Cancer Research Meeting Calendar  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, J.
Right arrow Articles by Ravid, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, J.
Right arrow Articles by Ravid, K.
[Cancer Research 63, 6413-6423, October 1, 2003]
© 2003 American Association for Cancer Research


Regular Articles

An Adenosine Analogue, IB-MECA, Down-Regulates Estrogen Receptor {alpha} and Suppresses Human Breast Cancer Cell Proliferation1

Jun Lu, Anne Pierron and Katya Ravid2

Department of Biochemistry and Cancer Center, Boston University School of Medicine, Boston, Massachusetts 02118


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Adenosine, a natural metabolite, plays important roles in several physiological and pathological processes, including modulation of cellular proliferation. Here, we report that among different adenosine analogues tested, micromolar concentrations of the A3 adenosine receptor (A3AR)-selective agonist N6-(3-iodobenzyl)adenosine-5'-N-methyluronamide (IB-MECA) completely inhibited the growth of the human breast cancer cell lines MCF-7 and ZR-75 while inducing apoptosis in T47D and Hs578T cells, which do not express A3AR mRNA. In MCF-7 cells, A3AR overexpression did not increase the sensitivity to drug treatment and an A3AR antagonist did not abolish IB-MECA effect. In search for mechanisms of the effect of this ligand, we found that in estrogen receptor {alpha} (ER{alpha})-positive cells, IB-MECA rapidly down-regulated ER{alpha} at mRNA and protein levels and consequently at the transcriptional activity level. Moreover, overexpression of ER{alpha} in MCF-7 cells alleviated the proliferation inhibition induced by IB-MECA. The inhibitory effects on cell growth and to some extent on ER{alpha} were mimicked by 2-chloro-adenosine >3'-deoxyadenosine> adenosine but not by a variety of other ligands. Our studies indicate that IB-MECA can down-regulate ER{alpha} and inhibit proliferation or induce apoptosis in different breast cancer cell types and raise the possibility of using this and related compounds in breast cancer treatment.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The purine nucleoside adenosine is a natural metabolite that plays a role in several physiological and pathological processes such as inhibition of platelet aggregation, cardioprotection after ischemia, vasodilation, mast cell activation, and lypolysis (see review in Ref. 1 ). Adenosine is produced in and released at micromolar concentration from diverse cells, including fibroblasts, endothelial cells, epithelial cells, cardiac myocytes, muscle cells, and platelets (2, 3, 4, 5) . The level of adenosine is additionally elevated under conditions such as muscle exercise (6) and ischemia (7) .

Adenosine exerts many of its effects by activation of specific cell surface receptors. To date, four ARs,3 namely A1AR, A2aAR, A2bAR, and A3AR, have been cloned (8 , 9) . Medicinal chemistry has provided different adenosine analogues that are potent selective activators of specific receptors of this group. These include agonists such as CCPA (A1AR selective), CGS21680 (A2aAR selective), IB-MECA (A3AR selective), and NECA (activates both A2aAR and A2bAR).

Adenosine and AR agonists were recently shown to inhibit growth or induce apoptosis in several types of cancer cells. Epidermoid carcinoma A431 cells and some human cancer cells were inhibited by agonists for A1AR or A2AR (10, 11, 12) . HL-60 leukemia and U-937 lymphoma cells were reported to be induced into apoptosis by A3AR agonists (13 , 14) . Furthermore, adenosine was found as one active component within skeletal muscle cell-conditioned medium, which can inhibit the growth of SK-28 melanoma cells, K-562 chronic myelogenous leukemia cells, and MCF-7 breast cancer cells (15) .

Breast cancer is the most frequently occurring cancer in women in the United States and almost all other developed countries, where approximately one in eight women will have a lifetime risk of developing breast cancer; 30% of patients who display such cancer will die from the disease (16) . ER{alpha} is a marker for many cases of breast cancers and is a primary target of hormone therapies. Tamoxifen, as a selective ER modulator, was used in adjuvant therapy and can effectively reduce the risk of relapses and death in ER-positive patients (17 , 18) . ER{alpha} was one of the earliest established members of the nuclear receptor superfamily and was discovered as a protein that binds with high affinity to the endogenous form of estrogen, 17-ß-estradiol (19) . ER{alpha} participates in many different signaling pathways in the mammary epithelial cells (20) . One activation pathway involves binding to its ligand and subsequent conformational change, leading to transcriptional regulation of downstream genes and G1-S cell cycle progression (21 , 22) . Estrogen also activates Cdc25A and down-regulates cyclin-dependent kinase inhibitors such as p27 and p21 (23) . In MCF-7 cells, inhibition of the estrogen/ER pathway can inhibit anchorage-dependent and anchorage-independent growth (24, 25, 26) , linking ER{alpha} signaling to breast cancer cell proliferation.

In this study, we examined the effect of adenosine and AR agonists on growth of breast cancer cell lines, particularly ER{alpha}-positive cells. We found that IB-MECA, an A3AR agonist, can potently inhibit cell proliferation in both anchorage-independent and anchorage-dependent assays. Our results indicated that the effect of IB-MECA in ER{alpha}-positive breast cancer cells was not mediated by the activation of A3AR but rather involved ER{alpha} down-regulation. These results point to the potential use of IB-MECA in the treatment of breast cancer and demonstrate the existence of a signaling pathway initiated by IB-MECA that can regulate ER{alpha} and ER{alpha}-mediated processes.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals.
All chemicals were purchased from Sigma (St. Louis, MO), unless otherwise indicated. IB-MECA, C1-IB-MECA, NECA, CCPA, 2CdA, and CADO were dissolved in DMSO, with a stock concentration of 50 mM and stored in -80°C. Adenosine, inosine, and 3'dA (also called cordycepin) were freshly dissolved before experiments into complete cell culture medium. CGS21680 was dissolved in PBS (Invitrogen, Carlsbad, CA) at 2 mM. MRS1191, dipyridamole, and S-(4nitrobenzyl)-thioinosine were dissolved in DMSO. ß-Estradiol was dissolved in 100% ethanol at 20 mM.

Plasmids.
pERE-Tk-Luc, consisting of a promoter containing EREs driving the luciferase reporter gene (27) , and pcDNA3-ER{alpha}, consisting of the CMV promoter driving the expression of human ER cDNA (27) , were kind gifts from Dr. Zhixiong Xiao. pcDNA3 and pEGFP-C1 plasmids were purchased from Clontech (Palo Alto, CA). pRc-hA3AR, consisting of the CMV promoter driving the expression of the human A3AR cDNA, and pCMV-ß-gal, consisting of the CMV promoter driving the bacterial ß-gal gene, were constructed in our laboratory and verified by DNA sequencing.

Cell Culture.
HeLa cells were purchased from American Type Culture Collection (Manassas, VA). MCF-7, ZR75, and T47D cells were originally from American Type Culture Collection and cultured in DMEM (Invitrogen) supplemented with 10% FBS, 5 units/ml penicillin, 5 µg/ml streptomycin, and 2 mM L-glutamine (all from Invitrogen). Hs578t cells were cultured in the above medium supplemented with 0.01 mg/ml insulin (Sigma). When indicated, MCF-7 cells were cultured in DMEM free of phenol red (Invitrogen) with charcoal-stripped serum (Hyclone, Logan, UT) for 3 days before they were treated with drugs. In experiments requiring serum starvation, MCF-7 cells were washed three times with serum-free medium and incubated in DMEM containing 0.1% FBS for 48 h before they were used in experiments. Rat bone marrow cells were obtained from femurs of rats (Sprague Dawley; Taconic, Albany, NY) and cultured in Iscove’s Modified Eagle’s Medium (Invitrogen) with 10% FBS, as described previously (28) .

Anchorage-independent Growth Assay (Soft Agar Assay).
Soft agar assay was performed as previously described (29) with a few modifications. Ligands were added into the bottom and top agar before plating into 6-well plates. Cells were treated with trypsin (Invitrogen) for 5 min in a 37°C incubator and pipetted several times so that most cells were in single-cell forms. Cells were counted with a hemacytometer (Hausser Scientific/VWR, South Plainfield, NJ), and 10,000 cells were mixed with top agar and plated into each well. After the top agar had solidified, 2 ml of medium containing the same treatment were added on top of the agar. This covering medium was changed every 2 days during culture. After 2 weeks of culture, each well was counted for the number of colonies formed using an Olympus IX70 microscope at x40 magnification. A cell colony was defined as any cluster of cells that contain more than three cells. The average of counts from three random fields for each well was taken as the colony number and analyzed. Each treatment was performed in triplicate.

Anchorage-dependent Growth Assay.
Cells were plated into 6-well plates and grown overnight before treatments. The seeding concentration of MCF-7 cells was 2 x 105/well, which was determined during preliminary experiments as not allowing the cells to reach confluence within 3 days. Cells were treated either with vehicle or ligands as indicated. Cells were detached by incubation with trypsin (Invitrogen), stained with trypan blue dye (Invitrogen), and counted with a hemacytometer before and after treatment. Only cells that exclude the trypan blue dye were counted, unless otherwise stated.

Western Blot Analysis.
Cells were washed three times in cold 1x PBS and collected by scraping on ice. Western blot analysis was performed as previously described, using enhanced chemiluminescence (28) . Antibodies used in this study were: ER{alpha} (NeoMarkers/Lab Vision, Fremont, CA, Ab-15); cyclin A (H-432; Santa Cruz Biotechnology, Santa Cruz, CA); cyclin B1 (H-433; Santa Cruz Biotechnology); cyclin E (HE-12; Upstate Biotechnology, Waltham, MA); ILK (clone 65.1.9; Upstate Biotechnology); Akt (no. 9272; Cell Signaling Technology, Beverly, MA); and phosphorylated Akt (no. 9271, Ser473; Cell Signaling Technology). ER{alpha} antibody was used at 1:100 dilutions. Cyclin A and cyclin B1 antibodies were used at 1:500 dilutions. Cyclin E, ILK, Akt, and phospho-Akt antibodies were used at a dilution of 1:1000. Data were quantitated using Kodak Digital Scientific 1D software (Eastman Kodak, New Haven, CT).

Thymidine Incorporation Assay.
Thymidine incorporation assays were performed as described (30) with modifications. Rat bone marrow cells were cultured in 25-cm2 flasks at a concentration of 20 x 106 cells/2 ml. After drug treatment for 24 h, cells were incubated with [3 H]thymidine at a final concentration of 3 µCi/ml for 8 h. For MCF-7 cells, cells were cultured in 6-well plates and incubated with [3 H]thymidine for 2 h after drug treatment. Cells were divided into two portions, 60% of which were processed as previously described (30) to obtain tritium counts. The rest of the cells were lysed with Western blotting lysis buffer, and protein concentrations were determined by Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA). Tritium counts were normalized with corresponding protein concentrations to account for cell number variations.

Flow Cytometry and Apoptosis Analysis.
Cells were detached from tissue culture plates by trypsin treatment and collected by centrifugation at 1200 x g for 5 min and washed once with PBS. Staining of cells with PI and analyzing them on a flow cytometer (FACScan; Becton Dickinson, Research Triangle Park, NC) were performed as described previously (31) . Data were analyzed with CellQuest software (Becton Dickinson). The percentage of events appearing with a fluorescence level less than those of diploid cells was calculated as an estimate of cells undergoing apoptosis.

Transfections and Reporter Gene Assay.
Transient transfection was performed using FuGene6 (Roche, Indianapolis, IN) transfection reagent according to manufacturer’s protocol. For cells cultured in 75-cm2 flasks, circular reporter plasmid pERE-Tk-Luc at 10 µg and 2 µg of pCMV-ß-gal were transfected with 25 µl FuGene6 reagent/flask. Cells were split into 6-well plates 12 h after transfection and incubated overnight in fresh medium. Cells were treated with vehicle or 100 µM IB-MECA for 12 h before harvesting. Luciferase and ß-gal activities were measured as described previously (32 , 33) . Luciferase readings and ß-gal activities were normalized against protein concentrations of the cell lysates, using Bio-Rad protein assay reagent. In experiments overexpressing ER{alpha}, 2 µg of pcDNA3-ER{alpha} were transfected with 5 µl of FuGene6 into each well of 6-well plates. Cells were treated with vehicle (DMSO) or IB-MECA 1 day after transfection. Transfection efficiency was determined by parallel transfection of pEGFP-C1 and counting fluorescent cells under microscope.

Stable transfection was performed with procedures similar to those of transient transfection, except that the plasmid pRc-A3AR was linearized with PvuI and purified by phenol/chloroform extraction and ethanol precipitation. Transfected MCF-7 cells were selected with 500 µg/ml Geneticin (Invitrogen) until Geneticin-treated control cells all died. This pool of stably transfected cells was either used in experiments or subjected to single-clone selection with limited dilution as described previously (32) . Briefly, cells were diluted to a concentration of 2.5 cells/ml and added into 96-well plates at 200 µl/well. Clones of cells expanded in this manner were analyzed for their A3AR expression using RT-PCR (see below).

Total RNA Preparation and RT-PCR.
Total RNA from MCF-7 cells or rat brain was prepared with Trizol (Invitrogen) as described previously (28) . For reverse transcription, 2 µg of RNA were used in a 30-µl reaction with random primers and Moloney murine leukemia virus reverse transcriptase (Invitrogen), following the manufacturer’s protocol. To control for possible contamination from genomic DNA in subsequent PCR reactions, control reverse transcription reactions were carried out under identical conditions but without reverse transcriptase. After reverse transcription, 1 µl each of the products was used in PCR reactions. In experiments analyzing A3AR expression in the brain and breast cancer cell lines, PCR reactions were performed for 33 cycles. In experiments examining overexpressed A3AR, 27 cycles of PCR were used. Specific primers, exactly matching both human and rat cDNA, were designed for A3AR, which recognize two separate exons, according to genomic sequences (from GenBank). Sequences for the sense and antisense A3AR primers (5'-3') are: tccatcatgtccttgctg and gcacatgacaaccaggg (annealing temperature: 61°C). In the experiments analyzing ER{alpha}, ERß, and pS2 mRNA levels, semiquantitative PCR reactions were carried out. Cycle numbers were predetermined to produce a linear amplification of reverse transcription products and are listed in the parentheses together with corresponding annealing temperatures and expected product sizes. The sense and antisense primer sequences are listed below (5'-3'): for human ER{alpha} (21 cycles, 55°C, 358 bp), gatccaagggaacgagctgg and tgggctcgttctccaggtag; for human pS2 (16 cycles, 57°C, 50 bp), accggacacctcagacacg and ctgtgttgtgagccgaggc; for human ERß (28 cycles, 57°C, 210 bp), aacacctgggcacctttctc and acagcgcagaagtgagcatc; and for GAPDH (16 cycles, 55°C, 570 bp), tcaccatcttccaggag and gcttcaccaccttcttg. PCR products were resolved on 5% polyacrylamide gels run with 0.5x Tris-borate EDTA buffer and stained with GelStar nucleic acid stain (BioWhittaker Molecular Applications, Baltimore, MD). PCR reactions were always performed in duplicates to control for PCR variations. All gels were visualized with a Kodak scientific imaging system and quantified using Kodak Digital Scientific 1D software (Eastman Kodak).

mRNA Half-Life Determination.
MCF-7 cells were pretreated with vehicle (DMSO) or 100 µM IB-MECA for 6 h, followed by addition of 80 µM DRB or 50 µM actinomycin D. Cells were harvested either before addition of transcription inhibitor (0 h) or after different time periods. Total RNA was prepared, and ER{alpha} content was assayed by RT-PCR analyses as described in "Materials and Methods" for RT-PCR. To control for the amount of RNA used in reverse transcription reactions, 2 µg each of total RNA were resolved on a denaturing agarose gel as previously described (28) and stained with ethidium bromide.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Adenosine or IB-MECA Inhibits Anchorage-independent Growth of MCF-7 Cells.
It has been reported that skeletal muscle-conditioned medium, with adenosine as an active component, can inhibit anchorage-dependent growth of MCF-7 breast cancer cells as measured by thymidine incorporation in liquid cultures (15) . We examined whether adenosine could also inhibit anchorage-independent growth of MCF-7 cells, a hallmark of tumorigenesis, and if this effect could be mimicked by adenosine analogues. Adenosine was added into soft agar cultures at different concentrations, and colonies formed were counted after 2 weeks of culture. As shown in Fig. 1ACitation , adenosine displayed a dose-dependent inhibition of colony formation. At 1 mM, adenosine inhibited ~50% of the colony-forming ability of MCF-7 cells. No effect was observed when inosine was used instead of adenosine (data not shown).



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Effects of adenosine and AR agonists on MCF-7 cell colony formation. MCF-7 cells were plated in soft agar and treated with (A) adenosine, (B) CCPA, (C) CGS21680, (D) NECA, or (E) IB-MECA, at indicated concentrations. After 2 weeks of treatment, colony numbers were counted, as detailed in "Materials and Methods," and presented as the percentage of those of vehicle-treated cells (0 µM). Data shown are averages of triplicate experiments, and error bars represent SDs. F, phase contrast microscopy of colonies of cells on soft agar treated for 2 weeks with vehicle (DMSO) or 100 µM IB-MECA, as indicated (x40 magnification).

 
Such a high concentration of adenosine can hardly be achieved in the circulation, although a high local concentration cannot be excluded. Because adenosine exerts many of its effects through activation of ARs and many AR agonists have a higher stability than adenosine, we investigated whether agonists for the four different types of ARs could inhibit anchorage-independent growth of MCF-7 cells. CCPA (A1AR agonist), NECA (A2AR agonist), CGS21680 (A2aAR agonist), and IB-MECA (A3AR agonist) were applied to MCF-7 cells at different dosages. At much higher concentrations than their binding affinities for corresponding ARs, CCPA, NECA, and CGS21680 did not inhibit the anchorage-independent growth of MCF-7 cells (Fig. 1, B–D)Citation . IB-MECA, on the other hand, at concentrations from 10 to 100 µM, showed a dose-dependent inhibition of MCF-7 cell colony formation (Fig. 1E)Citation . We also tested IB-MECA from another commercial source (Tocris, Avonmouth, United Kingdom) to compare two different batches of chemical preparation and obtained similar results (data not shown). This inhibitory effect of IB-MECA was both on colony number as well as on colony size (Fig. 1F)Citation .

Effects of IB-MECA on Anchorage-independent Growth and Apoptosis of Different Breast Cancer Cell Lines.
We tested the effect of IB-MECA on several human breast cancer cell lines, including MCF-7, ZR-75, T47D, and Hs578T, as well as on HeLa cells (human cervix adenocarcinoma cell line). Western blot analyses (Fig. 2A)Citation showed that the MCF-7, ZR-75, and T47D cell lines are ER{alpha} positive. Hs578T cells do not contain a detectable level of ER{alpha}, consistent with previous studies (34 , 35) . All breast cancer cell lines tested showed a dramatic decrease in colony formation, whereas HeLa cells only exhibited a mild response to this agonist (Fig. 2B)Citation , suggesting that inhibition of anchorage-independent growth by IB-MECA is closely related to the origin of cancer.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Effects of IB-MECA on colony formation and apoptosis of different epithelial cell lines. A, ER{alpha} levels in the human cancer cell lines MCF-7, T47D, ZR-75, Hs578T, and HeLa were examined with Western blot analysis. Actin was used as a loading control. B, MCF-7, ZR-75, T47D, Hs578T, and HeLa cells were plated in soft agar and treated with 100 µM IB-MECA. Numbers of colonies formed were determined after 2 weeks in culture and expressed as the percentage of those of vehicle-treated cells (DMSO). C, MCF-7, ZR-75, T47D, Hs578T, and MCF-10A cells were treated with 100 µM IB-MECA for 2 days. Cells were stained with PI and subjected to fluorescence-activated cell sorting analyses. Apoptotic events were determined by the sub-2n populations on fluorescence histograms and were expressed as the percentage of total events. All data shown are averages of triplicate experiments, and error bars represent SDs.

 
Some studies involving examination of mechanisms of IB-MECA effects on growth of a variety of transformed cells concluded that increased apoptosis is involved (13 , 14) . We examined whether the inhibition on anchorage-independent proliferation is attributable to increased apoptosis of the cells. As shown in Fig. 2CCitation , T47D and Hs578T cells treated with IB-MECA underwent substantial apoptosis compared with the vehicle-treated samples, whereas MCF-7 and ZR-75 cells displayed a nonsignificant change in apoptotic events. There was a mild effect of IB-MECA on the apoptosis of a nontransformed mammary epithelial cell line MCF-10A, suggesting that the toxicity of the chemical is not dramatic in normal mammary epithelial cells. The effects on MCF-7, ZR-75, and MCF-10A cells are in accordance with a recent study that Chinese hamster ovary cells did not show substantial apoptosis when treated with micromolar concentrations of IB-MECA (36) .

Our findings suggest that IB-MECA can induce two pathways in breast cancer cells. One involves growth inhibition and another involves apoptosis. Although IB-MECA-induced apoptosis by A3AR-dependent and A3AR-independent mechanisms have been studied in some cancer cells (13 , 14 , 37) , IB-MECA-induced growth arrest in ER{alpha}-positive breast cancer cells, however, has not been previously reported.

IB-MECA Inhibits Anchorage-dependent Proliferation of MCF-7 Cells.
Because IB-MECA inhibited the anchorage-independent proliferation of MCF-7 cells on both colony numbers and sizes (Fig. 1, E and F)Citation , we additionally tested this chemical on the anchorage-dependent proliferation of these cells. The numbers of trypan-blue negative cells were followed after MCF-7 cells were treated with IB-MECA. Although vehicle-treated cells showed an exponential increase in cell count, cells treated with IB-MECA did not show much change in the number of viable cells, even after 3 days of drug treatment (Fig. 3A)Citation . Our data indicated that IB-MECA was able to rapidly inhibit anchorage-dependent proliferation of MCF-7 cells.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. IB-MECA inhibits the proliferation of MCF-7 cells. A, MCF-7 cells were treated with vehicle (DMSO) or 100 µM IB-MECA and were counted after 1, 2, or 3 days. The number of cells was expressed as the percentage of cell count before treatment (day 0). Data shown are averages of triplicate experiments and error bars represent SDs. B and C, [3H]thymidine incorporation assays on MCF-7 cells (B) or primary rat bone marrow cells (C) were performed after cells were treated with vehicle (DMSO), 100 µM IB-MECA, or 100 µM 2CdA for 24 h. Data are averages of triplicate experiments and are expressed as the percentage of thymidine incorporation in vehicle-treated cells. Error bars represent SDs.

 
We further tested this inhibition by analyzing DNA synthesis through thymidine incorporation. Because many chemicals that inhibit cancer cell proliferation have undesirable side effects on bone marrow cells, we also tested the effect of IB-MECA on a primary rat bone marrow culture through thymidine incorporation. Because bone marrow cells have much lower rates of proliferation after long periods in culture (data not shown) and the effect of IB-MECA on MCF-7 cells could be observed after 1 day, we treated the cells for 24 h before incubating them with thymidine. IB-MECA and 2CdA (a drug used in chemotherapy) decreased thymidine incorporation in MCF-7 cells to 28 and 43%, respectively (Fig. 3B)Citation . In contrast, IB-MECA at 100 µM had a milder effect on thymidine incorporation in primary bone marrow cells (reduced to 68%), compared with the effect of 2CdA (reduced to 32%; Fig. 3CCitation ). Interestingly, in vivo application of IB-MECA had no inhibitory effect on blood cell counts, probably because of cytokine influences (38) .

IB-MECA Arrests MCF-7 Cells at G1 or G1-S Phase of the Cell Cycle.
To determine which phase of the cell cycle was affected by IB-MECA, we analyzed the cellular DNA profile through flow cytometry analysis. MCF-7 cells treated with IB-MECA displayed a decreased S-phase population from 25 to 12% (Fig. 4A)Citation , compared with vehicle-treated cells. The peak with diploid DNA content increased from 50 to 64% after IB-MECA treatment. There was no significant change in the percentage of tetraploid cells in treated versus control samples. These results suggested that IB-MECA had a primary effect on cell cycle arrest at G1 phase or G1-S transition.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. IB-MECA arrests MCF-7 cells at G1 or G1-S phase of the cell cycle. A, MCF-7 cells were treated with vehicle (DMSO) or 100 µM IB-MECA for 2 days. Cells were stained with PI and subjected to flow cytometry analyses. The percentages of cells in different phases of the cell cycle were as follows: G1 phase, 50.2% (DMSO) and 64.2% (IB-MECA); S phase, 25.2% (DMSO) and 12.3% (IB-MECA); and G2-M, 24.6% (DMSO) and 23.4% (IB-MECA). These calculations represent averages of three determinations. Representative fluorescence histograms are shown. B, MCF-7 cells were treated with vehicle (DMSO) or indicated concentrations of IB-MECA or NECA for 2 days. Cells were harvested and subjected to Western blot analyses using indicated antibodies. C, MCF-7 cells were treated with 100 µM IB-MECA for the indicated hours. Cells were harvested and subjected to Western blot analyses using indicated antibodies.

 
On the molecular level, cyclins A and B1 decreased in cells treated with IB-MECA (Fig. 4B)Citation , compared with vehicle-treated cells. On the contrary, NECA, which did not inhibit anchorage-independent proliferation of MCF-7 cells (Fig. 1D)Citation , did not significantly affect the levels of cyclins A and B1 (Fig. 4B)Citation . Interestingly, the dosage response of cyclin levels upon IB-MECA treatment was very similar to that of the cell proliferation inhibition (Fig. 1E)Citation . As shown in Fig. 4CCitation , cyclins A, and B1 were down-regulated in MCF-7 cells after IB-MECA treatment while cyclin E levels were augmented (as might be expected from an increased population of cells at late G1 or G1-S transition). As a control, the level of the p59 ILK (39) was monitored; it did not change with IB-MECA treatment, suggesting that IB-MECA had a selective effect on regulatory molecules.

IB-MECA-induced Growth Arrest Is Not Mediated through A3AR.
As an A3AR-selective agonist, IB-MECA-induced inhibition of proliferation of several transformed cell lines had been attributed to A3AR activation (36 , 38 , 40) . The affinity of IB-MECA for A3AR was reported to be in the nanomolar range (41) . However, the cell growth inhibitory effect we report here could only be observed at concentrations > 10 µM, suggesting it is unlikely that the effect is mediated by A3AR signaling. To test this contention, we examined A3AR expression (Fig. 5A)Citation , using RT-PCR, in the breast cancer cell lines MCF-7, ZR-75, T47D (ER{alpha} positive), and Hs578T (ER{alpha} negative). Compared with brain, an A3AR-expressing tissue (42) , all breast cancer cell lines showed no detectable levels of A3AR, even after 33 cycles of PCR amplification. This indicated that A3AR is not the major pathway in the IB-MECA-induced effects on breast cancer cells.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. The effect of IB-MECA is not through activation of A3 AR. A, The expression levels of A3AR in rat brain and breast cancer cell lines were assayed using RT-PCR. PCR products after 33 cycles of amplification were analyzed on a 1.5% agarose gel and visualized by staining with ethidium bromide. GAPDH (24 cycles) was used as a control. B and C, MCF-7 cells were stably transfected with human A3AR cDNA. B, the expression of A3AR in MCF-7 cells or a pool of stably transfected cells (MCF-7+A3) was assayed by RT-PCR. Reverse transcription reactions were performed with (+) or without (-) reverse transcriptase, followed by PCR reactions using primers specific for A3AR or GAPDH. Representative agarose gel pictures are shown. C, MCF-7 cells or pool of MCF-7 cells stably expressing A3AR (MCF-7+A3) were plated into soft agar and treated with different concentrations of IB-MECA. Colony numbers were determined after 2 weeks in culture and expressed as those of vehicle-treated cells. Data shown are averages of triplicate experiments, and error bars represent SDs.

 
To further confirm this conclusion, we examined the effect of IB-MECA on A3AR-overexpressing MCF-7 cells. A3AR-reconstituted cells would show a much lowered responsive dosage of IB-MECA if the proliferation inhibitory effect on MCF-7 cells was mediated by A3AR. MCF-7 cells were stably transfected with human A3AR cDNA. Expression of A3AR in a stable transfection pool could be strongly detected with 27 cycles of RT-PCR reactions (Fig. 5B)Citation and was much stronger than the expression level in the brain (data not shown). The percentage of cells in the transfection pool that contains the transgene was estimated by analyzing single clones selected from the pool of cells. Sixteen of 17 clones showed overexpression of A3AR (data not shown), verifying that the majority of the cells within the transfection pool overexpressed A3AR. The pool of stably transfected cells was compared with normal MCF-7 cells in soft agar assays. Fig. 5CCitation shows that the two types of cells have almost identical dosage response to IB-MECA. Increased expression of A3AR did not lower the concentration of IB-MECA needed to induce proliferation suppression. Because an increase in receptor expression might not be manifested in a parallel augmentation in coupled receptors, we also examined the effect of the selective A3AR antagonist MRS1191. When used at a concentration of up to 10 µM (greater than its Ki), MRS1191 did not abolish IB-MECA inhibitory effect on growth of MCF-7 cells (data not shown). Thus, we concluded that the growth inhibition by IB-MECA is not mediated through A3AR.

IB-MECA Treatment Decreases ER{alpha} in MCF-7 Cells.
In search for means by which IB-MECA might induce rapid changes in cell proliferation, we sought to determine whether ER{alpha} is a target of IB-MECA treatment. ER{alpha} activation is known to promote cell cycle progression, through G1/S and enhance both anchorage-dependent and anchorage-independent growth of breast cancer cells (21 , 22 , 43, 44, 45, 46, 47, 48) . Indeed, Western blot analysis indicated that the ER{alpha} protein level in MCF-7 cells was reduced by IB-MECA treatment although not affected by NECA (Fig. 6A)Citation . The decrease of ER{alpha} protein showed a similar dosage response as those of cell proliferation inhibition and of cyclin decrease (Figs. 1ECitation and 4BCitation ). Down-regulation of ER{alpha} by IB-MECA treatment occurred in a relatively fast manner (Fig. 6B)Citation . Reduction of ER{alpha} protein levels was also observed in ZR-75 and T47D cells (data not shown), suggesting that the impact of IB-MECA on this protein is common to ER{alpha}-positive breast cancer cell lines. These results suggested that ER{alpha} targeting might be a factor responsible for the growth inhibition effect of IB-MECA. The decrease of ER{alpha} could be detected not only under normal culturing conditions but also in phenol red-free cell culture medium supplemented with charcoal-stripped serum (data not shown), indicating that estrogen contained in normal serum did not affect this down-regulation.



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. IB-MECA down-regulates ER{alpha} in MCF-7 cells and inhibits ß-estradiol-induced cell proliferation. A, MCF-7 cells were treated with vehicle (DMSO), different concentrations of IB-MECA, or NECA for 2 days. Cells were harvested and subjected to Western blot analyses with antibodies against ER{alpha} or actin (loading control). B, MCF-7 cells were treated with DMSO (-) or 100 µM IB-MECA (+) for the indicated periods. Cells were harvested and subjected to Western blot analyses using antibodies against ER{alpha} and actin (loading control). C, MCF-7 cells transfected with pERE-Tk-Luc and pCMV-ß-gal plasmids were treated with vehicle (0) or indicated concentrations of IB-MECA for 12 h. Cells were harvested and reporter gene activity was assayed as detailed in "Materials and Methods." Data shown are averages of triplicate experiments, and error bars represent SDs. D, MCF-7 cells were cultured in phenol red-free medium with charcoal-stripped serum. We found these estrogen-depleted conditions to reduce the proliferation of MCF-7 cells, as also reported by others (72 , 79) . Cells were treated with (+) or without (-) 100 µM IB-MECA and indicated concentrations of 17-ß-estradiol (E2) for 24 h. Cell numbers at day 0 (right before treatment) are denoted as 100%. Data shown are averages of triplicate experiments, and error bars represent SDs. (P < 0.005 for samples labeled with * and P < 0.022 for samples labeled with ** under Student’s t test).

 
Because activators of ER{alpha} such as 17-ß-estradiol can reduce ER{alpha} level by regulating ER{alpha} protein stability (49 , 50) , a lowered protein level may not correlate with a reduction of ER{alpha} activity. Hence, we also examined the transcriptional activity of endogenous ER{alpha} after IB-MECA treatment, using a reporter construct containing EREs in the promoter (27) . As shown in Fig. 6CCitation , ERE promoter activity decreased by >5-fold after 12 h of IB-MECA treatment. In contrast, the viral CMV promoter did not show any decrease in activity. These results suggested that IB-MECA down-regulated ER{alpha} and subsequently caused a reduced activity of this transcription factor.

To explore whether the inhibition was primarily on ER{alpha} protein level or on both the level of protein and activation, MCF-7 cells cultured under estrogen-depleted conditions were treated with 2 or 20 nM 17-ß-estradiol. Without IB-MECA, ß-estradiol-treated cells showed an increase in cell number to 160–170% after 1 day of culture (Fig. 6D)Citation . This augmentation is similar to the rate of cell number increase under normal culturing condition (Figs. 3ACitation and 8BCitation ). Cells cultured without additional 17-ß-estradiol displayed a very mild increase in cell number (up to 125%; Fig. 6DCitation ), as would be expected from an estrogen-dependent cell line. With IB-MECA, however, all samples showed cell counts comparable with that of day 0, even when 17-ß-estradiol was present at 2 or 20 nM (Fig. 6D)Citation . This indicated that IB-MECA was able to inhibit ß-estradiol-induced cell proliferation in MCF-7 cells. Thus, we concluded that the primary effect of IB-MECA is on ER{alpha} level rather than on its activation.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Overexpression of ER{alpha} rescues growth inhibition by IB-MECA in MCF-7 cells. MCF-7 cells were transiently transfected with pcDNA3-ER{alpha} (pER{alpha}) or pcDNA3 (vector) with a transfection efficiency of ~40% (see "Materials and Methods"). Cells were treated with vehicle (DMSO) or 100 µM IB-MECA for 1 day. A, expression of ER{alpha} was determined by Western blot analysis. Actin served as a loading control. B, cell numbers were determined after 1-day treatment and expressed as the percentage of cell count before treatment (day 0). Data represent averages of triplicate experiments, and error bars represent SDs. Samples labeled with * showed a P of <0.002 under Student’s t test.

 
IB-MECA-induced Down-Regulation of ER{alpha} Is Likely Attributable to Decreased Transcription from the ER{alpha} Gene.
Studies on ER{alpha} regulation have revealed that this gene is regulated at the levels of transcription (51) , mRNA stability (52, 53, 54) , and protein degradation (49 , 50) . We investigated the down-regulation induced by IB-MECA by first examining the abundance of ER{alpha} mRNA. For comparison between protein levels and mRNA levels, materials from the same samples as in Fig. 6BCitation were used for total RNA preparation. As shown in Fig. 7ACitation , IB-MECA strongly down-regulated ER{alpha} mRNA in a fast and time-dependent manner, with the first sign of decrease after 4 h of IB-MECA treatment. After ER{alpha} down-regulation, the mRNA level of pS2, an endogenous estrogen-responsive gene (55) , was also reduced by IB-MECA. The down-regulation of pS2 could be observed after 8–12 h (Fig. 7A)Citation and to a stronger degree after 24 h (data not shown). In contrast, the message level of another estrogen binding protein, ERß (56) , was not significantly reduced (Fig. 7A)Citation . This cDNA was amplified with primers corresponding to the first two exons of the ERß gene. ER{alpha} mRNA down-regulation precedes that of ER{alpha} protein (Figs. 6BCitation and 7ACitation ), suggesting that the primary effect of IB-MECA is on ER{alpha} mRNA. Indeed, we did not notice any significant change in ER{alpha} protein degradation upon IB-MECA treatment when protein synthesis was inhibited by cycloheximide (Fig. 7B)Citation .



View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Effects of IB-MECA on mRNA level and mRNA half-life of ER{alpha} in MCF-7 cells. A, the mRNA levels of ER{alpha}, pS2, and ERß in IB-MECA-treated cells. MCF-7 cells were treated with vehicle (-) or 100 µM IB-MECA (+) for the indicated periods. Reverse transcription reactions were carried out on total RNA isolated from the samples (same samples as in Fig. 6Citation B). Primers specific for ER{alpha}, pS2, ERß, and GAPDH were used in semiquantitative PCR reactions. Representative pictures of RT-PCR products analyzed on polyacrylamide gels are shown. B, after 30-min of preincubation with 50 µg/ml of the protein synthesis inhibitor cycloheximide, MCF-7 cells were treated with vehicle (DMSO) or 100 µM IB-MECA for the indicated hours. Cells were harvested and assayed for ER{alpha} or actin contents with Western blot analyses. C, ER{alpha} mRNA half-life in IB-MECA-treated cells. MCF-7 cells were pretreated with vehicle (DMSO, -) or 100 µM IB-MECA (+) for 6 h before adding the transcription inhibitor DRB (80 µM). Cells were harvested after indicated periods and were subjected to RT-PCR analyses using specific primers for ER{alpha}. Total RNA samples of 2 µg each were resolved on a denaturing agarose gel, and the 18S rRNA bands were used as loading controls. D, a representative experiment is shown to illustrate the linear range of PCR reactions. Indicated template amounts of the 0 h DMSO-treated sample in C were amplified. A representative picture of PCR products analyzed on an acrylamide gel is shown. Intensities of the bands were quantitated using Kodak Digital Scientific 1D software and presented in arbitrary units (AU). Data shown are averages of two PCR reactions, and error bars represent variations. A linear regression fitting curve was plotted with R2 value of 1. E, mRNA half-lives were quantitated for samples in C. Average intensities of duplicate PCR reaction products (for ER{alpha}) were normalized with corresponding intensities of 18S rRNA. Normalized ER{alpha} data were presented as the percentage of the level at 0 h time point and plotted on a logarithmic scale. Data shown are averages of three independent experiments, and error bars represent SDs.

 
To differentiate whether the effect was on ER{alpha} gene transcription or mRNA stability, we examined the half-life of ER{alpha} message in vehicle- or IB-MECA-treated cells. MCF-7 cells were pretreated with vehicle or IB-MECA for 6 h before adding the transcription inhibitor DRB, which causes premature transcription termination. Consistent with Fig. 7ACitation , ER{alpha} mRNA was decreased after 6 h of IB-MECA pretreatment, as revealed by semiquantitative RT-PCR (the 0 h time point; Fig. 7CCitation ). The PCR reactions were carried out under conditions that allow linear amplification and quantitation (Fig. 7D)Citation . The half-life of ER{alpha} measured under the experimental conditions may be longer than the real half-life in the cells because the used transcription inhibitor may not shut down transcription immediately. Nevertheless, comparing vehicle- and IB-MECA-treated cells would indicate whether there is an impressive difference in ER{alpha} half-lives. The mRNA half-life in IB-MECA-treated cells was similar to that in vehicle-treated cells (Fig. 7, C and E)Citation , and the difference could not account for the observed reduction in mRNA level. Inhibiting transcription with another transcription inhibitor, actinomycin D, showed similar results (data not shown). Thus, we concluded that the effect of IB-MECA on ER{alpha} was most likely on the transcription of the gene. It should be pointed out that nuclear run-on assays were attempted, as we described previously (32) , but ER{alpha} de novo transcription in control cells was below our detection limit.

Overexpression of ER{alpha} Can Reverse the Growth Inhibition Induced by IB-MECA.
Results from the above experiments strongly suggest that the decrease of ER{alpha} is a pathway that leads to IB-MECA-induced cell cycle inhibition. In fact, ER{alpha} activation has been well documented to promote cell cycle progression in MCF-7 cells (21 , 22 , 43 , 44 , 46) . To further verify this, we took advantage of the fact that the CMV promoter was not significantly affected by IB-MECA treatment and, hence, we transfected cells with ER{alpha} cDNA under the control of the CMV promoter. This would provide the cells with sufficient amount of ER{alpha} to counter the decrease induced by IB-MECA. Indeed, ER{alpha} levels were high in the transfected cells, both before and after IB-MECA treatment (Fig. 8A)Citation .

If the inhibition of IB-MECA was mediated through a decrease in ER{alpha}, we would expect to see a moderate or no effect of IB-MECA on growth of ER{alpha}-overexpressing cells. Because only cells transfected with ER{alpha} may exhibit any resistance, transfection efficiency will be key in determining the potential increase in cell counts as compared with cells transfected with control plasmid. Stable transfection of ER{alpha} was attempted twice without success, which might be attributable to any potential long-term harmful effect of high levels of ER{alpha} in MCF-7 cells. Instead, we overexpressed ER{alpha} by transient transfection, and a transfection efficiency of ~40% was determined by counting green cells from a parallel transfection with a CMV-driven green fluorescence protein construct (pEGFP-C1). It should be pointed out that the percentage of green fluorescence protein-transfected cells within the total population decreased with longer period of culturing when the plasmid was transiently transfected (data not shown). We performed the ER{alpha} transfection experiment with 1 day of IB-MECA treatment to obtain a relatively high percentage of transfected cells.

When ER{alpha} was overexpressed in MCF-7 cells, IB-MECA treatment resulted in a moderate effect on growth, as compared with a larger effect in control cells (Fig. 8B)Citation . It is reasonable to assume that IB-MECA effect on growth of the transfected pool of cells was not eliminated because only ~40% of the cells overexpressed the transgene. All these data are consistent with the numerous reports linking inhibition of ER{alpha} with suppression of breast cancer cell growth, as reviewed above.

Effects of Adenosine and Several Adenosine Analogues on ER{alpha} Level and Proliferation of MCF-7 Cells.
We extended the assays performed on cells with IB-MECA treatment and sought to examine a variety of adenosine analogues for their abilities to suppress ER{alpha} and MCF-7 cell growth (summarized in Table 1Citation ).


View this table:
[in this window]
[in a new window]

 
Table 1 Effects of adenosine, inosine, and different adenosine analogues on ER level and proliferation of MCF-7 cells

 
Adenosine mildly inhibited growth but did not affect ER{alpha} level. Inosine did not inhibit the proliferation of MCF-7 cells. The A1AR selective analogue, CCPA, or the A2-type selective analogue, NECA, had no significant effect on cell proliferation and did not affect ER{alpha} protein level. We also tested another A3AR-selective agonist, chloro-IB-MECA (results not shown). At 10 µM, it had no effect on anchorage-independent growth of MCF-7 cells, whereas at 100 µM, it rendered almost all of the cells as trypan blue-positive within 6 h of treatment. Such a toxic effect prevented us from obtaining enough protein for additional analyses on ER{alpha} protein.

We also examined adenosine analogues, which are not selective for ARs and have been described as inhibitors of cancer cells. For example, 2CdA was used clinically for treating chronic lymphocytic leukemia (57) or infantile myofibromatosis (58) . 3'-dA was shown to inhibit leukemia cells (59) . In our studies, 2CdA significantly inhibited the growth of MCF-7 human breast cancer cells. In contrast to IB-MECA, however, it was as effective at 1 µM (data not shown) as at 100 µM, and it did not have a prominent effect on ER{alpha} levels. CADO >3'-dA significantly inhibited cell growth and ER{alpha} levels, without inducing apoptosis. These compounds, as IB-MECA, were only effective when used at a 10–100-µM range. Although these analogues affect ER{alpha} in a similar trend as IB-MECA, they likely also influence mechanisms not affected by IB-MECA because they arrest the cells cycle in a different phase. Serum starvation, which arrested the cell cycle at diploid phase (similarly to IB-MECA), did not reduce ER{alpha} level.

A variety of other adenosine analogues might be screened for inhibition of growth of breast cancer cells in vitro, using the tools we used here. Our current data should also motivate future examination of IB-MECA, CADO, as well as 3'-dA for inhibition of breast cancer in animal models.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Adenosine and chemically synthesized AR agonists have been reported to inhibit cancer cell proliferation. These inhibitory effects are through various mechanisms and mainly via the activation of different ARs. We found that high concentrations of adenosine inhibited growth of MCF-7 breast cancer cells. Among the agonists examined in our study, IB-MECA was shown to be a potent growth inhibitor of breast cancer cell lines, whereas the A1AR agonist, CCPA, and the A2AR agonists, CGS21680 and NECA, did not have a significant effect on MCF-7 cell proliferation. The breast cancer cells examined showed no detectible levels of A3AR, and A3AR overexpression in MCF-7 cells did not result in increased sensitivity upon IB-MECA treatment. In addition, an A3AR antagonist did not abolish the effect of IB-MECA. This suggested that A3AR is not a primary pathway through which the growth inhibition is mediated. Such a result is not surprising because another A3AR agonist, chloro-IB-MECA, was shown to induce apoptosis in two leukemia cell lines through mechanisms not related to A3AR signaling (37) .

How IB-MECA triggers the effect on proliferation in the treated breast cancer cells is not clear. It is possible that IB-MECA at high concentrations binds other unidentified membrane receptors and triggers downstream signaling. Another possibility could be that the compound signals through direct interaction with intracellular targets, after being transported into the cell. Such intracellular mechanisms have been noticed for adenosine (60) and an adenosine analogue, 2-chloroadenosine (61) , using the nucleoside transporter inhibitor dipyridamole. In our system, 10 µM dipyridamole did not prevent the growth inhibitory effect of IB-MECA, whereas at higher concentrations, dipyridamole had by itself an inhibitory effect on cell growth. It is possible, however, that the nucleoside uptake inhibitor cannot fully block the transport of IB-MECA because IB-MECA at higher concentrations might compete for the transporters or enter the cell by a nucleoside transporter-independent mechanism. In lack of radiolabeled IB-MECA, we were not able to determine the intracellular concentration of this ligand. The details of the mechanisms by which IB-MECA targets its effector molecules are intriguing and await additional exploration.

In search for mechanisms of action of IB-MECA on breast cancer cell growth, we focused on a known regulator of these cells, the ER{alpha}. We showed that in ER{alpha}-positive breast cancer cell lines MCF-7, ZR-75, and T47, IB-MECA down-regulated ER{alpha}, suggesting that this effect is general in ER{alpha}-positive breast cancer cells. We also showed that reversing the down-regulation of ER{alpha} significantly attenuated the growth inhibition induced by IB-MECA, indicating that ER{alpha} down-regulation is one pathway responsible for the growth inhibition in ER-positive breast cancer cells. This, however, does not exclude the possibility that other pathways are also involved in IB-MECA-induced proliferation inhibition in these cells. We found that IB-MECA regulated ER{alpha} through a down-regulation of mRNA and protein and consequently ER{alpha} transcriptional activity. The half-life of ER{alpha} message was not significantly altered when IB-MECA was present. This eliminates the possibility of regulation on message stability and points to a high likelihood of regulation through gene transcription. The ER{alpha} gene contains multiple promoters, some of which are as far as 150 kb upstream of the primary transcriptional start site (62 , 63) . Only a few transcription factors are known to regulate ER{alpha} gene expression (51 , 64) , including AP2{gamma}. Additional experiments are needed to elucidate the detailed mechanism of ER{alpha} gene down-regulation by IB-MECA. The mechanism by which IB-MECA down-regulates ER{alpha} is different from the one found for selective ER down-regulators such as ICI 182,780 (also known as fulvestrant and Faslodex). ICI 182,780 reduces ER{alpha} level through increased ER{alpha} protein turnover (65, 66, 67) , whereas IB-MECA down-regulates ER{alpha} through an effect on gene expression. In this view, IB-MECA and similar compounds may be efficacious in the treatment of breast cancers that are resistant to or have acquired resistance (68) to the pure antiestrogen ICI 182,780 and thus might be important additions to the arsenal of endocrine therapies for human breast cancer.

We examined the effect of IB-MECA on several different breast cancer cell lines. IB-MECA inhibited the growth of MCF-7 and ZR-75 cells and induced apoptosis in T47D and Hs578T cells. In T47D cells, IB-MECA treatment down-regulated ER{alpha} in a similar manner as in MCF-7 cells. It is known that T47D cells are estrogen-signaling-dependent; estrogen stimulates the proliferation of T47D cells and inhibiting estrogen signaling results in an inhibition of proliferation (69, 70, 71, 72) . Thus, it is possible that in T47D cells, two different pathways were induced by IB-MECA. One pathway involves ER{alpha}, which is common in all ER{alpha}-positive cells and which would lead to proliferation inhibition. Another pathway, which is not activated in MCF-7 cells and ZR-75 cells, initiates apoptosis in T47D cells. In MCF-7 cells, IB-MECA does not induce or inhibit apoptosis. Apoptotic events can be initiated via a variety of signaling pathways and by activation of one or more related regulators (reviewed in Refs. 73, 74, 75 ). We speculate that IB-MECA does not initiate apoptosis in MCF-7 cells because of its ability to activate certain antiapoptotic molecules such as Akt (reviewed in Refs. 76 , 77 ) so that the balance between its apoptotic and antiapoptotic signals are maintained. Hence, the dominant effect of IB-MECA in MCF-7 cells is inhibition of ER{alpha} expression and proliferation. We found that IB-MECA induced Akt phosphorylation (at Ser473) in MCF-7 cells (data not shown), as also reported in rat basophilic leukemia 2H3 cells (78) . This does not imply, however, that Akt is the only pathway by which IB-MECA might affect apoptosis in these cells. Additional exploration is needed to reveal the detailed mechanisms by which apoptosis is induced by IB-MECA in some cell lines but not in others.

In summary, we found that IB-MECA potently inhibits the proliferation of ER-positive breast cancer cells. ER{alpha} was identified as one pathway that is rapidly affected by IB-MECA in its inhibitory effect on proliferation. Interestingly, CADO as well as 3'-dA mimicked the effect of IB-MECA in this regard, except that the influence on ER{alpha} was milder and the cell cycle phase affected was different, suggesting that they act via an alternative mechanism. Our work highlights the possibility of using IB-MECA and some other adenosine analogues as drugs to treat breast cancers. IB-MECA may also be used in therapies that are aimed at regulating ER{alpha} levels. We propose that IB-MECA can serve as a backbone for chemical engineering that may yield a line of related compounds that are potent and specific.


    ACKNOWLEDGMENTS
 
We thank Dr. Edward Lamperti for critically reading this article.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by an NCI core grant to Boston University School of Medicine Cancer Center. Back

2 To whom requests for reprints should be addressed, at Biochemistry, K225, Boston University School of Medicine, 715 Albany Street, Boston, MA 02118. Phone: (617) 638-5053; Fax: (617) 638-5054; E-mail: ravid{at}biochem.bumc.bu.edu Back

3 The abbreviations used are: AR, adenosine receptor; CCPA, 2-chloro-N6-cyclopentyladenosine; NECA, 5'-(N-ethylcarboxamido)adenosine; IB-MECA, N6-(3-iodobenzyl)adenosine-5'-N-methyluronamide; CGS21680, 2-p-(2-carboxyethyl)phenethylamino-5'-N-ethylcarboxamidoadenosine; ER, estrogen receptor; 2CdA, 2-chloro-2'-deoxyadenosine; CADO, 2-chloro-adenosine; 3'dA, 3'-deoxyadenosine; PI, propidium iodide; CMV, cytomegalovirus; ß-gal, ß-galactosidase; ILK, integrin-linked kinase; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DRB, 5,6-dichlorobenzimidazole riboside; ERE, estrogen response element. Back

Received 2/26/03. Revised 6/25/03. Accepted 7/ 3/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Linden J. Molecular approach to adenosine receptors: receptor-mediated mechanisms of tissue protection. Annu. Rev. Pharmacol. Toxicol., 41: 775-787, 2001.[Medline]
  2. Gordon J. L. Extracellular, A. T. P. effects, sources and fate. Biochem. J., 233: 309-319, 1986.[Medline]
  3. Ralevic V., Milner P., Kirkpatrick K. A., Burnstock G. Flow-induced release of adenosine 5'-triphosphate from endothelial cells of the rat mesenteric arterial bed. Experientia, 48: 31-34, 1992.[Medline]
  4. Grierson J. P., Meldolesi J. Shear stress-induced [Ca2+]i transients and oscillations in mouse fibroblasts are mediated by endogenously released ATP. J. Biol. Chem., 270: 4451-4456, 1995.[Abstract/Free Full Text]
  5. Ferguson D. R., Kennedy I., Burton T. J. ATP is released from rabbit urinary bladder epithelial cells by hydrostatic pressure changes: a possible sensory mechanism?. J. Physiol., 505(Pt. 2): 503-511, 1997.[Abstract/Free Full Text]
  6. Vizi E., Huszar E., Csoma Z., Boszormenyi-Nagy G., Barat E., Horvath I., Herjavecz I., Kollai M. Plasma adenosine concentration increases during exercise: a possible contributing factor in exercise-induced bronchoconstriction in asthma. J. Allergy Clin. Immunol., 109: 446-448, 2002.[Medline]
  7. Decking U. K., Schlieper G., Kroll K., Schrader J. Hypoxia-induced inhibition of adenosine kinase potentiates cardiac adenosine release. Circ. Res., 81: 154-164, 1997.[Abstract/Free Full Text]
  8. Olah M. E., Stiles G. L. Adenosine receptor subtypes: characterization and therapeutic regulation. Annu. Rev. Pharmacol. Toxicol., 35: 581-606, 1995.[Medline]
  9. Klinger M., Freissmuth M., Nanoff C. Adenosine receptors: G protein-mediated signalling and the role of accessory proteins. Cell Signalling, 14: 99-108, 2002.[Medline]
  10. Tey H. B., Tan C. H., Khoo H. E. Modulation of DNA synthesis via adenosine receptors in human epidermoid carcinoma (A431) cells. Biofactors, 4: 161-165, 1994.[Medline]
  11. Tey H. B., Khoo H. E., Tan C. H. Adenosine modulates cell growth in human epidermoid carcinoma (A431) cells. Biochem. Biophys. Res. Commun., 187: 1486-1492, 1992.[Medline]
  12. Colquhoun A., Newsholme E. A. Inhibition of human tumour cell proliferation by analogues of adenosine. Cell Biochem. Funct., 15: 135-139, 1997.[Medline]
  13. Yao Y., Sei Y., Abbracchio M. P., Jiang J. L., Kim Y. C., Jacobson K. A. Adenosine A3 receptor agonists protect HL-60 and U-937 cells from apoptosis induced by A3 antagonists. Biochem. Biophys. Res. Commun., 232: 317-322, 1997.[Medline]
  14. Kohno Y., Sei Y., Koshiba M., Kim H. O., Jacobson K. A. Induction of apoptosis in HL-60 human promyelocytic leukemia cells by adenosine A(3) receptor agonists. Biochem. Biophys. Res. Commun., 219: 904-910, 1996.[Medline]
  15. Fishman P., Bar-Yehuda S., Vagman L. Adenosine and other low molecular weight factors released by muscle cells inhibit tumor cell growth. Cancer Res., 58: 3181-3187, 1998.[Abstract/Free Full Text]
  16. Bast R. E. A. Section 31 Ed. 5 . Cancer Medicine, Vol. 5: BC Decker, Inc. Hamilton, Ontario, Canada 2000.
  17. Park W. C., Jordan V. C. Selective estrogen receptor modulators (SERMS) and their roles in breast cancer prevention. Trends Mol. Med., 8: 82-88, 2002.[Medline]
  18. Group E. B. C. T. C. Tamoxifen for early breast cancer: an overview of the randomised trials. Lancet, 351: 1451-1467, 1998.[Medline]
  19. Couse J. F., Korach K. S. Estrogen receptor null mice: what have we learned and where will they lead us?. Endocr. Rev., 20: 358-417, 1999.[Abstract/Free Full Text]
  20. Hall J. M., Couse J. F., Korach K. S. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J. Biol. Chem., 276: 36869-36872, 2001.[Free Full Text]
  21. Foster J. S., Wimalasena J. Estrogen regulates activity of cyclin-dependent kinases and retinoblastoma protein phosphorylation in breast cancer cells. Mol. Endocrinol., 10: 488-498, 1996.[Abstract/Free Full Text]
  22. Altucci L., Addeo R., Cicatiello L., Dauvois S., Parker M. G., Truss M., Beato M., Sica V., Bresciani F., Weisz A. 17ß-Estradiol induces cyclin D1 gene transcription, p36D1-p34cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G1-arrested human breast cancer cells. Oncogene, 12: 2315-2324, 1996.[Medline]
  23. Cariou S., Donovan J. C., Flanagan W. M., Milic A., Bhattacharya N., Slingerland J. M. Down-regulation of p21WAF1/CIP1 or p27Kip1 abrogates antiestrogen-mediated cell cycle arrest in human breast cancer cells. Proc. Natl. Acad. Sci. USA, 97: 9042-9046, 2000.[Abstract/Free Full Text]
  24. Podhajcer O. L., Resnicoff M., Bover L., Medrano E. E., Slavutsky I., Larripa I., Mordoh J. Effect of estradiol and tamoxifen on the anchorage-independent growth of the subpopulations derived from MCF-7 breast carcinoma cells: cytogenetic analysis of the stem cell subpopulation. Exp. Cell Res., 179: 58-64, 1988.[Medline]
  25. Horwitz K. B., Koseki Y., McGuire W. L. Estrogen control of progesterone receptor in human breast cancer: role of estradiol and antiestrogen. Endocrinology, 103: 1742-1751, 1978.[Abstract/Free Full Text]
  26. Manni A., Wright C., Buck H. Growth factor involvement in the multihormonal regulation of MCF-7 breast cancer cell growth in soft agar. Breast Cancer Res. Treat., 20: 43-52, 1991.[Medline]
  27. Neuman E., Ladha M. H., Lin N., Upton T. M., Miller S. J., DiRenzo J., Pestell R. G., Hinds P. W., Dowdy S. F., Brown M., Ewen M. E. Cyclin D1 stimulation of estrogen receptor transcriptional activity independent of cdk4. Mol. Cell. Biol., 17: 5338-5347, 1997.[Abstract]
  28. Cataldo L. M., Zhang Y., Lu J., Ravid K. Rat NAP1: cDNA cloning and up-regulation by Mpl ligand. Gene (Amst.), 226: 355-364, 1999.[Medline]
  29. Romieu-Mourez R., Landesman-Bollag E., Seldin D. C., Traish A. M., Mercurio F., Sonenshein G. E. Roles of IKK kinases and protein kinase CK2 in activation of nuclear factor-{kappa}B in breast cancer. Cancer Res., 61: 3810-3818, 2001.[Abstract/Free Full Text]
  30. Zhang Y., Wang Z., Ravid K. The cell cycle in polyploid megakaryocytes is associated with reduced activity of cyclin B1-dependent cdc2 kinase. J. Biol. Chem., 271: 4266-4272, 1996.[Abstract/Free Full Text]
  31. Sun S., Ravid K. Role of a serine/threonine kinase, Mst1, in megakaryocyte differentiation. J. Cell Biochem., 76: 44-60, 1999.[Medline]
  32. Wang Z., Zhang Y., Lu J., Sun S., Ravid K. Mpl ligand enhances the transcription of the cyclin D3 gene: a potential role for Sp1 transcription factor. Blood, 93: 4208-4221, 1999.[Abstract/Free Full Text]
  33. Pianetti S., Guo S., Kavanagh K. T., Sonenshein G. E. Green tea polyphenol epigallocatechin-3 gallate inhibits Her-2/neu signaling, proliferation, and transformed phenotype of breast cancer cells. Cancer Res., 62: 652-655, 2002.[Abstract/Free Full Text]
  34. Hackett A. J., Smith H. S., Springer E. L., Owens R. B., Nelson-Rees W. A., Riggs J. L., Gardner M. B. Two syngeneic cell lines from human breast tissue: the aneuploid mammary epithelial (Hs578T) and the diploid myoepithelial (Hs578Bst) cell lines. J. Natl. Cancer Inst. (Bethesda), 58: 1795-1806, 1977.
  35. DeFriend D. J., Anderson E., Bell J., Wilks D. P., West C. M., Mansel R. E., Howell A. Effects of 4-hydroxytamoxifen and a novel pure antioestrogen (ICI 182780) on the clonogenic growth of human breast cancer cells in vitro. Br. J. Cancer, 70: 204-211, 1994.[Medline]
  36. Brambilla R., Cattabeni F., Ceruti S., Barbieri D., Franceschi C., Kim Y. C., Jacobson K. A., Klotz K. N., Lohse M. J., Abbracchio M. P. Activation of the A3 adenosine receptor affects cell cycle progression and cell growth. Naunyn Schmiedebergs Arch. Pharmacol., 361: 225-234, 2000.[Medline]
  37. Kim S. G., Ravi G., Hoffmann C., Jung Y. J., Kim M., Chen A., Jacobson K. A. p53-Independent induction of Fas and apoptosis in leukemic cells by an adenosine derivative, Cl-IB-MECA. Biochem. Pharmacol., 63: 871-880, 2002.[Medline]
  38. Fishman P., Bar-Yehuda S., Madi L., Cohn I. A3 adenosine receptor as a target for cancer therapy. Anticancer Drugs, 13: 437-443, 2002.[Medline]
  39. Hannigan G. E., Leung-Hagesteijn C., Fitz-Gibbon L., Coppolino M. G., Radeva G., Filmus J., Bell J. C., Dedhar S. Regulation of cell adhesion and anchorage-dependent growth by a new ß1-integrin-linked protein kinase. Nature (Lond.), 379: 91-96, 1996.[Medline]
  40. Fishman P., Bar-Yehuda S., Ohana G., Pathak S., Wasserman L., Barer F., Multani A. S. Adenosine acts as an inhibitor of lymphoma cell growth: a major role for the A3 adenosine receptor. Eur. J. Cancer, 36: 1452-1458, 2000.
  41. Fredholm B. B., IJzerman A. P., Jacobson K. A., Klotz K. N., Linden J. International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol. Rev., 53: 527-552, 2001.
  42. von Lubitz D. K. Adenosine A3 receptor and brain. A culprit, a hero, or merely yet another receptor?. Ann. N. Y. Acad. Sci., 825: 49-67, 1997.[Medline]
  43. Aitken S. C., Lippman M. E. Hormonal regulation of net DNA synthesis in MCF-7 human breast cancer cells in tissue culture. Cancer Res., 42: 1727-1735, 1982.[Abstract/Free Full Text]
  44. Sutherland R. L., Green M. D., Hall R. E., Reddel R. R., Taylor I. W. Tamoxifen induces accumulation of MCF 7 human mammary carcinoma cells in the G0-G1 phase of the cell cycle. Eur. J. Cancer Clin. Oncol., 19: 615-621, 1983.[Medline]
  45. Lippman M., Bolan G., Huff K. The effects of estrogens and antiestrogens on hormone-responsive human breast cancer in long-term tissue culture. Cancer Res., 36: 4595-4601, 1976.[Abstract/Free Full Text]
  46. Osborne C. K., Boldt D. H., Clark G. M., Trent J. M. Effects of tamoxifen on human breast cancer cell cycle kinetics: accumulation of cells in early G1 phase. Cancer Res., 43: 3583-3585, 1983.[Abstract/Free Full Text]
  47. Kodama F., Greene G. L., Salmon S. E. Relation of estrogen receptor expression to clonal growth and antiestrogen effects on human breast cancer cells. Cancer Res., 45: 2720-2724, 1985.[Abstract/Free Full Text]
  48. Goldenberg G. J., Froese E. K. Drug and hormone sensitivity of estrogen receptor-positive and -negative human breast cancer cells in vitro. Cancer Res., 42: 5147-5151, 1982.[Abstract/Free Full Text]
  49. Wijayaratne A. L., McDonnell D. P. The human estrogen receptor-alpha is a ubiquitinated protein whose stability is affected differentially by agonists, antagonists, and selective estrogen receptor modulators. J. Biol. Chem., 276: 35684-35692, 2001.[Abstract/Free Full Text]
  50. Borras M., Laios I., el Khissiin A., Seo H. S., Lempereur F., Legros N., Leclercq G. Estrogenic and antiestrogenic regulation of the half-life of covalently labeled estrogen receptor in MCF-7 breast cancer cells. J. Steroid Biochem. Mol. Biol., 57: 203-213, 1996.[Medline]
  51. McPherson L. A., Baichwal V. R., Weigel R. J. Identification of ERF-1 as a member of the AP2 transcription factor family. Proc. Natl. Acad. Sci. USA, 94: 4342-4347, 1997.[Abstract/Free Full Text]
  52. Saceda M., Lindsey R. K., Solomon H., Angeloni S. V., Martin M. B. Estradiol regulates estrogen receptor mRNA stability. J. Steroid Biochem. Mol. Biol., 66: 113-120, 1998.[Medline]
  53. Ing N. H., Ott T. L. Estradiol up-regulates estrogen receptor {alpha} messenger ribonucleic acid in sheep endometrium by increasing its stability. Biol. Reprod., 60: 134-139, 1999.[Abstract/Free Full Text]
  54. Kenealy M. R., Flouriot G., Sonntag-Buck V., Dandekar T., Brand H., Gannon F. The 3'-untranslated region of the human estrogen receptor {alpha} gene mediates rapid messenger ribonucleic acid turnover. Endocrinology, 141: 2805-2813, 2000.[Abstract/Free Full Text]
  55. Brown A. M., Jeltsch J. M., Roberts M., Chambon P. Activation of pS2 gene transcription is a primary response to estrogen in the human breast cancer cell line MCF-7. Proc. Natl. Acad. Sci. USA, 81: 6344-6348, 1984.[Abstract/Free Full Text]
  56. Mosselman S., Polman J., Dijkema R. ER ß: identification and characterization of a novel human estrogen receptor. FEBS Lett., 392: 49-53, 1996.[Medline]
  57. Robak T. The role of nucleoside analogues in the treatment of chronic lymphocytic leukemia-lessons learned from prospective randomized trials. Leuk. Lymphoma, 43: 537-548, 2002.[Medline]
  58. Williams W., Craver R. D., Correa H., Velez M., Gardner R. V. Use of 2-chlorodeoxyadenosine to treat infantile myofibromatosis. J. Pediatr. Hematol. Oncol., 24: 59-63, 2002.[Medline]
  59. Koc Y., Urbano A. G., Sweeney E. B., McCaffrey R. Induction of apoptosis by cordycepin in ADA-inhibited TdT-positive leukemia cells. Leukemia (Baltimore), 10: 1019-1024, 1996.
  60. Schrier S. M., van Tilburg E. W., van der Meulen H., Ijzerman A. P., Mulder G. J., Nagelkerke J. F. Extracellular adenosine-induced apoptosis in mouse neuroblastoma cells: studies on involvement of adenosine receptors and adenosine uptake. Biochem. Pharmacol., 61: 417-425, 2001.[Medline]
  61. Barbieri D., Abbracchio M. P., Salvioli S., Monti D., Cossarizza A., Ceruti S., Brambilla R., Cattabeni F., Jacobson K. A., Franceschi C. Apoptosis by 2-chloro-2'-deoxy-adenosine and 2-chloro-adenosine in human peripheral blood mononuclear cells. Neurochem. Int., 32: 493-504, 1998.[Medline]
  62. Kos M., Reid G., Denger S., Gannon F. Minireview: genomic organization of the human ER{alpha} gene promoter region. Mol. Endocrinol., 15: 2057-2063, 2001.[Abstract/Free Full Text]
  63. Reid G., Denger S., Kos M., Gannon F. Human estrogen receptor-alpha: regulation by synthesis, modification and degradation. Cell Mol. Life Sci., 59: 821-831, 2002.[Medline]
  64. Cohn C. S., Sullivan J. A., Kiefer T., Hill S. M. Identification of an enhancer element in the estrogen receptor upstream region: implications for regulation of ER transcription in breast cancer. Mol. Cell Endocrinol., 158: 25-36, 1999.[Medline]
  65. Wakeling A. E., Dukes M., Bowler J. A potent specific pure antiestrogen with clinical potential. Cancer Res., 51: 3867-3873, 1991.[Abstract/Free Full Text]
  66. Pink J. J., Jordan V. C. Models of estrogen receptor regulation by estrogens and antiestrogens in breast cancer cell lines. Cancer Res., 56: 2321-2330, 1996.[Abstract/Free Full Text]
  67. Fan M., Bigsby R. M., Nephew K. P. The NEDD8 pathway is required for proteasome-mediated degradation of human estrogen receptor (ER)-{alpha} and essential for the antiproliferative activity of ICI 182,780 in ER{alpha}-positive breast cancer cells. Mol. Endocrinol., 17: 356-365, 2003.[Abstract/Free Full Text]
  68. Lykkesfeldt A. E., Larsen S. S., Briand P. Human breast cancer cell lines resistant to pure anti-estrogens are sensitive to tamoxifen treatment. Int. J. Cancer, 61: 529-534, 1995.[Medline]
  69. Jones J. L., Daley B. J., Enderson B. L., Zhou J. R., Karlstad M. D. Genistein inhibits tamoxifen effects on cell proliferation and cell cycle arrest in T47D breast cancer cells. Am. Surg., 68: 575-577; discussion 577578, 2002.[Medline]
  70. Fontana J. A. Interaction of retinoids and tamoxifen on the inhibition of human mammary carcinoma cell proliferation. Exp. Cell Biol., 55: 136-144, 1987.[Medline]
  71. Dardes R. C., O’Regan R. M., Gajdos C., Robinson S. P., Bentrem D., De Los Reyes A., Jordan V. C. Effects of a new clinically relevant antiestrogen (GW5638) related to tamoxifen on breast and endometrial cancer growth in vivo. Clin. Cancer Res., 8: 1995-2001, 2002.[Abstract/Free Full Text]
  72. Cavailles V., Gompel A., Portois M. C., Thenot S., Mabon N., Vignon F. Comparative activity of pulsed or continuous estradiol exposure on gene expression and proliferation of normal and tumoral human breast cells. J. Mol. Endocrinol., 28: 165-175, 2002.[Abstract]
  73. Green D. R., Reed J. C. Mitochondria and apoptosis. Science (Wash. DC), 281: 1309-1312, 1998.[Abstract/Free Full Text]
  74. Wajant H. The Fas signaling pathway: more than a paradigm. Science (Wash. DC), 296: 1635-1636, 2002.[Abstract/Free Full Text]
  75. Vousden K. H. p53: death star. Cell, 103: 691-694, 2000.[Medline]
  76. Franke T. F., Kaplan D. R., Cantley L. C. PI3K: downstream AKTion blocks apoptosis. Cell, 88: 435-437, 1997.[Medline]
  77. Datta S. R., Brunet A., Greenberg M. E. Cellular survival: a play in three Akts. Genes Dev., 13: 2905-2927, 1999.[Free Full Text]
  78. Gao Z., Li B. S., Day Y. J., Linden J. A3 adenosine receptor activation triggers phosphorylation of protein kinase B and protects rat basophilic leukemia 2H3 mast cells from apoptosis. Mol. Pharmacol., 59: 76-82, 2001.[Abstract/Free Full Text]
  79. Bezwoda W. R., Meyer K. Effect of {alpha}-interferon, 17ß-estradiol, and tamoxifen on estrogen receptor concentration and cell cycle kinetics of MCF 7 cells. Cancer Res., 50: 5387-5391, 1990.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Arch Intern MedHome page
K. Ishitani, J. Lin, J. E. Manson, J. E. Buring, and S. M. Zhang
Caffeine Consumption and the Risk of Breast Cancer in a Large Prospective Cohort of Women
Arch Intern Med, October 13, 2008; 168(18): 2022 - 2031.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Amlal, S. Faroqui, A. Balasubramaniam, and S. Sheriff
Estrogen Up-regulates Neuropeptide Y Y1 Receptor Expression in a Human Breast Cancer Cell Line.
Cancer Res., April 1, 2006; 66(7): 3706 - 3714.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
H. Chung, J.-Y. Jung, S.-D. Cho, K.-A Hong, H.-J. Kim, D.-H. Shin, H. Kim, H. O. Kim, D. H. Shin, H. W. Lee, et al.
The antitumor effect of LJ-529, a novel agonist to A3 adenosine receptor, in both estrogen receptor-positive and estrogen receptor-negative human breast cancers.
Mol. Cancer Ther., March 1, 2006; 5(3): 685 - 692.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. G. Nguyen, D. Chinnappan, T. Urano, and K. Ravid
Mechanism of Aurora-B Degradation and Its Dependency on Intact KEN and A-Boxes: Identification of an Aneuploidy-Promoting Property
Mol. Cell. Biol., June 15, 2005; 25(12): 4977 - 4992.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, J.
Right arrow Articles by Ravid, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, J.
Right arrow Articles by Ravid, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online