| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
and Suppresses Human Breast Cancer Cell Proliferation1
Department of Biochemistry and Cancer Center, Boston University School of Medicine, Boston, Massachusetts 02118
| ABSTRACT |
|---|
|
|
|---|
(ER
)-positive cells, IB-MECA rapidly down-regulated ER
at mRNA and protein levels and consequently at the transcriptional activity level. Moreover, overexpression of ER
in MCF-7 cells alleviated the proliferation inhibition induced by IB-MECA. The inhibitory effects on cell growth and to some extent on ER
were mimicked by 2-chloro-adenosine >3'-deoxyadenosine> adenosine but not by a variety of other ligands. Our studies indicate that IB-MECA can down-regulate ER
and inhibit proliferation or induce apoptosis in different breast cancer cell types and raise the possibility of using this and related compounds in breast cancer treatment. | INTRODUCTION |
|---|
|
|
|---|
Adenosine exerts many of its effects by activation of specific cell surface receptors. To date, four ARs,3 namely A1AR, A2aAR, A2bAR, and A3AR, have been cloned (8 , 9) . Medicinal chemistry has provided different adenosine analogues that are potent selective activators of specific receptors of this group. These include agonists such as CCPA (A1AR selective), CGS21680 (A2aAR selective), IB-MECA (A3AR selective), and NECA (activates both A2aAR and A2bAR).
Adenosine and AR agonists were recently shown to inhibit growth or induce apoptosis in several types of cancer cells. Epidermoid carcinoma A431 cells and some human cancer cells were inhibited by agonists for A1AR or A2AR (10, 11, 12) . HL-60 leukemia and U-937 lymphoma cells were reported to be induced into apoptosis by A3AR agonists (13 , 14) . Furthermore, adenosine was found as one active component within skeletal muscle cell-conditioned medium, which can inhibit the growth of SK-28 melanoma cells, K-562 chronic myelogenous leukemia cells, and MCF-7 breast cancer cells (15) .
Breast cancer is the most frequently occurring cancer in women in the United States and almost all other developed countries, where approximately one in eight women will have a lifetime risk of developing breast cancer; 30% of patients who display such cancer will die from the disease (16)
. ER
is a marker for many cases of breast cancers and is a primary target of hormone therapies. Tamoxifen, as a selective ER modulator, was used in adjuvant therapy and can effectively reduce the risk of relapses and death in ER-positive patients (17
, 18)
. ER
was one of the earliest established members of the nuclear receptor superfamily and was discovered as a protein that binds with high affinity to the endogenous form of estrogen, 17-ß-estradiol (19)
. ER
participates in many different signaling pathways in the mammary epithelial cells (20)
. One activation pathway involves binding to its ligand and subsequent conformational change, leading to transcriptional regulation of downstream genes and G1-S cell cycle progression (21
, 22)
. Estrogen also activates Cdc25A and down-regulates cyclin-dependent kinase inhibitors such as p27 and p21 (23)
. In MCF-7 cells, inhibition of the estrogen/ER pathway can inhibit anchorage-dependent and anchorage-independent growth (24, 25, 26)
, linking ER
signaling to breast cancer cell proliferation.
In this study, we examined the effect of adenosine and AR agonists on growth of breast cancer cell lines, particularly ER
-positive cells. We found that IB-MECA, an A3AR agonist, can potently inhibit cell proliferation in both anchorage-independent and anchorage-dependent assays. Our results indicated that the effect of IB-MECA in ER
-positive breast cancer cells was not mediated by the activation of A3AR but rather involved ER
down-regulation. These results point to the potential use of IB-MECA in the treatment of breast cancer and demonstrate the existence of a signaling pathway initiated by IB-MECA that can regulate ER
and ER
-mediated processes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids.
pERE-Tk-Luc, consisting of a promoter containing EREs driving the luciferase reporter gene (27)
, and pcDNA3-ER
, consisting of the CMV promoter driving the expression of human ER cDNA (27)
, were kind gifts from Dr. Zhixiong Xiao. pcDNA3 and pEGFP-C1 plasmids were purchased from Clontech (Palo Alto, CA). pRc-hA3AR, consisting of the CMV promoter driving the expression of the human A3AR cDNA, and pCMV-ß-gal, consisting of the CMV promoter driving the bacterial ß-gal gene, were constructed in our laboratory and verified by DNA sequencing.
Cell Culture.
HeLa cells were purchased from American Type Culture Collection (Manassas, VA). MCF-7, ZR75, and T47D cells were originally from American Type Culture Collection and cultured in DMEM (Invitrogen) supplemented with 10% FBS, 5 units/ml penicillin, 5 µg/ml streptomycin, and 2 mM L-glutamine (all from Invitrogen). Hs578t cells were cultured in the above medium supplemented with 0.01 mg/ml insulin (Sigma). When indicated, MCF-7 cells were cultured in DMEM free of phenol red (Invitrogen) with charcoal-stripped serum (Hyclone, Logan, UT) for 3 days before they were treated with drugs. In experiments requiring serum starvation, MCF-7 cells were washed three times with serum-free medium and incubated in DMEM containing 0.1% FBS for 48 h before they were used in experiments. Rat bone marrow cells were obtained from femurs of rats (Sprague Dawley; Taconic, Albany, NY) and cultured in Iscoves Modified Eagles Medium (Invitrogen) with 10% FBS, as described previously (28)
.
Anchorage-independent Growth Assay (Soft Agar Assay).
Soft agar assay was performed as previously described (29)
with a few modifications. Ligands were added into the bottom and top agar before plating into 6-well plates. Cells were treated with trypsin (Invitrogen) for 5 min in a 37°C incubator and pipetted several times so that most cells were in single-cell forms. Cells were counted with a hemacytometer (Hausser Scientific/VWR, South Plainfield, NJ), and 10,000 cells were mixed with top agar and plated into each well. After the top agar had solidified, 2 ml of medium containing the same treatment were added on top of the agar. This covering medium was changed every 2 days during culture. After 2 weeks of culture, each well was counted for the number of colonies formed using an Olympus IX70 microscope at x40 magnification. A cell colony was defined as any cluster of cells that contain more than three cells. The average of counts from three random fields for each well was taken as the colony number and analyzed. Each treatment was performed in triplicate.
Anchorage-dependent Growth Assay.
Cells were plated into 6-well plates and grown overnight before treatments. The seeding concentration of MCF-7 cells was 2 x 105/well, which was determined during preliminary experiments as not allowing the cells to reach confluence within 3 days. Cells were treated either with vehicle or ligands as indicated. Cells were detached by incubation with trypsin (Invitrogen), stained with trypan blue dye (Invitrogen), and counted with a hemacytometer before and after treatment. Only cells that exclude the trypan blue dye were counted, unless otherwise stated.
Western Blot Analysis.
Cells were washed three times in cold 1x PBS and collected by scraping on ice. Western blot analysis was performed as previously described, using enhanced chemiluminescence (28)
. Antibodies used in this study were: ER
(NeoMarkers/Lab Vision, Fremont, CA, Ab-15); cyclin A (H-432; Santa Cruz Biotechnology, Santa Cruz, CA); cyclin B1 (H-433; Santa Cruz Biotechnology); cyclin E (HE-12; Upstate Biotechnology, Waltham, MA); ILK (clone 65.1.9; Upstate Biotechnology); Akt (no. 9272; Cell Signaling Technology, Beverly, MA); and phosphorylated Akt (no. 9271, Ser473; Cell Signaling Technology). ER
antibody was used at 1:100 dilutions. Cyclin A and cyclin B1 antibodies were used at 1:500 dilutions. Cyclin E, ILK, Akt, and phospho-Akt antibodies were used at a dilution of 1:1000. Data were quantitated using Kodak Digital Scientific 1D software (Eastman Kodak, New Haven, CT).
Thymidine Incorporation Assay.
Thymidine incorporation assays were performed as described (30)
with modifications. Rat bone marrow cells were cultured in 25-cm2 flasks at a concentration of 20 x 106 cells/2 ml. After drug treatment for 24 h, cells were incubated with [3
H]thymidine at a final concentration of 3 µCi/ml for 8 h. For MCF-7 cells, cells were cultured in 6-well plates and incubated with [3
H]thymidine for 2 h after drug treatment. Cells were divided into two portions, 60% of which were processed as previously described (30)
to obtain tritium counts. The rest of the cells were lysed with Western blotting lysis buffer, and protein concentrations were determined by Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA). Tritium counts were normalized with corresponding protein concentrations to account for cell number variations.
Flow Cytometry and Apoptosis Analysis.
Cells were detached from tissue culture plates by trypsin treatment and collected by centrifugation at 1200 x g for 5 min and washed once with PBS. Staining of cells with PI and analyzing them on a flow cytometer (FACScan; Becton Dickinson, Research Triangle Park, NC) were performed as described previously (31)
. Data were analyzed with CellQuest software (Becton Dickinson). The percentage of events appearing with a fluorescence level less than those of diploid cells was calculated as an estimate of cells undergoing apoptosis.
Transfections and Reporter Gene Assay.
Transient transfection was performed using FuGene6 (Roche, Indianapolis, IN) transfection reagent according to manufacturers protocol. For cells cultured in 75-cm2 flasks, circular reporter plasmid pERE-Tk-Luc at 10 µg and 2 µg of pCMV-ß-gal were transfected with 25 µl FuGene6 reagent/flask. Cells were split into 6-well plates 12 h after transfection and incubated overnight in fresh medium. Cells were treated with vehicle or 100 µM IB-MECA for 12 h before harvesting. Luciferase and ß-gal activities were measured as described previously (32
, 33)
. Luciferase readings and ß-gal activities were normalized against protein concentrations of the cell lysates, using Bio-Rad protein assay reagent. In experiments overexpressing ER
, 2 µg of pcDNA3-ER
were transfected with 5 µl of FuGene6 into each well of 6-well plates. Cells were treated with vehicle (DMSO) or IB-MECA 1 day after transfection. Transfection efficiency was determined by parallel transfection of pEGFP-C1 and counting fluorescent cells under microscope.
Stable transfection was performed with procedures similar to those of transient transfection, except that the plasmid pRc-A3AR was linearized with PvuI and purified by phenol/chloroform extraction and ethanol precipitation. Transfected MCF-7 cells were selected with 500 µg/ml Geneticin (Invitrogen) until Geneticin-treated control cells all died. This pool of stably transfected cells was either used in experiments or subjected to single-clone selection with limited dilution as described previously (32) . Briefly, cells were diluted to a concentration of 2.5 cells/ml and added into 96-well plates at 200 µl/well. Clones of cells expanded in this manner were analyzed for their A3AR expression using RT-PCR (see below).
Total RNA Preparation and RT-PCR.
Total RNA from MCF-7 cells or rat brain was prepared with Trizol (Invitrogen) as described previously (28)
. For reverse transcription, 2 µg of RNA were used in a 30-µl reaction with random primers and Moloney murine leukemia virus reverse transcriptase (Invitrogen), following the manufacturers protocol. To control for possible contamination from genomic DNA in subsequent PCR reactions, control reverse transcription reactions were carried out under identical conditions but without reverse transcriptase. After reverse transcription, 1 µl each of the products was used in PCR reactions. In experiments analyzing A3AR expression in the brain and breast cancer cell lines, PCR reactions were performed for 33 cycles. In experiments examining overexpressed A3AR, 27 cycles of PCR were used. Specific primers, exactly matching both human and rat cDNA, were designed for A3AR, which recognize two separate exons, according to genomic sequences (from GenBank). Sequences for the sense and antisense A3AR primers (5'-3') are: tccatcatgtccttgctg and gcacatgacaaccaggg (annealing temperature: 61°C). In the experiments analyzing ER
, ERß, and pS2 mRNA levels, semiquantitative PCR reactions were carried out. Cycle numbers were predetermined to produce a linear amplification of reverse transcription products and are listed in the parentheses together with corresponding annealing temperatures and expected product sizes. The sense and antisense primer sequences are listed below (5'-3'): for human ER
(21 cycles, 55°C, 358 bp), gatccaagggaacgagctgg and tgggctcgttctccaggtag; for human pS2 (16 cycles, 57°C, 50 bp), accggacacctcagacacg and ctgtgttgtgagccgaggc; for human ERß (28 cycles, 57°C, 210 bp), aacacctgggcacctttctc and acagcgcagaagtgagcatc; and for GAPDH (16 cycles, 55°C, 570 bp), tcaccatcttccaggag and gcttcaccaccttcttg. PCR products were resolved on 5% polyacrylamide gels run with 0.5x Tris-borate EDTA buffer and stained with GelStar nucleic acid stain (BioWhittaker Molecular Applications, Baltimore, MD). PCR reactions were always performed in duplicates to control for PCR variations. All gels were visualized with a Kodak scientific imaging system and quantified using Kodak Digital Scientific 1D software (Eastman Kodak).
mRNA Half-Life Determination.
MCF-7 cells were pretreated with vehicle (DMSO) or 100 µM IB-MECA for 6 h, followed by addition of 80 µM DRB or 50 µM actinomycin D. Cells were harvested either before addition of transcription inhibitor (0 h) or after different time periods. Total RNA was prepared, and ER
content was assayed by RT-PCR analyses as described in "Materials and Methods" for RT-PCR. To control for the amount of RNA used in reverse transcription reactions, 2 µg each of total RNA were resolved on a denaturing agarose gel as previously described (28)
and stained with ethidium bromide.
| RESULTS |
|---|
|
|
|---|
50% of the colony-forming ability of MCF-7 cells. No effect was observed when inosine was used instead of adenosine (data not shown).
|
Effects of IB-MECA on Anchorage-independent Growth and Apoptosis of Different Breast Cancer Cell Lines.
We tested the effect of IB-MECA on several human breast cancer cell lines, including MCF-7, ZR-75, T47D, and Hs578T, as well as on HeLa cells (human cervix adenocarcinoma cell line). Western blot analyses (Fig. 2A)
showed that the MCF-7, ZR-75, and T47D cell lines are ER
positive. Hs578T cells do not contain a detectable level of ER
, consistent with previous studies (34
, 35)
. All breast cancer cell lines tested showed a dramatic decrease in colony formation, whereas HeLa cells only exhibited a mild response to this agonist (Fig. 2B)
, suggesting that inhibition of anchorage-independent growth by IB-MECA is closely related to the origin of cancer.
|
Our findings suggest that IB-MECA can induce two pathways in breast cancer cells. One involves growth inhibition and another involves apoptosis. Although IB-MECA-induced apoptosis by A3AR-dependent and A3AR-independent mechanisms have been studied in some cancer cells (13
, 14
, 37)
, IB-MECA-induced growth arrest in ER
-positive breast cancer cells, however, has not been previously reported.
IB-MECA Inhibits Anchorage-dependent Proliferation of MCF-7 Cells.
Because IB-MECA inhibited the anchorage-independent proliferation of MCF-7 cells on both colony numbers and sizes (Fig. 1, E and F)
, we additionally tested this chemical on the anchorage-dependent proliferation of these cells. The numbers of trypan-blue negative cells were followed after MCF-7 cells were treated with IB-MECA. Although vehicle-treated cells showed an exponential increase in cell count, cells treated with IB-MECA did not show much change in the number of viable cells, even after 3 days of drug treatment (Fig. 3A)
. Our data indicated that IB-MECA was able to rapidly inhibit anchorage-dependent proliferation of MCF-7 cells.
|
IB-MECA Arrests MCF-7 Cells at G1 or G1-S Phase of the Cell Cycle.
To determine which phase of the cell cycle was affected by IB-MECA, we analyzed the cellular DNA profile through flow cytometry analysis. MCF-7 cells treated with IB-MECA displayed a decreased S-phase population from 25 to 12% (Fig. 4A)
, compared with vehicle-treated cells. The peak with diploid DNA content increased from 50 to 64% after IB-MECA treatment. There was no significant change in the percentage of tetraploid cells in treated versus control samples. These results suggested that IB-MECA had a primary effect on cell cycle arrest at G1 phase or G1-S transition.
|
IB-MECA-induced Growth Arrest Is Not Mediated through A3AR.
As an A3AR-selective agonist, IB-MECA-induced inhibition of proliferation of several transformed cell lines had been attributed to A3AR activation (36
, 38
, 40)
. The affinity of IB-MECA for A3AR was reported to be in the nanomolar range (41)
. However, the cell growth inhibitory effect we report here could only be observed at concentrations > 10 µM, suggesting it is unlikely that the effect is mediated by A3AR signaling. To test this contention, we examined A3AR expression (Fig. 5A)
, using RT-PCR, in the breast cancer cell lines MCF-7, ZR-75, T47D (ER
positive), and Hs578T (ER
negative). Compared with brain, an A3AR-expressing tissue (42)
, all breast cancer cell lines showed no detectable levels of A3AR, even after 33 cycles of PCR amplification. This indicated that A3AR is not the major pathway in the IB-MECA-induced effects on breast cancer cells.
|
IB-MECA Treatment Decreases ER
in MCF-7 Cells.
In search for means by which IB-MECA might induce rapid changes in cell proliferation, we sought to determine whether ER
is a target of IB-MECA treatment. ER
activation is known to promote cell cycle progression, through G1/S and enhance both anchorage-dependent and anchorage-independent growth of breast cancer cells (21
, 22 , 43, 44, 45, 46, 47, 48)
. Indeed, Western blot analysis indicated that the ER
protein level in MCF-7 cells was reduced by IB-MECA treatment although not affected by NECA (Fig. 6A)
. The decrease of ER
protein showed a similar dosage response as those of cell proliferation inhibition and of cyclin decrease (Figs. 1E
and 4B
). Down-regulation of ER
by IB-MECA treatment occurred in a relatively fast manner (Fig. 6B)
. Reduction of ER
protein levels was also observed in ZR-75 and T47D cells (data not shown), suggesting that the impact of IB-MECA on this protein is common to ER
-positive breast cancer cell lines. These results suggested that ER
targeting might be a factor responsible for the growth inhibition effect of IB-MECA. The decrease of ER
could be detected not only under normal culturing conditions but also in phenol red-free cell culture medium supplemented with charcoal-stripped serum (data not shown), indicating that estrogen contained in normal serum did not affect this down-regulation.
|
such as 17-ß-estradiol can reduce ER
level by regulating ER
protein stability (49
, 50)
, a lowered protein level may not correlate with a reduction of ER
activity. Hence, we also examined the transcriptional activity of endogenous ER
after IB-MECA treatment, using a reporter construct containing EREs in the promoter (27)
. As shown in Fig. 6C
and subsequently caused a reduced activity of this transcription factor.
To explore whether the inhibition was primarily on ER
protein level or on both the level of protein and activation, MCF-7 cells cultured under estrogen-depleted conditions were treated with 2 or 20 nM 17-ß-estradiol. Without IB-MECA, ß-estradiol-treated cells showed an increase in cell number to 160170% after 1 day of culture (Fig. 6D)
. This augmentation is similar to the rate of cell number increase under normal culturing condition (Figs. 3A
and 8B
). Cells cultured without additional 17-ß-estradiol displayed a very mild increase in cell number (up to 125%; Fig. 6D
), as would be expected from an estrogen-dependent cell line. With IB-MECA, however, all samples showed cell counts comparable with that of day 0, even when 17-ß-estradiol was present at 2 or 20 nM (Fig. 6D)
. This indicated that IB-MECA was able to inhibit ß-estradiol-induced cell proliferation in MCF-7 cells. Thus, we concluded that the primary effect of IB-MECA is on ER
level rather than on its activation.
|
Is Likely Attributable to Decreased Transcription from the ER
Gene.
regulation have revealed that this gene is regulated at the levels of transcription (51)
, mRNA stability (52, 53, 54)
, and protein degradation (49
, 50)
. We investigated the down-regulation induced by IB-MECA by first examining the abundance of ER
mRNA. For comparison between protein levels and mRNA levels, materials from the same samples as in Fig. 6B
mRNA in a fast and time-dependent manner, with the first sign of decrease after 4 h of IB-MECA treatment. After ER
down-regulation, the mRNA level of pS2, an endogenous estrogen-responsive gene (55)
, was also reduced by IB-MECA. The down-regulation of pS2 could be observed after 812 h (Fig. 7A)
mRNA down-regulation precedes that of ER
protein (Figs. 6B
mRNA. Indeed, we did not notice any significant change in ER
protein degradation upon IB-MECA treatment when protein synthesis was inhibited by cycloheximide (Fig. 7B)
|
gene transcription or mRNA stability, we examined the half-life of ER
message in vehicle- or IB-MECA-treated cells. MCF-7 cells were pretreated with vehicle or IB-MECA for 6 h before adding the transcription inhibitor DRB, which causes premature transcription termination. Consistent with Fig. 7A
mRNA was decreased after 6 h of IB-MECA pretreatment, as revealed by semiquantitative RT-PCR (the 0 h time point; Fig. 7C
measured under the experimental conditions may be longer than the real half-life in the cells because the used transcription inhibitor may not shut down transcription immediately. Nevertheless, comparing vehicle- and IB-MECA-treated cells would indicate whether there is an impressive difference in ER
half-lives. The mRNA half-life in IB-MECA-treated cells was similar to that in vehicle-treated cells (Fig. 7, C and E)
was most likely on the transcription of the gene. It should be pointed out that nuclear run-on assays were attempted, as we described previously (32)
, but ER
de novo transcription in control cells was below our detection limit.
Overexpression of ER
Can Reverse the Growth Inhibition Induced by IB-MECA.
Results from the above experiments strongly suggest that the decrease of ER
is a pathway that leads to IB-MECA-induced cell cycle inhibition. In fact, ER
activation has been well documented to promote cell cycle progression in MCF-7 cells (21
, 22
, 43 , 44
, 46)
. To further verify this, we took advantage of the fact that the CMV promoter was not significantly affected by IB-MECA treatment and, hence, we transfected cells with ER
cDNA under the control of the CMV promoter. This would provide the cells with sufficient amount of ER
to counter the decrease induced by IB-MECA. Indeed, ER
levels were high in the transfected cells, both before and after IB-MECA treatment (Fig. 8A)
.
If the inhibition of IB-MECA was mediated through a decrease in ER
, we would expect to see a moderate or no effect of IB-MECA on growth of ER
-overexpressing cells. Because only cells transfected with ER
may exhibit any resistance, transfection efficiency will be key in determining the potential increase in cell counts as compared with cells transfected with control plasmid. Stable transfection of ER
was attempted twice without success, which might be attributable to any potential long-term harmful effect of high levels of ER
in MCF-7 cells. Instead, we overexpressed ER
by transient transfection, and a transfection efficiency of
40% was determined by counting green cells from a parallel transfection with a CMV-driven green fluorescence protein construct (pEGFP-C1). It should be pointed out that the percentage of green fluorescence protein-transfected cells within the total population decreased with longer period of culturing when the plasmid was transiently transfected (data not shown). We performed the ER
transfection experiment with 1 day of IB-MECA treatment to obtain a relatively high percentage of transfected cells.
When ER
was overexpressed in MCF-7 cells, IB-MECA treatment resulted in a moderate effect on growth, as compared with a larger effect in control cells (Fig. 8B)
. It is reasonable to assume that IB-MECA effect on growth of the transfected pool of cells was not eliminated because only
40% of the cells overexpressed the transgene. All these data are consistent with the numerous reports linking inhibition of ER
with suppression of breast cancer cell growth, as reviewed above.
Effects of Adenosine and Several Adenosine Analogues on ER
Level and Proliferation of MCF-7 Cells.
We extended the assays performed on cells with IB-MECA treatment and sought to examine a variety of adenosine analogues for their abilities to suppress ER
and MCF-7 cell growth (summarized in Table 1
).
|
level. Inosine did not inhibit the proliferation of MCF-7 cells. The A1AR selective analogue, CCPA, or the A2-type selective analogue, NECA, had no significant effect on cell proliferation and did not affect ER
protein level. We also tested another A3AR-selective agonist, chloro-IB-MECA (results not shown). At 10 µM, it had no effect on anchorage-independent growth of MCF-7 cells, whereas at 100 µM, it rendered almost all of the cells as trypan blue-positive within 6 h of treatment. Such a toxic effect prevented us from obtaining enough protein for additional analyses on ER
protein.
We also examined adenosine analogues, which are not selective for ARs and have been described as inhibitors of cancer cells. For example, 2CdA was used clinically for treating chronic lymphocytic leukemia (57)
or infantile myofibromatosis (58)
. 3'-dA was shown to inhibit leukemia cells (59)
. In our studies, 2CdA significantly inhibited the growth of MCF-7 human breast cancer cells. In contrast to IB-MECA, however, it was as effective at 1 µM (data not shown) as at 100 µM, and it did not have a prominent effect on ER
levels. CADO >3'-dA significantly inhibited cell growth and ER
levels, without inducing apoptosis. These compounds, as IB-MECA, were only effective when used at a 10100-µM range. Although these analogues affect ER
in a similar trend as IB-MECA, they likely also influence mechanisms not affected by IB-MECA because they arrest the cells cycle in a different phase. Serum starvation, which arrested the cell cycle at diploid phase (similarly to IB-MECA), did not reduce ER
level.
A variety of other adenosine analogues might be screened for inhibition of growth of breast cancer cells in vitro, using the tools we used here. Our current data should also motivate future examination of IB-MECA, CADO, as well as 3'-dA for inhibition of breast cancer in animal models.
| DISCUSSION |
|---|
|
|
|---|
How IB-MECA triggers the effect on proliferation in the treated breast cancer cells is not clear. It is possible that IB-MECA at high concentrations binds other unidentified membrane receptors and triggers downstream signaling. Another possibility could be that the compound signals through direct interaction with intracellular targets, after being transported into the cell. Such intracellular mechanisms have been noticed for adenosine (60) and an adenosine analogue, 2-chloroadenosine (61) , using the nucleoside transporter inhibitor dipyridamole. In our system, 10 µM dipyridamole did not prevent the growth inhibitory effect of IB-MECA, whereas at higher concentrations, dipyridamole had by itself an inhibitory effect on cell growth. It is possible, however, that the nucleoside uptake inhibitor cannot fully block the transport of IB-MECA because IB-MECA at higher concentrations might compete for the transporters or enter the cell by a nucleoside transporter-independent mechanism. In lack of radiolabeled IB-MECA, we were not able to determine the intracellular concentration of this ligand. The details of the mechanisms by which IB-MECA targets its effector molecules are intriguing and await additional exploration.
In search for mechanisms of action of IB-MECA on breast cancer cell growth, we focused on a known regulator of these cells, the ER
. We showed that in ER
-positive breast cancer cell lines MCF-7, ZR-75, and T47, IB-MECA down-regulated ER
, suggesting that this effect is general in ER
-positive breast cancer cells. We also showed that reversing the down-regulation of ER
significantly attenuated the growth inhibition induced by IB-MECA, indicating that ER
down-regulation is one pathway responsible for the growth inhibition in ER-positive breast cancer cells. This, however, does not exclude the possibility that other pathways are also involved in IB-MECA-induced proliferation inhibition in these cells. We found that IB-MECA regulated ER
through a down-regulation of mRNA and protein and consequently ER
transcriptional activity. The half-life of ER
message was not significantly altered when IB-MECA was present. This eliminates the possibility of regulation on message stability and points to a high likelihood of regulation through gene transcription. The ER
gene contains multiple promoters, some of which are as far as 150 kb upstream of the primary transcriptional start site (62
, 63)
. Only a few transcription factors are known to regulate ER
gene expression (51
, 64)
, including AP2
. Additional experiments are needed to elucidate the detailed mechanism of ER
gene down-regulation by IB-MECA. The mechanism by which IB-MECA down-regulates ER
is different from the one found for selective ER down-regulators such as ICI 182,780 (also known as fulvestrant and Faslodex). ICI 182,780 reduces ER
level through increased ER
protein turnover (65, 66, 67)
, whereas IB-MECA down-regulates ER
through an effect on gene expression. In this view, IB-MECA and similar compounds may be efficacious in the treatment of breast cancers that are resistant to or have acquired resistance (68)
to the pure antiestrogen ICI 182,780 and thus might be important additions to the arsenal of endocrine therapies for human breast cancer.
We examined the effect of IB-MECA on several different breast cancer cell lines. IB-MECA inhibited the growth of MCF-7 and ZR-75 cells and induced apoptosis in T47D and Hs578T cells. In T47D cells, IB-MECA treatment down-regulated ER
in a similar manner as in MCF-7 cells. It is known that T47D cells are estrogen-signaling-dependent; estrogen stimulates the proliferation of T47D cells and inhibiting estrogen signaling results in an inhibition of proliferation (69, 70, 71, 72)
. Thus, it is possible that in T47D cells, two different pathways were induced by IB-MECA. One pathway involves ER
, which is common in all ER
-positive cells and which would lead to proliferation inhibition. Another pathway, which is not activated in MCF-7 cells and ZR-75 cells, initiates apoptosis in T47D cells. In MCF-7 cells, IB-MECA does not induce or inhibit apoptosis. Apoptotic events can be initiated via a variety of signaling pathways and by activation of one or more related regulators (reviewed in Refs. 73, 74, 75
). We speculate that IB-MECA does not initiate apoptosis in MCF-7 cells because of its ability to activate certain antiapoptotic molecules such as Akt (reviewed in Refs. 76
, 77
) so that the balance between its apoptotic and antiapoptotic signals are maintained. Hence, the dominant effect of IB-MECA in MCF-7 cells is inhibition of ER
expression and proliferation. We found that IB-MECA induced Akt phosphorylation (at Ser473) in MCF-7 cells (data not shown), as also reported in rat basophilic leukemia 2H3 cells (78)
. This does not imply, however, that Akt is the only pathway by which IB-MECA might affect apoptosis in these cells. Additional exploration is needed to reveal the detailed mechanisms by which apoptosis is induced by IB-MECA in some cell lines but not in others.
In summary, we found that IB-MECA potently inhibits the proliferation of ER-positive breast cancer cells. ER
was identified as one pathway that is rapidly affected by IB-MECA in its inhibitory effect on proliferation. Interestingly, CADO as well as 3'-dA mimicked the effect of IB-MECA in this regard, except that the influence on ER
was milder and the cell cycle phase affected was different, suggesting that they act via an alternative mechanism. Our work highlights the possibility of using IB-MECA and some other adenosine analogues as drugs to treat breast cancers. IB-MECA may also be used in therapies that are aimed at regulating ER
levels. We propose that IB-MECA can serve as a backbone for chemical engineering that may yield a line of related compounds that are potent and specific.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 This work was supported by an NCI core grant to Boston University School of Medicine Cancer Center. ![]()
2 To whom requests for reprints should be addressed, at Biochemistry, K225, Boston University School of Medicine, 715 Albany Street, Boston, MA 02118. Phone: (617) 638-5053; Fax: (617) 638-5054; E-mail: ravid{at}biochem.bumc.bu.edu ![]()
3 The abbreviations used are: AR, adenosine receptor; CCPA, 2-chloro-N6-cyclopentyladenosine; NECA, 5'-(N-ethylcarboxamido)adenosine; IB-MECA, N6-(3-iodobenzyl)adenosine-5'-N-methyluronamide; CGS21680, 2-p-(2-carboxyethyl)phenethylamino-5'-N-ethylcarboxamidoadenosine; ER, estrogen receptor; 2CdA, 2-chloro-2'-deoxyadenosine; CADO, 2-chloro-adenosine; 3'dA, 3'-deoxyadenosine; PI, propidium iodide; CMV, cytomegalovirus; ß-gal, ß-galactosidase; ILK, integrin-linked kinase; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DRB, 5,6-dichlorobenzimidazole riboside; ERE, estrogen response element. ![]()
Received 2/26/03. Revised 6/25/03. Accepted 7/ 3/03.
| REFERENCES |
|---|
|
|
|---|
B in breast cancer. Cancer Res., 61: 3810-3818, 2001.
messenger ribonucleic acid in sheep endometrium by increasing its stability. Biol. Reprod., 60: 134-139, 1999.
gene mediates rapid messenger ribonucleic acid turnover. Endocrinology, 141: 2805-2813, 2000.
gene promoter region. Mol. Endocrinol., 15: 2057-2063, 2001.
and essential for the antiproliferative activity of ICI 182,780 in ER
-positive breast cancer cells. Mol. Endocrinol., 17: 356-365, 2003.
-interferon, 17ß-estradiol, and tamoxifen on estrogen receptor concentration and cell cycle kinetics of MCF 7 cells. Cancer Res., 50: 5387-5391, 1990.This article has been cited by other articles:
![]() |
K. Ishitani, J. Lin, J. E. Manson, J. E. Buring, and S. M. Zhang Caffeine Consumption and the Risk of Breast Cancer in a Large Prospective Cohort of Women Arch Intern Med, October 13, 2008; 168(18): 2022 - 2031. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Amlal, S. Faroqui, A. Balasubramaniam, and S. Sheriff Estrogen Up-regulates Neuropeptide Y Y1 Receptor Expression in a Human Breast Cancer Cell Line. Cancer Res., April 1, 2006; 66(7): 3706 - 3714. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chung, J.-Y. Jung, S.-D. Cho, K.-A Hong, H.-J. Kim, D.-H. Shin, H. Kim, H. O. Kim, D. H. Shin, H. W. Lee, et al. The antitumor effect of LJ-529, a novel agonist to A3 adenosine receptor, in both estrogen receptor-positive and estrogen receptor-negative human breast cancers. Mol. Cancer Ther., March 1, 2006; 5(3): 685 - 692. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. G. Nguyen, D. Chinnappan, T. Urano, and K. Ravid Mechanism of Aurora-B Degradation and Its Dependency on Intact KEN and A-Boxes: Identification of an Aneuploidy-Promoting Property Mol. Cell. Biol., June 15, 2005; 25(12): 4977 - 4992. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |