers (1) . The majority of human cells share a common mechanism of oxygen sensing mediated by Hifs3 1 and 2. These proteins are heterodimers consisting of {alpha} subunits, Hif-1{alpha} and Hif-2{alpha} (also known as endothelial PER-ARNT-SIM domain protein 1) that dimerize with the constitutively expressed aryl hydrocarbon receptor nuclear translocator (also known as Hif-1ß; reviewed in Ref. 2 ). Both Hif-{alpha} molecules are subject to similar regulatory processes involving enzymatic hydroxylation of conserved prolyl and asparaginyl residues that target them for degradation via the VHL ubiquitin E3 ligase complex (reviewed in Ref. 3 ). Moreover, in transfection assays, both transcription factors activate a range of hypoxia response elements with similar efficacy (4 , 5) .

Despite these striking similarities, genetic studies have provided firm evidence for nonredundant functions. Targeted inactivation of Hif-1{alpha} and Hif-2{alpha} in embryonic stem cells is associated with different patterns of response to hypoxia and low glucose stress (6) , and different developmental defects are observed in Hif-1{alpha}-/- and Hif-2{alpha}-/- mouse embryos (for review see Ref. 3 ). In part, differences may relate to distinct patterns of cellular expression. For instance, in the kidney, whereas both transcription factors are abundantly expressed, Hif-1{alpha} is the predominant form in epithelial cells, whereas Hif-2{alpha} is predominant in interstitial fibroblast and endothelial cells (7) . However, many cancers and cell lines express both isoforms. The expression of the two Hif-{alpha} isoforms at similar levels in this setting might be predicted to lead to a level of redundancy. Nevertheless, overexpression of Hif-2{alpha}, but not Hif-1{alpha}, promoted growth of renal cell carcinoma cells (8 , 9) yet inhibited growth of breast cells (10) , suggesting distinct effects on biology. These findings raise important questions as to what extent Hif-1{alpha} and Hif-2{alpha} have overlapping or redundant transcriptional functions in the cancer setting, whether expression of particular Hif transcriptional targets are always linked to expression of a particular Hif-{alpha} isoforms, or whether transcriptional selectivity varies according to cell background.

We have used siRNAs to specifically inhibit Hif-1{alpha} and Hif-2{alpha} production in human breast and renal carcinoma cell lines and in a human endothelial cell line, which express differing levels of Hif-1{alpha} and Hif-2{alpha}, ranging from isolated expression of Hif-1{alpha} to isolated expression of Hif-2{alpha}. The role of each molecule on induction of specific transcriptional targets with a variety of functions in the hypoxic response was then investigated.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
siRNA Duplexes.
The siRNA oligonucleotides were designed after the recommendations of Elbashir et al. (11) and were synthesized and high-performance liquid chromatography purified at Transgenomic Laboratories (Glasgow, United Kingdom). The Hif-1{alpha} siRNA duplex targeted nucleotides 1521–1541 of the Hif-1{alpha} mRNA sequence (NM001530) and comprised of: sense 5'-CUGAUGACCAGCAACUUGAdTdT-3' and antisense 5'-UCAAGUUGCUGGUCAUCAGdTdT-3'. The Hif-2{alpha} siRNA duplex targeted nucleotides 1260–1280 of the Hif-2{alpha} mRNA sequence (NM001430) and comprised of sense 5'-CAGCAUCUUUGAUAGCAGUdTdT-3' and antisense 5'-ACUGCUAUCAAAGAUGCUGdTdT-3'. The inverted Hif-1{alpha} control duplex did not target any gene and comprised of sense 5'-AGUUCAACGACCAGUAGUCdTdT-3' and antisense 5'-GACUACUGGUCGUUGAdTdT-3'. Duplexes were prepared by mixing 50-µM concentrations of antisense and sense oligonucleotides with annealing buffer [30 mM HEPES (pH 7.0), 100 mM potassium acetate, and 2 mM magnesium acetate], heat denaturing for 1 min at 85°C, and annealing at 37°C for 1 h. Duplex formation was confirmed by electrophoresis through 5% low melting temperature agarose (NuSieve GTG; FMC Bioproducts, Rockland, ME). Additional siRNA duplexes used for confirmation of the specificity of particular effects were prepared as above and targeted to nucleotides 1510–1530 (AACGACACAGAAACTGATGAC) of the Hif-1{alpha} mRNA sequence and nucleotides 328–348 (AAATCAGCTTCCTGCGAACAC) of the Hif-2{alpha} mRNA sequence.

Cell Culture.
MDA 435 cells, MDA 468 cells (breast cancer), 786-0 cells (renal cancer), and HUVECs (endothelial) were obtained from the Cancer Research United Kingdom cell service. Breast and renal cancer cells were grown in DMEM supplemented with 10% FCS (Globepharm), L-glutamine (2 µM), penicillin (50 IU/ml), and streptomycin sulfate (50 µg/ml). HUVECs were grown in the media supplemented as above but with 20% FCS plus endothelial cell growth supplement and heparin (Sigma) and grown on plates coated with 2% gelatin/PBS. Experiments were performed on dishes of cells in normoxia (humidified air with 5% CO2) or hypoxia [hypoxic conditions were generated in a Napco 7001 incubator (Precision Scientific) with 0.1% O2, 5% CO2, and balance N2].

siRNA Treatment of Cells.
Cells were plated onto 10-cm2 cell culture dishes and grown to 30–50% confluence before transfection. The duplexes were diluted to give a final concentration of 20 nM in Opti-Mem I (Invitrogen life Technologies, San Diego, CA). Twenty-five µl of Oligofectamine transfection reagent (Invitrogen Life Technologies) were added, and the mixture incubated at room temperature for 25 min. The cells were rinsed with Opti-Mem I to remove any residual serum and incubated with the oligonucleotide duplexes in serum-free conditions for 4 h at 37°C. Serum was then added back to the culture, and cells were incubated for an additional 24 h before beginning an experiment.

RNA Preparation and RNase Protection Assay.
Cells were rinsed with PBS and drained thoroughly. RNA was extracted from the cells using the solution D method described by Chomczynski and Sacchi (12) and assessed by absorbance at 260/280 nm. The RNase protection assay protocol and generation of 32P-labeled RNA probes to Hif-1{alpha}, Hif-2{alpha}, and U6 small nuclear RNA has been described previously (4) . Protected fragments were resolved on an 8% polyacrylamide gel and analyzed on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Western Blotting.
Cells were washed thoroughly with PBS before being homogenized in a lysis buffer containing 8 M urea, 10% SDS, 1 M DTT, and protease inhibitors. Samples were electrophoresed on a 10% SDS-PAGE gel and transferred onto a polyvinylidene difluoride membrane (Millipore, Bedfordshire, United Kingdom). Proteins were detected using monoclonal antibodies to Hif-1{alpha} (Signal Transduction Laboratories), Hif-2{alpha} (4) , CA9 (13) , GLUT-1 (Alpha Diagnostic, San Antonio, TX), glyceraldehyde-3-phosphate dehydrogenase (Abcam, Cambridge, United Kingdom), and BNip3 (14) at 1:1,000, 1:1,000, 1:500, 1:250, 1:2,000, and 1:20,000, respectively. As a loading control, a mouse monoclonal antibody to ß-tubulin (Sigma) was used at 1:20,000. Overnight primary antibody incubation was followed by incubation with goat antimouse or rabbit horseradish peroxidase (Dako) and enhanced chemiluminescence developing reagents (Amersham). Blots were exposed to film for between 30 s and 2 min.

Measurement of VEGF and uPAR.
Supernatant was harvested from treated cells and centrifuged to remove cell debris. Secreted VEGF and uPAR were measured in the supernatant using the respective Quantikine ELISA kit (R&D Systems, Abingdon, United Kingdom) as per the manufacturer’s instructions. The amount of VEGF and uPAR in the supernatant was normalized to the final number of cells in the dish from which it was harvested.

Cell Migration Assay.
Cells treated with siRNA as described above were incubated in 0.1% oxygen for 16 h, removed from the culture dish using 2 mM EDTA, and resuspended in 1% FCS media. A total of 200 µl of serum-free media containing 1.5 x 104 cells was placed into the top of migration chambers with 8-µm filters (24-well plate format; Falcon), which were standing in wells containing 700 µl of media containing 10% FCS. The cells were incubated at 37°C for 4 h, after which the chambers were removed from the wells and coded for analysis by a blinded observer. Cells that had migrated to the bottom of the filter were fixed with 2.5% glutaraldehyde for 15 min, rinsed thoroughly with PBS, and stained with 0.1% crystal violet for 2 min. The total number of cells on the bottom of each filter was counted under a microscope, and each experiment was performed in triplicate on at least three occasions.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Specificity of siRNAs Targeted to Hif-1{alpha} and Hif-2{alpha}.
We synthesized siRNA oligonucleotides that specifically target Hif-1{alpha} or Hif-2{alpha} mRNAs for degradation and transfected these into cells 24 h before hypoxic stimulation. RNA extracted from the treated cells was subjected to RNAse Protection Assay analysis for Hif-1{alpha} and Hif-2{alpha}. MDA 468 and HUVECs expressed transcripts encoding both Hif-1{alpha} and Hif-2{alpha} (Fig. 1)Citation , whereas the MDA 435 cells did not express Hif-2{alpha} mRNA (Fig. 1)Citation , and the 786-0 cells did not express Hif-1{alpha} mRNA (Fig. 1)Citation . Treatment of the cells with the siRNAs ablated the expression of Hif-1{alpha} and Hif-2{alpha} mRNA specifically in that the Hif-1{alpha} siRNA did not affect the Hif-2{alpha} gene expression and vice versa (Fig. 1)Citation . Inverted siRNA controls of the Hif-1{alpha} and Hif-2{alpha} siRNAs had no effect on the expression of either gene; the inverted Hif-1{alpha} siRNA was used as the control in all experiments described (Figs. 1Citation 2Citation 3Citation 4)Citation . When cells were transfected with both siRNAs, expression of Hif-1{alpha} and Hif-2{alpha} was ablated. No cell toxicity was noted after transfection with either of the siRNAs or with Oligofectamine alone (described as the negative control). To confirm the specificity of the technique, siRNAs targeted to another region of the Hif-1{alpha} and Hif-2{alpha} mRNAs were synthesized and transfected into MDA 468 cells, which were then subjected to hypoxic stimulation. The results obtained with these siRNAs were the same as described above in respect to specificity of Hif-1{alpha} and Hif-2{alpha} targeting (data not shown).



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. RNase protection analysis of RNA extracted from MDA 468 cells (A), MDA 435 cells (B), 786-0 cells (C), and HUVECs (D). Cells were mock transfected (-) or subjected to siRNA directed to Hif-1{alpha} (1) , Hif-2{alpha} (2) , both Hif-1{alpha} and Hif-2{alpha} (b), or inverted control (i) before subsequent incubation for 16 h in 20% oxygen (N) or 0.1% oxygen (H). Specific down-regulation of Hif-1{alpha} or Hif-2{alpha} mRNA occurred after siRNA for each respective transcript or both transcripts. The inverted siRNA control had no effect on mRNA levels. Quantification of U6 small nuclear RNA was used as a loading control.

 


View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, Western blot analysis of protein extracted from MDA 468 cells and HUVECs after treatment as described in Fig. 1Citation . Specific down-regulation of Hif-1{alpha} or Hif-2{alpha} protein occurred after siRNA for each respective transcript or both transcripts. The inverted siRNA control had no effect on protein levels. Hypoxic induction of CA9, GLUT-1, and BNip3 protein was blocked after siRNA for Hif-1{alpha} but not after siRNA for Hif-2{alpha}. siRNA against both genes also resulted in the down-regulation of the target genes. B, VEGF levels and uPAR levels (C) in media conditioned by MDA 468 (B and C) and HUVECs (C), normalized to final cell number. Normoxic or hypoxic treatment of cells is indicated by {square} and {blacksquare}, respectively. Experiments were performed in triplicate at least three times, and results from one representative experiment are shown. One-tailed, student t tests comparing each treatment with the hypoxic mock control were performed, and significance is indicated by * for P < 0.05 and ** for P < 0.01.

 


View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A, Western blot analysis of protein extracted from 786-0 cells after treatment as described in Fig. 1Citation . 786-0 cells do not express Hif-1{alpha}, but specific down-regulation of Hif-2{alpha} protein occurred after siRNA for Hif-2{alpha}. The inverted siRNA and Hif-1{alpha} siRNA had no effect on Hif-2{alpha} protein levels. GLUT-1 protein is reduced after siRNA for Hif-2{alpha} but not after siRNA for Hif-1{alpha}. Somewhat unusually, there was a modest induction of GLUT-1 after hypoxic stimulus, which was also inhibited by siRNA for Hif-2{alpha}. siRNA for both genes also resulted in the down-regulation of the target genes. B, VEGF levels and uPAR levels (C) in media conditioned by the above cells normalized to final cell number. Normoxic or hypoxic treatment of cells is indicated by {square} and {blacksquare}, respectively. Experiments were performed in triplicate at least three times, and results from one representative experiment are shown. One-tailed, student t tests comparing each treatment with the hypoxic mock control were performed, and significance is indicated by * for P < 0.05 and ** for P < 0.01.

 


View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Migration analysis of cells treated with a mock transfection (-) or siRNA for Hif-1{alpha} (1) , Hif-2{alpha} (2) , both Hif-1{alpha} and Hif-2{alpha} (b), or inverted control (i) before subsequent incubation for 16 h in 0.1% oxygen. The number of cells that had migrated through an 8-µm filter was counted, and the mean and SD of three replicates in a representative experiment is shown graphically. A and B, hypoxically induced migration of MDA 468 cells is inhibited by treatment with siRNA for both Hif-1{alpha} and Hif-2{alpha}. B shows photographs of the bottom of a representative selection of migration chambers, with blue cells visible around the smaller round pores of the filter. C, hypoxically induced migration of MDA 435 cells was inhibited by treatment with siRNA for Hif-1{alpha}, not Hif-2{alpha}, whereas migration of HUVECs was inhibited by siRNA for both Hif-1{alpha} and Hif-2{alpha} (D).

 
Expression of Hypoxically Induced Genes by Human Cell Lines After Treatment with siRNA for Hif-1{alpha} and Hif-2{alpha}.
The HIF system up-regulates the production of proteins with a wide range of functions in the homeostatic and apoptotic response (2 , 3 , 13 , 15) to hypoxia and cell death in many different human cell types. To investigate the importance of Hif-1{alpha} and Hif-2{alpha} in conferring such responses in different cell backgrounds, we analyzed the expression of CA9 (acid metabolism), BNip3 (cell death), GLUT-1 (glucose/energy metabolism), VEGF (angiogenesis), and uPAR (proteolytic pathway of invasion) in MDA 435 cells, MDA 468 cells (breast carcinoma), 786-0 cells (renal carcinoma), and HUVECs (endothelial) after treatment with Hif-1{alpha} and/or Hif-2{alpha} siRNA. Protein levels were measured using Western blot analysis (CA9, BNip3, and GLUT-1) or ELISA (VEGF and uPAR).

Analysis of the breast carcinoma cell lines revealed that MDA 468 cells expressed both Hif-1{alpha} and Hif-2{alpha} protein (Fig. 2)Citation , whereas MDA 435 cells expressed only Hif-1{alpha} protein (data not shown). In both cell lines, hypoxic induction of CA9, BNip3, GLUT-1, VEGF, and uPAR protein was inhibited by treatment with Hif-1{alpha} siRNA but not affected by Hif-2{alpha} siRNA. Silencing both Hif-1{alpha} and Hif-2{alpha} had the same effect as silencing with Hif-1{alpha}, and the inverted control siRNA had no effect on the expression of any of the genes (Fig. 2Citation ; data not shown). The same results were obtained when MDA 468 cells were transfected with the confirmatory siRNAs (data not shown).

Similar to the MDA 468 cell lines, HUVECs expressed both Hif-1{alpha} and Hif-2{alpha} protein after hypoxic stimulus (Fig. 2)Citation . Hypoxia did not induce HUVECs to express CA9 or secrete VEGF but did increase the levels of expression of BNip3, GLUT-1, and uPAR. Pretreatment of HUVECs with siRNA to Hif-1{alpha} ablated the hypoxic induction of BNip3, GLUT-1, and uPAR, but Hif-2{alpha} siRNA treatment had no effect on protein production (Fig. 2)Citation .

The renal carcinoma cell line 786-0 expressed Hif-2{alpha} but not Hif-1{alpha}, and because this cell line lacks functional VHL, expression of Hif-2{alpha} was seen constitutively under normoxic conditions (Fig. 3)Citation . VEGF and GLUT-1 proteins were also constitutively expressed, but BNip3 and CA9 proteins were not expressed at detectable levels. uPAR was constitutively expressed by 786-0 cells but at 2-fold lower levels than by breast or endothelial cells. Treatment of cells with siRNA to Hif-2{alpha} reduced the expression of GLUT-1 and VEGF, whereas siRNA to Hif-1{alpha} had no effect (Fig. 3)Citation . Expression of uPAR was not affected by siRNA to Hif-1{alpha} or Hif-2{alpha}.

Cell Migration Induced by Hypoxia Is Affected by Pretreatment with siRNA to Hif-1{alpha} or Hif-2{alpha} Depending on the Cell Type.
Intratumoral hypoxia is correlated with increased risk of invasion in human cancer (1) , and hypoxia increases the invasion of colon carcinoma cells (16) . To elucidate which hypoxia-induced transcription factor is involved in this process, we analyzed MDA 468 and HUVE cells treated with siRNA for Hif-1{alpha} or Hif-2{alpha} and normoxia or hypoxia in a cell migration assay. Cells subjected to hypoxia showed increased migration compared with the cells that had remained in normoxia, and treatment with inverted siRNA or mock transfection had no effect on the migration response. In MDA 435 cells, the hypoxic response was inhibited by treatment with siRNA directed to Hif-1{alpha} but not to Hif-2{alpha}. However, in MDA 468 and HUVECs, hypoxically induced migration was inhibited by pretreatment of the cells with either Hif-1{alpha} or Hif-2{alpha} siRNA. Treatment of cells with both siRNAs inhibited the hypoxically induced migration response in both cell lines but not more than with either alone (Fig. 4)Citation .


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
In this study, we used siRNAs that specifically target degradation of mRNAs encoding Hif-1 {alpha} or Hif-2{alpha}. After treatment with siRNA, the expression of Hif-1{alpha} or Hif-2{alpha} mRNA and protein was greatly reduced under hypoxic conditions. The effects of these siRNAs were analyzed in two human breast carcinoma cell lines, a human endothelial cell line, and a human renal carcinoma cell line containing an inactivating mutation in VHL.

Our results indicate that in the breast carcinoma and endothelial cell lines, the major Hif-{alpha} isoform required for induction of a set of well-characterized hypoxic genes is Hif-1{alpha}. Surprisingly, even in cells expressing both Hif-{alpha} isoforms, Hif-2{alpha} did not substitute in regulating any of these genes when Hif-1{alpha} was inactivated. Nevertheless, functional analysis of the endothelial and breast carcinoma cell lines revealed that both Hif-1{alpha} and Hif-2{alpha} are required for hypoxia-induced cell migration in cell lines that express both proteins, suggesting that there are other actions of Hif-2{alpha} that have not been revealed in our studies of gene expression. Overall, however, the importance of Hif-1{alpha} in these cells is in concordance with other studies that have reported Hif-1{alpha} as a positive factor in tumor growth (17) and carcinoma cell invasion (16) in different cells. The hypothesis that Hif-1{alpha} is the major hypoxia-induced transcription factor involved in breast carcinogenesis is supported by evidence that one of the breast carcinoma cell lines used in this study has lost Hif-2{alpha} expression, and stable transfection of this cell line with Hif-2{alpha} resulted in its impaired growth as xenograft tumors compared with the parental line (10) .

In contrast with the above results, we found that in the VHL-defective 786-0 renal carcinoma line, in which the native Hif-1{alpha} gene is not expressed, some of the hypoxia-inducible transcripts were now critically dependent of Hif-2{alpha}. VHL is required for proteolytic regulation of both Hif-1{alpha} and Hif-2{alpha}, and in VHL defective cells both isoforms are stabilized. However, there is an unusual bias toward enhanced Hif-2{alpha} mRNA expression in clear cell renal carcinoma that is not observed in the renal tubular epithelium from which these tumors are derived (7) but arises during tumor development (18) . This may be because of an additional action of VHL on the Hif system (19 , 20) and/or additional non-VHL mediated actions on Hif{alpha} isoforms that arise during the oncogenic process. The current results suggest the existence of another distinct interface between the HIF system and renal carcinogenesis that makes connections between Hif-2{alpha} expression and certain hypoxia-inducible mRNAs. The finding that the Hif-2{alpha} pathway appears to be specifically activated in clear cell renal carcinogenesis by several steps strongly suggests a causal role for Hif-2{alpha} in development of the cancer. Interestingly, this is supported by comparison of results from two groups that have examined the expression of mutant forms of Hif-1{alpha} or Hif-2{alpha} that escape VHL-mediated destruction on the tumor suppressor effect of expressing wild-type VHL in renal cell carcinoma cells. These studies have shown that stabilized Hif-2{alpha} but not Hif-1{alpha} reverses VHL tumor suppressor function (8 , 9) .

In conclusion, these studies have, for the first time, directly compared functional inactivation of Hif-1{alpha} and Hif-2{alpha} in different cancer cell lines. The findings indicate that the actions are distinct and differ according to cell background and suggest that these differences are important in tumor development.


    ACKNOWLEDGMENTS
 
We thank Arnold Greenberg (deceased) of the cell death group at Manitoba Institute of Cell Biology, University of Manitoba (Winnipeg, Manitoba, Canada) for the kind gift of the BNip3 monoclonal antibody.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 H. M. S., J. M. and A. L. H. were funded by Cancer Research United Kingdom and P. J. R. by the Wellcome Trust. R. R. is a Rhodes scholar. Back

2 To whom requests for reprints should be addressed, at Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom. Phone: 44-1865-222457; Fax: 44-1865-222431; E-mail: harrisa{at}cancer.org.uk Back

3 The abbreviations used are: Hif, hypoxia-inducible factor; CA9, carbonic anhydrase 9; GLUT-1, glucose transporter-1; HUVEC, human umbilical vein endothelial cell; siRNA, short interfering RNA; uPAR, urokinase-type plasminogen activator receptor; VEGF, vascular endothelial growth factor; VHL, von Hippel-Lindau. Back

Received 7/ 7/03. Revised 8/12/03. Accepted 8/15/03.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Hoeckel M., Vaupel P. Biological consequences of tumor hypoxia. Semin. Oncol., 28: 36-41, 2001.
  2. Semenza G. L. HIF-1 and tumor progression: pathophysiology and therapeutics. Trends Mol. Med., 8: S62-S67, 2002.[Medline]
  3. Pugh C. W., Ratcliffe P. J. Regulation of angiogenesis by hypoxia: role of the HIF system. Nat. Med., 9: 677-684, 2003.[Medline]
  4. Wiesener M. S., Turley H., Allen W. E., Willam C., Eckhardt K. U., Talks K. L., Wood S. M., Gatter K. C., Harris A. L., Pugh C. W., Ratcliffe P. J., Maxwell P. H. Induction of endothelial PAS domain protein-1 by hypoxia: characterization and comparison with hypoxia-inducible factor-1{alpha}. Blood, 92: 2260-2268, 1998.[Abstract/Free Full Text]
  5. Ema M., Hirota K., Mimura J., Abe H., Yodoi J., Sogawa K., Peollinger L., Fujii-Kuriyama Y. Molecular mechanisms of transcription activation by HLF and HIF1{alpha} in response to hypoxia: their stabilisation and redox signal-induced interaction with CBP/p300. EMBO J., 18: 1905-1914, 1999.[Medline]
  6. Brusselmanns K., Bono F., Maxwell P. H., Dor Y., Dewerchin M., Collen D., Herbert J-M., Carmeliet P. Hypoxia-inducible factor-2{alpha} is involved in the apoptotic response to hypoglycemia but not to hypoxia. J. Biol. Chem., 276: 39192-39196, 2001.[Abstract/Free Full Text]
  7. Rosenberger C., Mandriota S., Jurgensen J. S., Wiesner M. S., Horstrup J. H., Frei U., Ratcliffe P. J., Maxwell P. H., Bachmann S., Eckardt K. U. Expression of hypoxia-inducible factor-1{alpha} and -2{alpha} in hypoxic and ischemic rat kidneys. J. Am. Soc. Nephrol., 13: 1974-1976, 2002.[Free Full Text]
  8. Maranchie J. K., Vasselli J. R., Riss J., Bonifacino J. S., Linehan W. M., Klausner R. D. The contribution of VHL substrate binding and HIF-1{alpha} to the phenotype of VHL loss in renal cell carcinoma. Cancer Cell, 1: 247-255, 2002.[Medline]
  9. Kondo K., Klco J., Nakamura E., Lechpammer M., Kaelin W. G. Inhibition of HIF is necessary for tumor suppression by the von Hippel Lindau protein. Cancer Cell, 1: 237-246, 2002.[Medline]
  10. Blancher C., Moore J. W., Talks K. L., Houlbrook S., Harris A. L. Relationship of hypoxia-inducible factor (HIF)-1{alpha} and HIF-2{alpha} expression to vascular endothelial growth factor induction and hypoxia survival in human breast cancer cell lines. Cancer Res., 60: 7106-7113, 2000.[Abstract/Free Full Text]
  11. Elbashir S. M., Harborth J., Lendeckel W., Yalcin A., Weber K., Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature (Lond.), 411: 494-498, 2001.[Medline]
  12. Chomczynski P., Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
  13. Wykoff C. C., Beasley N. J. P., Watson P. H., Turner K. J., Pastorek J., Sibtain A., Wilson G. D., Turley H., Talks K., Maxwell P. H., Pugh C. W., Ratcliffe P. J., Harris A. L. Hypoxia-inducible expression of tumor-associated carbonic anhydrases. Cancer Res., 60: 7075-7083, 2000.[Abstract/Free Full Text]
  14. Ray R., Chen G., Vande Velde C., Cizeau J., Hoon Park J. H., Reed J. C., Gietz R. D., Greenberg A. H. BNIP3 heterodimerizes with Bcl-2/Bcl-XL and induces cell death independent of a Bcl-2 homology 3 (BH3) domain at both mitochondrial and nonmitochondrial sites. J. Biol. Chem., 275: 1439-1448, 2000.[Abstract/Free Full Text]
  15. Sowter H. M., Ratcliffe P. J., Watson P., Greenberg A. H., Harris A. L. HIF-1-dependent regulation of hypoxic induction of the cell death factors BNIP3 and NIX in human tumors. Cancer Res., 61: 6669-6673, 2001.[Abstract/Free Full Text]
  16. Krishnamachary B., Berg-Dixon S., Kelly B., Agani F., Feldser D., Ferreira G., Iyer N., LaRusch J., Pak B., Taghavi P., G. L. S. Regulation of colon carcinoma cell invasion by hypoxia-inducible factor 1. Cancer Res., 63: 1138-1143, 2003.[Abstract/Free Full Text]
  17. Ryan H. E., Poloni M., McNulty W., Elson D., Gassmann M., Arbeit J. M., Johnson R. S. Hypoxia-inducible factor-1{alpha} is a positive factor in solid tumor growth. Cancer Res., 60: 4010-4015, 2000.[Abstract/Free Full Text]
  18. Mandriota S. J., Turner K. J., Davies D. R., Murray P. G., Morgan N. V., Sowter H. M., Wykoff C. C., Maher E. R., Harris A. L., Ratcliffe P. J., Maxwell P. H. HIF inactivation identifies early lesions in VHL kidneys: evidence for site specific tumor suppressor function in the nephron. Cancer Cell, 1: 459-468, 2002.[Medline]
  19. Kreig M., Haas R., Brauch H., Acker T., Flamme I., Plate K. H. Up-regulation of hypoxia-inducible factors HIF-1{alpha} and HIF-2{alpha} under normoxic conditions in renal carcinoma cells by von Hippel-Lindau tumor suppressor gene loss function. Oncogene, 19: 5435-5443, 2000.[Medline]
  20. Maxwell P. H., Dachs G., Gleadle J. M., Nicholls L. G., Harris A. L., Stratford I. J., Hankinson O., Pugh C. W., Ratcliffe P. J. Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proc. Natl. Acad. Sci. USA, 94: 8104-8109, 1997.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
S. Kroening, E. Neubauer, J. Wessel, M. Wiesener, and M. Goppelt-Struebe
Hypoxia interferes with connective tissue growth factor (CTGF) gene expression in human proximal tubular cell lines
Nephrol. Dial. Transplant., November 1, 2009; 24(11): 3319 - 3325.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Kikuchi, M. S. Pino, M. Zeng, S. Shirasawa, and D. C. Chung
Oncogenic KRAS and BRAF Differentially Regulate Hypoxia-Inducible Factor-1{alpha} and -2{alpha} in Colon Cancer
Cancer Res., November 1, 2009; 69(21): 8499 - 8506.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
L. Gunaratnam and J. V. Bonventre
HIF in Kidney Disease and Development
J. Am. Soc. Nephrol., September 1, 2009; 20(9): 1877 - 1887.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Asplund, G. Ostergren-Lunden, G. Camejo, P. Stillemark-Billton, and G. Bondjers
Hypoxia increases macrophage motility, possibly by decreasing the heparan sulfate proteoglycan biosynthesis
J. Leukoc. Biol., August 1, 2009; 86(2): 381 - 388.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-Y. Fang, R. Hughes, C. Murdoch, S. B. Coffelt, S. K. Biswas, A. L. Harris, R. S. Johnson, H. Z. Imityaz, M. C. Simon, E. Fredlund, et al.
Hypoxia-inducible factors 1 and 2 are important transcriptional effectors in primary macrophages experiencing hypoxia
Blood, July 23, 2009; 114(4): 844 - 859.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. R. Mole, C. Blancher, R. R. Copley, P. J. Pollard, J. M. Gleadle, J. Ragoussis, and P. J. Ratcliffe
Genome-wide Association of Hypoxia-inducible Factor (HIF)-1{alpha} and HIF-2{alpha} DNA Binding with Expression Profiling of Hypoxia-inducible Transcripts
J. Biol. Chem., June 19, 2009; 284(25): 16767 - 16775.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. D. Michaud, G. A. Robitaille, J.-P. Gratton, and D. E. Richard
Sphingosine-1-Phosphate: A Novel Nonhypoxic Activator of Hypoxia-Inducible Factor-1 in Vascular Cells
Arterioscler Thromb Vasc Biol, June 1, 2009; 29(6): 902 - 908.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
K. Burkitt, S. Y. Chun, D. T. Dang, and L. H. Dang
Targeting both HIF-1 and HIF-2 in human colon cancer cells improves tumor response to sunitinib treatment
Mol. Cancer Ther., May 1, 2009; 8(5): 1148 - 1156.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Lakhal, N. P. Talbot, A. Crosby, C. Stoepker, A. R. M. Townsend, P. A. Robbins, C. W. Pugh, P. J. Ratcliffe, and D. R. Mole
Regulation of growth differentiation factor 15 expression by intracellular iron
Blood, February 12, 2009; 113(7): 1555 - 1563.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Rohwer, M. Welzel, K. Daskalow, D. Pfander, B. Wiedenmann, K. Detjen, and T. Cramer
Hypoxia-Inducible Factor 1{alpha} Mediates Anoikis Resistance via Suppression of {alpha}5 Integrin
Cancer Res., December 15, 2008; 68(24): 10113 - 10120.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Helczynska, A.-M. Larsson, L. Holmquist Mengelbier, E. Bridges, E. Fredlund, S. Borgquist, G. Landberg, S. Pahlman, and K. Jirstrom
Hypoxia-Inducible Factor-2{alpha} Correlates to Distant Recurrence and Poor Outcome in Invasive Breast Cancer
Cancer Res., November 15, 2008; 68(22): 9212 - 9220.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Z.-B. Han, H. Ren, H. Zhao, Y. Chi, K. Chen, B. Zhou, Y.-j. Liu, L. Zhang, B. Xu, B. Liu, et al.
Hypoxia-inducible factor (HIF)-1{alpha} directly enhances the transcriptional activity of stem cell factor (SCF) in response to hypoxia and epidermal growth factor (EGF)
Carcinogenesis, October 1, 2008; 29(10): 1853 - 1861.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
E. Hervouet, A. Cizkova, J. Demont, A. Vojtiskova, P. Pecina, N. L.W. Franssen-van Hal, J. Keijer, H. Simonnet, R. Ivanek, S. Kmoch, et al.
HIF and reactive oxygen species regulate oxidative phosphorylation in cancer
Carcinogenesis, August 1, 2008; 29(8): 1528 - 1537.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Taguchi, K. Yanagisawa, M. Tanaka, K. Cao, Y. Matsuyama, H. Goto, and T. Takahashi
Identification of Hypoxia-Inducible Factor-1{alpha} as a Novel Target for miR-17-92 MicroRNA Cluster
Cancer Res., July 15, 2008; 68(14): 5540 - 5545.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Basu, A. G. Contreras, D. Datta, E. Flynn, L. Zeng, H. T. Cohen, D. M. Briscoe, and S. Pal
Overexpression of Vascular Endothelial Growth Factor and the Development of Post-Transplantation Cancer
Cancer Res., July 15, 2008; 68(14): 5689 - 5698.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Gerber and J. S. Pober
IFN-{alpha} Induces Transcription of Hypoxia-Inducible Factor-1{alpha} to Inhibit Proliferation of Human Endothelial Cells
J. Immunol., July 15, 2008; 181(2): 1052 - 1062.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Yamashita, K. Ohneda, M. Nagano, C. Miyoshi, N. Kaneko, Y. Miwa, M. Yamamoto, O. Ohneda, and Y. Fujii-Kuriyama
Hypoxia-inducible Transcription Factor-2{alpha} in Endothelial Cells Regulates Tumor Neovascularization through Activation of Ephrin A1
J. Biol. Chem., July 4, 2008; 283(27): 18926 - 18936.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Puppo, F. Battaglia, C. Ottaviano, S. Delfino, D. Ribatti, L. Varesio, and M. C. Bosco
Topotecan inhibits vascular endothelial growth factor production and angiogenic activity induced by hypoxia in human neuroblastoma by targeting hypoxia-inducible factor-1{alpha} and -2{alpha}
Mol. Cancer Ther., July 1, 2008; 7(7): 1974 - 1984.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. J. Champion, M. Guinea, V. Dammai, and T. Hsu
Endothelial Function of von Hippel-Lindau Tumor Suppressor Gene: Control of Fibroblast Growth Factor Receptor Signaling
Cancer Res., June 15, 2008; 68(12): 4649 - 4657.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Seifeddine, A. Dreiem, E. Blanc, M.-C. Fulchignoni-Lataud, M.-A. L. F. Belda, F. Lecuru, T. H. Mayi, N. Mazure, V. Favaudon, C. Massaad, et al.
Hypoxia Down-regulates CCAAT/Enhancer Binding Protein-{alpha} Expression in Breast Cancer Cells
Cancer Res., April 1, 2008; 68(7): 2158 - 2165.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
F. Battaglia, S. Delfino, E. Merello, M. Puppo, R. Piva, L. Varesio, and M. C. Bosco
Hypoxia transcriptionally induces macrophage-inflammatory protein-3{alpha}/CCL-20 in primary human mononuclear phagocytes through nuclear factor (NF)-{kappa}B
J. Leukoc. Biol., March 1, 2008; 83(3): 648 - 662.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. A. Carroll and M. Ashcroft
Regulation of Angiogenic Factors by HDM2 in Renal Cell Carcinoma
Cancer Res., January 15, 2008; 68(2): 545 - 552.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Sathornsumetee, Y. Cao, J. E. Marcello, J. E. Herndon II, R. E. McLendon, A. Desjardins, H. S. Friedman, M. W. Dewhirst, J. J. Vredenburgh, and J. N. Rich
Tumor Angiogenic and Hypoxic Profiles Predict Radiographic Response and Survival in Malignant Astrocytoma Patients Treated With Bevacizumab and Irinotecan
J. Clin. Oncol., January 10, 2008; 26(2): 271 - 278.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. K. Martens, K. M. Kirschner, C. Warnecke, and H. Scholz
Hypoxia-inducible Factor-1 (HIF-1) Is a Transcriptional Activator of the TrkB Neurotrophin Receptor Gene
J. Biol. Chem., May 11, 2007; 282(19): 14379 - 14388.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
I. Kojima, T. Tanaka, R. Inagi, H. Kato, T. Yamashita, A. Sakiyama, O. Ohneda, N. Takeda, M. Sata, T. Miyata, et al.
Protective Role of Hypoxia-Inducible Factor-2{alpha} against Ischemic Damage and Oxidative Stress in the Kidney
J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1218 - 1226.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T. Shinojima, M. Oya, A. Takayanagi, R. Mizuno, N. Shimizu, and M. Murai
Renal cancer cells lacking hypoxia inducible factor (HIF)-1{alpha} expression maintain vascular endothelial growth factor expression through HIF-2{alpha}
Carcinogenesis, March 1, 2007; 28(3): 529 - 536.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Viemann, M. Schmidt, K. Tenbrock, S. Schmid, V. Muller, K. Klimmek, S. Ludwig, J. Roth, and M. Goebeler
The Contact Allergen Nickel Triggers a Unique Inflammatory and Proangiogenic Gene Expression Pattern via Activation of NF-{kappa}B and Hypoxia-Inducible Factor-1{alpha}
J. Immunol., March 1, 2007; 178(5): 3198 - 3207.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. An and M. B. Rettig
Epidermal growth factor receptor inhibition sensitizes renal cell carcinoma cells to the cytotoxic effects of bortezomib
Mol. Cancer Ther., January 1, 2007; 6(1): 61 - 69.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. M. Asikainen, N. S. Waleh, B. K. Schneider, R. I. Clyman, and C. W. White
Enhancement of angiogenic effectors through hypoxia-inducible factor in preterm primate lung in vivo
Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L588 - L595.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
R. D. Guzy and P. T. Schumacker
Oxygen sensing by mitochondria at complex III: the paradox of increased reactive oxygen species during hypoxia
Exp Physiol, September 1, 2006; 91(5): 807 - 819.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Kaluz, M. Kaluzova, and E. J. Stanbridge
Proteasomal Inhibition Attenuates Transcriptional Activity of Hypoxia-Inducible Factor 1 (HIF-1) via Specific Effect on the HIF-1{alpha} C-Terminal Activation Domain
Mol. Cell. Biol., August 1, 2006; 26(15): 5895 - 5907.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. A. Esteban, S. K. Harten, M. G. Tran, and P. H. Maxwell
Formation of Primary Cilia in the Renal Epithelium Is Regulated by the von Hippel-Lindau Tumor Suppressor Protein
J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1801 - 1806.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Zheng, J. L. Ruas, R. Cao, F. A. Salomons, Y. Cao, L. Poellinger, and T. Pereira
Cell-Type-Specific Regulation of Degradation of Hypoxia-Inducible Factor 1{alpha}: Role of Subcellular Compartmentalization
Mol. Cell. Biol., June 15, 2006; 26(12): 4628 - 4641.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. A. Carroll and M. Ashcroft
Role of Hypoxia-Inducible Factor (HIF)-1{alpha} versus HIF-2{alpha} in the Regulation of HIF Target Genes in Response to Hypoxia, Insulin-Like Growth Factor-I, or Loss of von Hippel-Lindau Function: Implications for Targeting the HIF Pathway.
Cancer Res., June 15, 2006; 66(12): 6264 - 6270.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. P. Elvidge, L. Glenny, R. J. Appelhoff, P. J. Ratcliffe, J. Ragoussis, and J. M. Gleadle
Concordant Regulation of Gene Expression by Hypoxia and 2-Oxoglutarate-dependent Dioxygenase Inhibition: THE ROLE OF HIF-1{alpha}, HIF-2{alpha}, AND OTHER PATHWAYS
J. Biol. Chem., June 2, 2006; 281(22): 15215 - 15226.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Okuyama, B. Krishnamachary, Y. F. Zhou, H. Nagasawa, M. Bosch-Marce, and G. L. Semenza
Expression of Vascular Endothelial Growth Factor Receptor 1 in Bone Marrow-derived Mesenchymal Cells Is Dependent on Hypoxia-inducible Factor 1
J. Biol. Chem., June 2, 2006; 281(22): 15554 - 15563.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. Aprelikova, M. Wood, S. Tackett, G. V.R. Chandramouli, and J. C. Barrett
Role of ETS Transcription Factors in the Hypoxia-Inducible Factor-2 Target Gene Selection
Cancer Res., June 1, 2006; 66(11): 5641 - 5647.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. A. Esteban, M. G.B. Tran, S. K. Harten, P. Hill, M. C. Castellanos, A. Chandra, R. Raval, T. S. O'Brien, and P. H. Maxwell
Regulation of E-cadherin Expression by VHL and Hypoxia-Inducible Factor.
Cancer Res., April 1, 2006; 66(7): 3567 - 3575.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Dayan, D. Roux, M. C. Brahimi-Horn, J. Pouyssegur, and N. M. Mazure
The Oxygen Sensor Factor-Inhibiting Hypoxia-Inducible Factor-1 Controls Expression of Distinct Genes through the Bifunctional Transcriptional Character of Hypoxia-Inducible Factor-1{alpha}.
Cancer Res., April 1, 2006; 66(7): 3688 - 3698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. J. Knowles, D. R. Mole, P. J. Ratcliffe, and A. L. Harris
Normoxic Stabilization of Hypoxia-Inducible Factor-1{alpha} by Modulation of the Labile Iron Pool in Differentiating U937 Macrophages: Effect of Natural Resistance-Associated Macrophage Protein 1.
Cancer Res., March 1, 2006; 66(5): 2600 - 2607.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. I. Koukourakis, S. M. Bentzen, A. Giatromanolaki, G. D. Wilson, F. M. Daley, M. I. Saunders, S. Dische, E. Sivridis, and A. L. Harris
Endogenous Markers of Two Separate Hypoxia Response Pathways (hypoxia inducible factor 2 alpha and carbonic anhydrase 9) Are Associated With Radiotherapy Failure in Head and Neck Cancer Patients Recruited in the CHART Randomized Trial
J. Clin. Oncol., February 10, 2006; 24(5): 727 - 735.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. D. Cowden Dahl, B. H. Fryer, F. A. Mack, V. Compernolle, E. Maltepe, D. M. Adelman, P. Carmeliet, and M. C. Simon
Hypoxia-Inducible Factors 1{alpha} and 2{alpha} Regulate Trophoblast Differentiation
Mol. Cell. Biol., December 1, 2005; 25(23): 10479 - 10491.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
G. L. Semenza
Involvement of Hypoxia-Inducible Factor 1 in Pulmonary Pathophysiology
Chest, December 1, 2005; 128(6_suppl): 592S - 594S.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
G. L. Semenza
Involvement of Hypoxia-Inducible Factor 1 in Pulmonary Pathophysiology
Chest, December 1, 2005; 128(6_suppl): 592S - 594S.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. E. Sears and G. Hoppe
Triamcinolone Acetonide Destabilizes VEGF mRNA in Muller Cells under Continuous Cobalt Stimulation
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4336 - 4341.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. S. Patel, J.-L. Li, D. Generali, R. Poulsom, D. W. Cranston, and A. L. Harris
Up-regulation of Delta-like 4 Ligand in Human Tumor Vasculature and the Role of Basal Expression in Endothelial Cell Function
Cancer Res., October 1, 2005; 65(19): 8690 - 8697.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Bilton, N. Mazure, E. Trottier, M. Hattab, M.-A. Dery, D. E. Richard, J. Pouyssegur, and M. C. Brahimi-Horn
Arrest-defective-1 Protein, an Acetyltransferase, Does Not Alter Stability of Hypoxia-inducible Factor (HIF)-1{alpha} and Is Not Induced by Hypoxia or HIF
J. Biol. Chem., September 2, 2005; 280(35): 31132 - 31140.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. An and M. B. Rettig
Mechanism of von Hippel-Lindau Protein-Mediated Suppression of Nuclear Factor kappa B Activity
Mol. Cell. Biol., September 1, 2005; 25(17): 7546 - 7556.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. R. Raval, K. W. Lau, M. G. B. Tran, H. M. Sowter, S. J. Mandriota, J.-L. Li, C. W. Pugh, P. H. Maxwell, A. L. Harris, and P. J. Ratcliffe
Contrasting Properties of Hypoxia-Inducible Factor 1 (HIF-1) and HIF-2 in von Hippel-Lindau-Associated Renal Cell Carcinoma
Mol. Cell. Biol., July 1, 2005; 25(13): 5675 - 5686.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Smith, L. Gunaratnam, M. Morley, A. Franovic, K. Mekhail, and S. Lee
Silencing of Epidermal Growth Factor Receptor Suppresses Hypoxia-Inducible Factor-2-Driven VHL-/- Renal Cancer
Cancer Res., June 15, 2005; 65(12): 5221 - 5230.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. B. Rankin, D. F. Higgins, J. A. Walisser, R. S. Johnson, C. A. Bradfield, and V. H. Haase
Inactivation of the Arylhydrocarbon Receptor Nuclear Translocator (Arnt) Suppresses von Hippel-Lindau Disease-Associated Vascular Tumors in Mice
Mol. Cell. Biol., April 15, 2005; 25(8): 3163 - 3172.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. Wang, D. A. Davis, M. Haque, L. E. Huang, and R. Yarchoan
Differential Gene Up-Regulation by Hypoxia-Inducible Factor-1{alpha} and Hypoxia-Inducible Factor-2{alpha} in HEK293T Cells
Cancer Res., April 15, 2005; 65(8): 3299 - 3306.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. L. Covello, M. C. Simon, and B. Keith
Targeted Replacement of Hypoxia-Inducible Factor-1{alpha} by a Hypoxia-Inducible Factor-2{alpha} Knock-in Allele Promotes Tumor Growth
Cancer Res., March 15, 2005; 65(6): 2277 - 2286.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
V. A.J. Kempf, M. Lebiedziejewski, K. Alitalo, J.-H. Walzlein, U. Ehehalt, J. Fiebig, S. Huber, B. Schutt, C. A. Sander, S. Muller, et al.
Activation of Hypoxia-Inducible Factor-1 in Bacillary Angiomatosis: Evidence for a Role of Hypoxia-Inducible Factor-1 in Bacterial Infections
Circulation, March 1, 2005; 111(8): 1054 - 1062.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
G Eisenhofer, T-T Huynh, K Pacak, F M Brouwers, M M Walther, W M Linehan, P J Munson, M Mannelli, D S Goldstein, and A G Elkahloun
Distinct gene expression profiles in norepinephrine- and epinephrine-producing hereditary and sporadic pheochromocytomas: activation of hypoxia-driven angiogenic pathways in von Hippel-Lindau syndrome
Endocr. Relat. Cancer, December 1, 2004; 11(4): 897 - 911.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. P. Stolze, Y.-M. Tian, R. J. Appelhoff, H. Turley, C. C. Wykoff, J. M. Gleadle, and P. J. Ratcliffe
Genetic Analysis of the Role of the Asparaginyl Hydroxylase Factor Inhibiting Hypoxia-inducible Factor (HIF) in Regulating HIF Transcriptional Target Genes
J. Biol. Chem., October 8, 2004; 279(41): 42719 - 42725.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
T. Acker and H. Acker
Cellular oxygen sensing need in CNS function: physiological and pathological implications
J. Exp. Biol., August 15, 2004; 207(18): 3171 - 3188.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
G. L. Semenza
Hydroxylation of HIF-1: Oxygen Sensing at the Molecular Level
Physiology, August 1, 2004; 19(4): 176 - 182.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Takeda, K. Maemura, Y. Imai, T. Harada, D. Kawanami, T. Nojiri, I. Manabe, and R. Nagai
Endothelial PAS Domain Protein 1 Gene Promotes Angiogenesis Through the Transactivation of Both Vascular Endothelial Growth Factor and Its Receptor, Flt-1
Circ. Res., July 23, 2004; 95(2): 146 - 153.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Uchida, F. Rossignol, M. A. Matthay, R. Mounier, S. Couette, E. Clottes, and C. Clerici
Prolonged Hypoxia Differentially Regulates Hypoxia-inducible Factor (HIF)-1{alpha} and HIF-2{alpha} Expression in Lung Epithelial Cells: IMPLICATION OF NATURAL ANTISENSE HIF-1{alpha}
J. Biol. Chem., April 9, 2004; 279(15): 14871 - 14878.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. Zimmer, D. Doucette, N. Siddiqui, and O. Iliopoulos
Inhibition of Hypoxia-Inducible Factor Is Sufficient for Growth Suppression of VHL-/- Tumors
Mol. Cancer Res., February 1, 2004; 2(2): 89 - 95.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sowter, H. M.
Right arrow Articles by Harris, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sowter, H. M.
Right arrow Articles by Harris, A. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online