| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Department of Internal Medicine I, University Hospital [P. M., C. B., M. B., M. R., K-H. H., A. M., H. F., G. A., T. M. G.], Department of Pharmacology [K. G.], and Department of Surgery I [G. L.], University of Ulm, 89081 Ulm, Germany; Department of Medicine B, Westfälische Wilhelms-Universität, D-48129 Münster, Germany [M. M. L.]; Department of Medicine IV, Medical Faculty Mannheim, University of Heidelberg at Mannheim, D-68167 Mannheim, Germany [M. L.]; and Department of Surgery I, Miyazaki Medical College, Miyazaki, 889-1601, Japan [T. I.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Claudin-4 consists of 209 amino acids and contains four putative transmembrane segments (5) . In previous studies, we identified claudin-4 as overexpressed in pancreatic cancer in various expression profiling approaches using representational difference analysis and DNA array technology (6 , 7) . To date, the physiological relevance of this finding remains unknown.
Interestingly, claudin-4 and, with a lesser affinity, claudin-3 have been described to function as receptors for CPE3 (5) . CPE is known to injure intestinal epithelial cells by an increase in membrane permeability resulting in loss of the osmotic equilibrium and subsequent cell death (8) . In pancreatic cancer cells, we observed a cytotoxic effect of CPE in vitro and in vivo, which was restricted to claudin-4 expressing cells. These findings might open a novel treatment approach for claudin-4 expressing solid tumors using CPE (9) . Our observations were confirmed recently by Long et al. (10) , who described a cytotoxic effect of CPE in prostate cancer cells overexpressing claudin-3 and claudin-4.0. Claudin-4 was also found recently to be overexpressed in ovarian cancer (11) underlining the therapeutic potential of the CPE-claudin-4 interaction in a variety of solid tumors.
Several claudins have been shown to be regulated by oncogenes and tumor promoting growth factors. Transfection of oncogenic Raf-1 into a salivary gland epithelial cell line resulted in down-regulation of claudin-1 and loss of tight junction function (12) . In Ras-transformed MDCK cells, claudin-1 was absent from cell-cell contacts but was reassembled to the cell membrane after blocking the mitogen-activated protein kinase pathway, paralleled by tight junction formation (13) . TGF-ß, a potent modulator of invasion and metastasis in pancreatic cancer (14 , 15) , has been demonstrated to perturb the tight junction permeability and assembly of claudin-11 in Sertoli cells (16) . Furthermore, claudins have been shown to modify tumor invasion by the regulation of MMPs. Several members of the claudin-family such as claudin-2 and claudin-5 are able to activate membrane-type 1-MMP-mediated pro-MMP-2 processing (17) . These reports indicate that members of the claudin-family are modulated during the process of oncogenic transformation and may play an important role in influencing tumor progression and invasion.
On the basis of our previous observations, the aim of the present study was to characterize the biological role of claudin-4 up-regulation in several solid tumors including pancreatic carcinoma (9) . Therefore, we investigated the effect of claudin-4 on proliferation, invasion, and metastatic behavior of pancreatic cancer cells, and examined the regulatory effects of both TGF-ß and oncogenic Ras including its major downstream effectors on claudin-4 expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The human pancreatic cancer cell lines were obtained from the indicated suppliers: PANC-1 (European Collection of Animal Cell Cultures, Salisbury, United Kingdom), SUIT-2 clones S2-007 and S2-028 (Takeshi Iwamura, Miyazaki Medical College, Miyazaki, Japan; Ref. 18 ). PANC-1 cells were stably transfected with human dominant-negative H-Ras (S17N) cloned into the pEGFP-C expression vector (Clontech, Palo Alto, CA). PANC-1 cells stably overexpressing TGF-ß1 were generated as described previously (19) . All of the cell lines were incubated in DMEM (Life Technologies, Inc., Karlsruhe, Germany) and 10% FCS (Life Technologies, Inc.).
The rabbit polyclonal antibody against claudin-4 was obtained from S. Tsukita and was used as described previously (20) . TGF-ß was purchased from R&D Systems (Minneapolis, MN). The inhibitors UO126 and LY294002 were purchased from Sigma (St. Louis, MO).
Overexpression of Claudin-4 in S2-007 Cells.
A full-length claudin-4 cDNA was PCR-amplified from normal pancreas tissue using the 5'-primer CGGGTACCGTGGACGCTGAACAATGG and 3'-primer GGACTAGTGGAGCCGT GGCACCTTA. A 673-bp PCR product containing nucleotides 183812 of human claudin-4 (Accession No. NM_001305) was sequence-verified and cloned into kpnI and speI restriction sites of the mammalian expression vectors pBIG2R (21)
and pBIG2i (tetracyclin-inducible). Stable transfection into the S2-007 pancreatic cancer cell line was performed using the Lipofectin reagent (Life Technologies, Inc.). Claudin-4 expressing clones were selected with hygromycin (300 µg/ml) and screened by Northern blot analysis.
Immunohistochemistry and Immunocytochemistry.
For immunohistochemical analysis, snap-frozen sections of pancreatic cancer tissues were fixed in 3% paraformaldehyde, blocked for 1 h in 1% BSA/PBS, and subsequently stained with a rabbit polyclonal antibody for claudin-4 at a dilution of 1:1000 as described previously (20)
. As secondary antibody, a Cy3-labeled antirabbit goat IgG was used. Microscopic analysis was performed with a Zeiss fluorescence microscope. For immunocytochemical analysis, S2-007 cells were grown on a four-chamber slide and subsequently treated as described above for frozen tissues.
RNA Extraction and Northern Blot Analysis.
RNA from cell lines was extracted using the RNeasy kit (Qiagen, Hilden, Germany). RNA from fresh-frozen pancreatic tissue was prepared as described previously (22)
. Thirty µg of total RNA were size-fractionated and blotted as described previously (6)
. Hybridization was performed with a digoxigenin-11 dUTP-labeled probe for claudin-4 using the Dig-Labeling kit (Roche Diagnostics, Mannheim, Germany). Specific bands were detected using the CDP-Star chemiluminescence substrate (Roche Diagnostics).
Western Blot Analysis.
For protein analysis, cells were lysed in radioimmunoprecipitation assay protein lysis buffer. Identical amounts of protein were size-fractionated by SDS-PAGE and blotted onto polyvinylidene difluoride membranes (Millipore, Schwalbach, Germany) as described previously (23)
. For immunodetection, blots were incubated with a rabbit polyclonal antibody against mouse claudin-4 (1:1000; Ref. 20
) followed by peroxidase-coupled secondary antiserum (Pierce, Rochester, NY). Antibody detection was carried out using an enhanced chemiluminescence reaction system (Pierce, Bonn, Germany).
Proliferation Assay.
[3H]Thymidine incorporation was measured to determine cellular proliferation as described previously (24)
. Each assay was repeated four times.
FACS Analysis.
After harvesting, cells were centrifuged at 1500 rpm for 3 min and washed once with PBS. After resuspending in 500 µl PBS, 5 ml 80% ethanol (-20°C) were added dropwise while vortexing, and cells were incubated on ice for 30 min. Cells were centrifuged at 1500 rpm for 5 min and resuspended in 320 µl PBS. After RNase treatment cells were stained with propidium iodide according to standard methods. To minimize aggregates, the suspension was passed several times through a syringe and subsequently filtered through a 53 µm nylon mesh before analyzing in a FACScan flow cytometer (Becton Dickinson). Remaining aggregates were gated out before analysis. Doublets were excluded using the doublet discrimination method of the Cellfit software (Becton Dickinson). The percentage of apoptotic nuclei was determined as described by the method of Nicoletti et al. (25)
. Cell cycle analysis was done using the WinMDI software, as well as the Modfit software (Becton Dickinson).
Invasion Assay.
The invasive potential of the parental S2-007 and S2-028 cell lines, two claudin-4 overexpressing S2-007 clones and one vector-transfected S2-007 clone, was determined using a modified two-chamber invasion assay as described previously (14)
. Briefly, 12-well Transwell-plates (COSTAR, Cambridge, MA) with 8-µm pore size were coated with 1:2 diluted Matrigel (Becton Dickinson, Heidelberg, Germany). The lower chamber contained DMEM-medium with 10% FCS, and the upper chamber was filled with 1.5 x 105 tumor cells in DMEM with 1% FCS. Incubation times were 6, 12, and 28 h. After the incubation period, cells on the upper side of the membrane were wiped off, and the membrane was fixed in 4% paraformaldehyde and 0.25% glutaraldehyde. Cells on the lower side of the membrane were stained with 0.5% methylenblue in 50% methanol and counted. All of the invasion assays were done in triplicate.
Soft Agar Assay.
Soft agar assays were performed as described previously (23)
. Two x 104 cells of each S2-007 and S2-028 parental cells, as well as two claudin-4 overexpressing S2-007 clones and one mock-transfected S2007 clone were seeded in DMEM/0.33% bacto-agar onto a bottom layer of DMEM/0.5% bacto-agar. Anchorage-independent growth was measured 2 weeks later by counting the colony number.
Zymography.
The gelatinolytic activity of MMPs was determined in the supernatants of S2-007 cells with tetracyclin-inducible claudin-4 expression as described previously (15)
. For this purpose, cells were treated in serum-free or 5% FCS-containing DMEM in the presence or absence of 2 µg/ml doxycyclin. After 24 h, supernatants were concentrated and the protein content was determined using the BCA Protein Assay Reagent (Pierce, Rockford, IL). Equal amounts of protein (20 µg/lane) were mixed with SDS sample buffer without reducing agents and incubated for 20 min at 37°C. Subsequently, samples were separated on a 7.5% PAGE containing 1 mg/ml gelatin for the detection of MMP activity (Invitrogen, Karlsruhe, Germany). After electrophoresis, gels were soaked for 1 h in 2.5% Triton X-100 to remove SDS and incubated for 16 h at 37°C in 50 mM Tris-HCl (pH 7.6) containing 150 mM NaCl, 10 mM CaCl2, and 0.02% NaN3. Gels were stained for 1 h in 45% methanol/10% acetic acid containing 0.5% Coomassie brilliant blue G250 and destained. Proteolytic activity was detected as clear bands on a blue background of the Coomassie blue-stained gel. Zymographic analyses were performed in at least three independent experiments.
Mouse Experiments.
NMRI-
/
mice were propagated and maintained in a pathogen-free environment according to the guidelines of the local animal welfare committee. One x 106 cells of claudin-4 overexpressing S2-007 cells or mock-transfected cells dissolved in PBS (2 clones each; 6 mice/group) were injected into the tail vein of 5-week-old female NMRI
/
mice each. Five weeks after injection, the animals were sacrificed. Lungs, liver, and spleen were paraffin-embedded and examined histologically. Colonizations of the lungs were counted in 10 serial sections of each lung.
EM.
EM analysis was performed as described previously (26)
. In brief, SUIT-2 cells were fixed in an iced solution of buffered 5% paraformaldehyde, embedded in Epon, postfixed, and contrasted with osmium, uranyl, and lead. Semithin sections were studied by light microscopy and thin sections evaluated on a Philips EM10 electron microscope.
| RESULTS |
|---|
|
|
|---|
|
To confirm these findings that were obtained by overexpressing claudin-4, we examined a series of six pancreatic adenocarcinomas immunohistochemically. As depicted in two representative tissues shown in Fig. 1D
, claudin-4 immunostaining in each tissue was restricted to tumor cells, whereas no claudin-4 staining was found in the surrounding extracellular matrix compartment. Moreover, in tumors exhibiting ductal-like structures, claudin-4 was predominantly localized in the apical cell layers adjacent to the ductal lumen (Fig. 1D)
. Interestingly, claudin-4 expression tended to be stronger in well-differentiated tumors as compared with poorly differentiated tumors, a finding that has to be confirmed in a study using a larger series of tumor samples.
Effect of Claudin-4 Expression on Cell Invasion and Anchorage-independent Growth in Vitro.
To investigate the effect of claudin-4 on the invasive potential of S2-007 cells, we performed two-chamber assays. In all three of the examined claudin-4 overexpressing S2-007 clones, invasion was significantly reduced as compared with both parental S2-007 cells and mock-transfected S2-007 cells. The invasive potential of the claudin-4 overexpressing S2-007 cells, as assessed by the two-chamber assays, was closer to the invasive potential of the low-invasive S2-028 cells with high endogenous claudin-4 levels than to the parental S2-007 cells (Fig. 2A)
.
|
Effect of Claudin-4 Expression on Lung Colonization in Vivo.
To examine whether the anti-invasive effect of claudin-4 in vitro has a physiological relevance in vivo, we injected two S2-007 clones stably overexpressing claudin-4 into the tail vein of
/
mice and compared the occurrence of pulmonary colonization in claudin-4 overexpressing versus mock-transfected S2-007 clones after a period of 5 weeks. Interestingly, claudin-4 overexpression significantly reduced the number of pulmonary colonizations by
50%, as compared with mock-transfected cells (Fig. 3A)
. Furthermore, 5 of 16 mice injected with claudin-4 overexpressing cells did not show any evidence of lung metastases, as determined by 10 serial sections of each lung. In contrast, none of the control mice was free of lung metastasis upon sacrification (Fig. 3B)
. Thus, the anti-invasive effect of claudin-4 could be confirmed in vivo.
|
|
Modulation of Claudin-4 by TGF-ß and Oncogenic Ras.
Tight junction structure and integrity are modulated by a variety of cytokines and growth factors. Both the TGF-ß and the Ras cascade have been shown to be of paramount importance for the development of the metastatic phenotype of tumor cells and tumor progression. In pancreatic carcinoma, TGF-ß has been demonstrated as an important modulator of tumor progression (15)
. Despite of its direct growth-inhibitory effects in vitro, TGF-ß is also known to strongly promote invasion of pancreatic cancer cells. To study the TGF-ß responsiveness of claudin-4 we used exogenously added TGF-ß as well as PANC-1 cells stably overexpressing TGF-ß. Interestingly, in both systems claudin-4 expression was down-regulated by TGF-ß (Fig. 5A)
. After addition of exogenous TGF-ß, claudin-4 RNA decreased after 4 h, which was followed by a decrease in claudin-4 protein levels after 12 h (Fig. 5C)
.
|
| DISCUSSION |
|---|
|
|
|---|
In this study, we focused on the biological role of up-regulated claudin-4 in pancreatic cancer cells. We first demonstrated that overexpressed claudin-4 is mainly concentrated at cell-cell contacts. An increase in these cell-cell adhesion sites is ultrastructurally paralleled by an increased number of tight junctions in claudin-4 overexpressing cells. These findings are in accordance to observations by Van Itallie et al. (29) in claudin-4 overexpressing MDCK cells, who described an increase in the total content of TJ strands with a more elaborate and complex pattern of strands.
Interestingly, our functional in vitro data indicate that overexpression of claudin-4 is associated with decreased invasiveness, as demonstrated by two-chamber invasion assays. In addition, claudin-4 overexpression was also associated with a markedly diminished ability of S2-007 cells to anchorage-independent growth in soft agar. We could confirm these observations in vivo and showed a significantly decreased lung colonization rate after tail vein injection of claudin-4 overexpressing cells in nude mice. By examining proliferation and cell cycle progression, we could rule out that the described effects are secondary to altered proliferation, cell cycle progression, or significantly increased apoptosis.
A role of tight junctions as a prerequisite for tumor cell invasion has been described in endothelial cells. The reduction of tight junctions in these cells was found to decrease paracellular resistance and to facilitate invasion of epithelial tumor cells through endothelial cell layers (30 , 31) . In epithelial tumor cells, the formation of junctional complexes including tight and adherent junctions has been shown to reduce the invasive potential (32) . However, to our knowledge, the direct effect of claudins on invasion of tumor cells has not been examined systematically. Our data show for the first time that overexpressed claudin-4 confers a less invasive phenotype in vitro and in vivo. We were able to show that this is not likely to be caused by alterations in the activity of gelatinolytic MMPs, as it has been described previously for other members of the claudin family (17) . In our ultrastructural studies we found an increase in tight junctions between neighboring claudin-4 overexpressing tumor cells. This leads to the conclusion that an increase in the density of cell-cell adhesions formed by tight junctions may represent a crucial impediment against the dissociation of pancreatic cancer cells from their original tumor. This, in turn, would prevent the invasion into neighboring tissues or the formation of distant metastases. A similar mechanism has been proposed for the E-cadherin-mediated development of epithelial polarity and the suppression of invasiveness of cancer cells, which is associated with increased cell contact formation (32) .
Considering that claudin-4 is highly expressed in many pancreatic carcinomas (9) and several other solid tumors (10 , 11) , our in vitro and in vivo findings demonstrating claudin-4 as an anti-invasive factor appear somewhat surprising. On the basis of the immunohistochemical findings in our series of pancreatic carcinoma tissues, in which claudin-4 expression was higher in well-differentiated carcinomas than in undifferentiated tumors, one can hypothesize that claudin-4 expression is mainly a phenomenon of differentiated, less invasive tumors with ductal-like structures. In undifferentiated, highly invasive tumors claudin-4 expression is less pronounced. However, to unequivocally prove a correlation among tumor grading, invasiveness, and claudin-4 expression, a study with a larger series of tumor specimens is warranted.
In support of our data, we identified TGF-ß as a negative modulator of claudin-4. Both exogenous TGF-ß and endogenously overexpressed TGF-ß decreased claudin-4 levels markedly. Despite its antiproliferative effects in the early phase of tumorigenesis, TGF-ß is known as a potent mediator of tumor progression by inducing cell spreading, migration, angiogenesis, and tumor cell invasion (33 , 34) . TGF-ß-induced down-regulation of membrane proteins involved in cell-cell contact formation, such as claudin-4, therefore might be an important mechanism through which TGF-ß promotes tumor invasion.
In addition to the important role of TGF-ß in pancreatic cancer, up to 90% of pancreatic carcinomas have an activating K-Ras mutation (27) . Surprisingly, we found that specific inhibition of both major downstream effectors of Ras, MEK and PI3K, is associated with a decrease in claudin-4 expression in PANC-1 cells. In addition, claudin-4 was also transcriptionally down-regulated in dominant-negative H-Ras (S17N) overexpressing cells. Therefore, transcriptional up-regulation of claudin-4 by Ras-activation could account for the observed high expression of claudin-4 in the majority of pancreatic carcinomas. In the literature, the effect of Ras-activation and its downstream effectors on claudin expression and tight junctions has been discussed controversially thus far. Kinugasa et al. (35) reported a decrease in interleukin 17-induced claudin-2 expression in intestinal epithelial cells after the addition of the MEK inhibitor PD98059. In mammary epithelial cells, both MEK inhibition by PD98059 and PI3K inhibition by LY294002 were able to diminish glucocorticoid-induced transepithelial resistance, which is mainly maintained by the tight junctions (36) . In contrast, Ras-transformed MDCK cells treated with the MEK inhibitor PD98059 showed recruitment of claudin-1 to the cell membrane and increased assembly of tight junctions (13) . In addition, recent results in pig thyrocytes suggest that TGF-ß exerts its effect on epithelial-mesenchymal transition, which includes down-regulation of claudin-1 and decreased transepithelial resistance through a MEK-dependent mechanism (37) . Thus, it seems likely that the constituents of the tight junctions are regulated in a complex manner, which depends on the cellular context and might also vary among different members of the claudin family. Additional studies are necessary to elucidate the regulatory network modulating claudin expression and tight junction formation and integrity.
In summary, we showed that claudin-4 is overexpressed in pancreatic cancer and associated with decreased invasiveness in vitro and in vivo. This effect was morphologically associated with increased formation of tight junctions between tumor cells. Claudin-4 is negatively regulated by TGF-ß and down-regulated by inhibition of the Ras signaling pathway. Our data clearly identify claudin-4 expression as an event that impairs the invasiveness and the metastatic potential of pancreatic cancer cells. Additional studies are warranted to investigate the correlation among claudin-4 expression, tumor invasion, and clinical outcome in pancreatic cancer patients. This might also characterize the groups of patients, which might benefit from a possible CPE-based anticancer therapy targeting claudin-4.
| FOOTNOTES |
|---|
1 Supported by grants of the Deutsche Forschungsgemeinschaft (SFB 518/Project B1) and the European Community (QLG1-CT-2002-01196; to T. M. G.) and by the Sander-Stiftung (project 2001.053.1; to P. M. and T. M. G.), and Deutsche Krebshilfe (10-2031-Le1; to M. M. L.). ![]()
2 To whom requests for reprints should be addressed, at Universität Ulm, Abteilung Innere Medizin I, Robert-Koch-Str.8, 89081 Ulm, Germany. Phone: 49-731-50024385; Fax: 49-731-50024302; E-mail: thomas.gress{at}medizin.uni-ulm.de ![]()
3 The abbreviations used are: CPE, Clostridium perfringens enterotoxin; TGF, transforming growth factor; MMP, matrix metalloproteinase; MEK, mitogen-activated protein/extracellular signal-regulated kinase kinase; PI3K, phosphatidylinositol 3'-kinase; FACS, fluorescence-activated cell sorter; EM, electron microscopy. ![]()
Received 3/ 1/03. Revised 5/28/03. Accepted 7/21/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S.-R. Shiou, A. B. Singh, K. Moorthy, P. K. Datta, M. K. Washington, R. D. Beauchamp, and P. Dhawan Smad4 Regulates Claudin-1 Expression in a Transforming Growth Factor-{beta}-Independent Manner in Colon Cancer Cells Cancer Res., February 15, 2007; 67(4): 1571 - 1579. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Boireau, M. Buchert, M. S. Samuel, J. Pannequin, J. L. Ryan, A. Choquet, H. Chapuis, X. Rebillard, C. Avances, M. Ernst, et al. DNA-methylation-dependent alterations of claudin-4 expression in human bladder carcinoma Carcinogenesis, February 1, 2007; 28(2): 246 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lioni, P. Brafford, C. Andl, A. Rustgi, W. El-Deiry, M. Herlyn, and K. S.M. Smalley Dysregulation of Claudin-7 Leads to Loss of E-Cadherin Expression and the Increased Invasion of Esophageal Squamous Cell Carcinoma Cells Am. J. Pathol., February 1, 2007; 170(2): 709 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Osanai, M. Murata, N. Nishikiori, H. Chiba, T. Kojima, and N. Sawada Epigenetic Silencing of Occludin Promotes Tumorigenic and Metastatic Properties of Cancer Cells via Modulations of Unique Sets of Apoptosis-Associated Genes. Cancer Res., September 15, 2006; 66(18): 9125 - 9133. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Rinker-Schaeffer, J. P. O'Keefe, D. R. Welch, and D. Theodorescu Metastasis Suppressor Proteins: Discovery, Molecular Mechanisms, and Clinical Application. Clin. Cancer Res., July 1, 2006; 12(13): 3882 - 3889. [Full Text] [PDF] |
||||
![]() |
P. Michl, B. Knobel, and J. Downward CUTL1 Is Phosphorylated by Protein Kinase A, Modulating Its Effects on Cell Proliferation and Motility J. Biol. Chem., June 2, 2006; 281(22): 15138 - 15144. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Oku, E. Sasabe, E. Ueta, T. Yamamoto, and T. Osaki Tight Junction Protein Claudin-1 Enhances the Invasive Activity of Oral Squamous Cell Carcinoma Cells by Promoting Cleavage of Laminin-5 {gamma}2 Chain via Matrix Metalloproteinase (MMP)-2 and Membrane-Type MMP-1. Cancer Res., May 15, 2006; 66(10): 5251 - 5257. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ebihara, M. Kondoh, N. Hasuike, M. Harada, H. Mizuguchi, Y. Horiguchi, M. Fujii, and Y. Watanabe Preparation of a Claudin-Targeting Molecule Using a C-Terminal Fragment of Clostridium perfringens Enterotoxin J. Pharmacol. Exp. Ther., January 1, 2006; 316(1): 255 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. N. Lee, E. Huang, and H. J. Ward Tight junction biology and kidney dysfunction Am J Physiol Renal Physiol, January 1, 2006; 290(1): F20 - F34. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Fedwick, T. K. Lapointe, J. B. Meddings, P. M. Sherman, and A. G. Buret Helicobacter pylori Activates Myosin Light-Chain Kinase To Disrupt Claudin-4 and Claudin-5 and Increase Epithelial Permeability Infect. Immun., December 1, 2005; 73(12): 7844 - 7852. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Morin Claudin Proteins in Human Cancer: Promising New Targets for Diagnosis and Therapy Cancer Res., November 1, 2005; 65(21): 9603 - 9606. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Agarwal, T. D'Souza, and P. J. Morin Claudin-3 and Claudin-4 Expression in Ovarian Epithelial Cells Enhances Invasion and Is Associated with Increased Matrix Metalloproteinase-2 Activity Cancer Res., August 15, 2005; 65(16): 7378 - 7385. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. De Craene, B. Gilbert, C. Stove, E. Bruyneel, F. van Roy, and G. Berx The Transcription Factor Snail Induces Tumor Cell Invasion through Modulation of the Epithelial Cell Differentiation Program Cancer Res., July 15, 2005; 65(14): 6237 - 6244. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. T. Barry, A. B. Nobel, and F. A. Wright Significance analysis of functional categories in gene expression studies: a structured permutation approach Bioinformatics, May 1, 2005; 21(9): 1943 - 1949. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mima, S. Tsutsumi, H. Ushijima, M. Takeda, I. Fukuda, K. Yokomizo, K. Suzuki, K. Sano, T. Nakanishi, W. Tomisato, et al. Induction of Claudin-4 by Nonsteroidal Anti-inflammatory Drugs and Its Contribution to Their Chemopreventive Effect Cancer Res., March 1, 2005; 65(5): 1868 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Gadal, A Starzec, C Bozic, C Pillot-Brochet, S Malinge, V Ozanne, J Vicenzi, L Buffat, G Perret, F Iris, et al. Integrative analysis of gene expression patterns predicts specific modulations of defined cell functions by estrogen and tamoxifen in MCF7 breast cancer cells J. Mol. Endocrinol., February 1, 2005; 34(1): 61 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Cheung, K. L. Leung, Y. C. Ip, X. Chen, D. Y. Fong, I. O. Ng, S. T. Fan, and S. So Claudin-10 Expression Level is Associated with Recurrence of Primary Hepatocellular Carcinoma Clin. Cancer Res., January 15, 2005; 11(2): 551 - 556. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Van Itallie and J. M. Anderson The Molecular Physiology of Tight Junction Pores Physiology, December 1, 2004; 19(6): 331 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brumby, J. Secombe, J. Horsfield, M. Coombe, N. Amin, D. Coates, R. Saint, and H. Richardson A Genetic Screen for Dominant Modifiers of a cyclin E Hypomorphic Mutation Identifies Novel Regulators of S-Phase Entry in Drosophila Genetics, September 1, 2004; 168(1): 227 - 251. [Abstract] [Full Text] |