
[Cancer Research 63, 449-454, January 15, 2003]
© 2003 American Association for Cancer Research
Molecular Biology and Genetics |
The Homeotic Protein Six3 Is a Coactivator of the Nuclear Receptor NOR-1 and a Corepressor of the Fusion Protein EWS/NOR-1 in Human Extraskeletal Myxoid Chondrosarcomas1
Cynthia Laflamme,
Christine Filion,
Julia A. Bridge,
Marc Ladanyi,
Mary B. Goldring and
Yves Labelle2
Human and Molecular Genetic Research Unit, Pavillon Saint-François dAssise, CHUQ, Quebec, Qc, G1L 3L5 and Laval University Faculty of Medicine, Quebec, Qc, G1K 7P4 Canada [C. L., C. F., Y. L.]; Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, Nebraska 68198 [J. A. B.]; Department of Pathology, Memorial Sloan-Kettering Cancer Center, New York, New York 10021 [M. L.]; and New England Baptist Bone and Joint Institute and Rheumatology Division, Beth Israel Deaconess Medical Center, Harvard Institutes of Medicine, Boston, Massachusetts 02115 [M. B. G.]
 |
ABSTRACT
|
|---|
Nuclear receptors represent a large family of transcription factors involved in development, differentiation, homeostasis, and cancer. In recent years, a growing number of cofactors has been discovered that participate in the regulation of the transcriptional activity of these proteins. We present in this study the identification of a cofactor, the homeotic protein Six3, which differentially regulates the transcriptional activity of the orphan nuclear receptor NOR-1 (NR4A3). NOR-1 is normally involved in the balance between cell proliferation and cell death, and is implicated in oncogenesis as part of the EWS/NOR-1 fusion protein found in human extraskeletal myxoid chondrosarcoma (EMC) tumors. Reverse transcription-PCR analyses indicate that EMC tumors expressing the EWS/NOR-1 mRNA also express mRNAs encoding NOR-1 and Six3. Glutathione S-transferase fusion protein assays show that Six3 binds in vitro the DNA-binding domain of NOR-1 and the EWS domain of EWS/NOR-1 and that the homeodomain of Six3 is required for these interactions. Mammalian two-hybrid experiments, using immortalized human chondrocytes as a model, indicate that Six3 also interacts with NOR-1 and EWS/NOR-1 in vivo. Cotransfection experiments show that Six3 stimulates the transcriptional activity of NOR-1, whereas it represses that of EWS/NOR-1. Considering the highly specific expression pattern of Six3, our finding that it is expressed in EMC suggests that it plays a pivotal role in the development of these tumors. We propose that Six3 maintains a transcriptional balance between the activities of NOR-1 and EWS/NOR-1, the net effect being to deregulate the expression of specific target genes and push the equilibrium toward uncontrolled cell proliferation.
 |
INTRODUCTION
|
|---|
Nuclear receptors represent a large superfamily of transcription factors involved in a wide variety of developmental, homeostatic, and pathological processes (reviewed in Ref. 1
). The transcriptional activity of many nuclear receptors is regulated by endogenous or exogenous ligands. However, for a number of them, termed orphan receptors, no ligands have been identified. In addition to ligands, a large array of cofactors regulate the transcriptional activity of these proteins (reviewed in Refs. 2, 3, 4
). Many coactivators stimulate transcriptional activation by a subset of nuclear receptors in an agonist and AF-2-dependent mechanism and interact with the receptors through a conserved LXXLL motif. They possess histone acetyltransferase activities and may directly contact the RNA polymerase II core machinery. Corepressors possess receptor-interacting domains containing a motif, LXX I/H I XXX I/L, reminiscent of the LXXLL motif of coactivators, and repressor domains which interact with various histone deacetylases. These observations suggest that nuclear receptor cofactors exert their effects by interacting with the basal transcriptional machinery and remodeling the chromatin structure in the vicinity of their associated receptors.
NOR-1 (also known as TEC, MINOR, and CHN and designated NR4A3 in the nuclear receptor nomenclature system; Ref. 5
) is an orphan nuclear receptor originally identified as a protein induced in primary cultures of rat embryonic forebrain neurons undergoing apoptosis (6)
. Homology analyses of its DBD3
indicate that NOR-1 forms a subfamily with two other nuclear receptors, Nurr1 and NGFI-B. All three proteins are immediate early gene products induced by a variety of mitogenic stimuli, such as growth factors, mitogens, and liver regeneration (7, 8, 9, 10)
. In addition, NOR-1 and NGFI-B are induced during T cell receptor-mediated apoptosis of immature thymocytes and T-cell hybridomas (11, 12, 13)
. NOR-1 expression appears ubiquitous but is predominant in the central nervous system (14, 15, 16)
, and a mouse gene knockout model reveals that it is essential for the development of the semicircular canals of the inner ear (17)
. NOR-1 is also involved in human EMC tumors. The t(9;22) chromosomal translocation found in a subset of these tumors fuses the EWS gene on chromosome 22 to NOR-1 on chromosome 9, resulting in the production of a fusion protein called EWS/NOR-1, containing the NH2-terminal domain of EWS fused to the complete amino acid sequence of NOR-1 (18)
. NOR-1 can also be fused to two other genes in EMC as a result of chromosomal translocations: (a) TAF2N on chromosome 17 (19)
; and (b) TCF12 on chromosome 15 (20)
. The role of EWS/NOR-1 in EMC is not clear. Recently, it was shown that EWS/NOR-1 modulates pre-mRNA splicing and interacts with the human splicing protein U1C (21)
. On the other hand, EWS/NOR-1 is a highly potent transcriptional activator that binds to and activates transcription from a DNA response element recognized by the NOR-1 subfamily members, the NBRE (22)
. Therefore, the fusion protein may exert pleiotropic effects in cancer cells.
Recently, the homeotic protein Six3 was identified in a yeast two-hybrid screen as a putative partner of NOR-1 (23)
. Because the entire amino acid sequence of NOR-1 is present in EWS/NOR-1, we sought to determine whether Six3 was coexpressed with EWS/NOR-1 in EMC tumors. We present evidence that such is the case and proceed to characterize further in vitro and in vivo the interactions between Six3 and NOR-1 and EWS/NOR-1.
 |
MATERIALS AND METHODS
|
|---|
RT-PCR Analyses.
Total RNA was isolated from four frozen EMC tumor samples possessing the t(9;22) chromosomal translocation as determined by cytogenetic analyses and two human chondrocyte cell lines, C-20/A4 and T/C-28, using TRIzol (Life Technologies, Inc.) and following the suppliers instructions. RNA was reverse transcribed with the Omniscript RT kit (Qiagen) using oligo(dT) or random primers (New England Biolabs). PCR reactions were performed using the Qiagen Taq DNA polymerase with the following oligonucleotides (see Fig. 1A
for the position of the oligonucleotides with respect to the coding sequence of each mRNA): (a) EWS/NOR-1 type I: 5' oligo: 5' aaacaggaaagcccaaaggc 3', 3' oligo: 5' ggtggctgtagccgtgatct 3' (PCR annealing temperature used: 58°C); (b) EWS/NOR-1 type II: 5' oligo: 5' cccactagttacccacccca 3', 3' oligo: 5' ggctgagagtgtaggagga 3' (PCR annealing temperature used: 58°C); (c) Six3: 5' oligo: 5' agcggactcggagcctgttg 3', 3' oligo: 5' agcgcatgccgctcggtcca 3' (PCR annealing temperature used: 58°C); and (d) NOR-1: 5' oligo: 5' tcgggacagctctctag 3', 3' oligo: 5' ggtggctgtagccgtgatct 3' (PCR annealing temperature used: 52°C). Each PCR reaction consisted of 35 amplification cycles. Oligo pairs were chosen so that an intron would be present if genomic DNA were amplified, and each amplified fragment was sequenced to confirm its identity. RT-PCR products were resolved in 1.5% agarose gels and visualized by ethidium bromide staining.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1. RT-PCR analyses of EMC tumors and human chondrocyte cell lines. A, diagram showing the position of the oligonucleotides (arrowheads) used for the PCR reactions with respect to the coding sequence of each mRNA. Lines, noncoding sequences; boxes, coding sequences. B, analyses of EMC tumor RNA samples with oligonucleotides specific for EWS/NOR-1 (top panel), Six3 (middle panel), and NOR-1 (bottom panel). T14, four different tumor samples; C, the control RT-PCR reaction with no added template. T13 tumors express the type I EWS/NOR-1 fusion transcript, whereas T4 expresses the type II. All tumors express Six3 and NOR-1 mRNAs. C, analyses of human chondrocyte cell lines C-20/A4 and T/C-28 RNA samples. Both cell lines express NOR-1 (bottom panel), whereas only C-20/A4 expresses Six3 (top panel).
|
|
Plasmids.
GST fusion proteins were produced from the pGEX-4T-1 vector (Amersham Biosciences). Human NOR-1 and EWS/NOR-1 full-length and deleted cDNA coding sequences cloned into the pcDNA3.1(+) vector (22)
were either amplified using the PfuDNA polymerase (Stratagene) or digested with restriction enzymes and cloned in-frame with the GST coding sequence of pGEX-4T-1. The nucleotide sequence of all amplified fragments was confirmed by DNA sequencing. The human Six3 cDNA coding sequence was amplified from the C-20/A4 chondrocyte cell line and cloned into the HindIII-EcoRI restriction enzyme sites of pcDNA3.1(+)(Invitrogen) to give pcDNA/Six3. pcDNA/Six3
C was obtained by removing a SacII-EcoRV fragment from pcDNA/Six3, and pcDNA/Six3
HD was obtained by removing a NotI-NotI fragment from pcDNA/Six3. Mammalian two-hybrid experiments were carried out using the pBIND and pACT expression vectors and the pG5luc reporter vector provided in the CheckMate Mammalian Two-Hybrid System from Promega. pBIND contains the DBD of GAL4 (amino acids 1147), and pACT contains the activation domain of VP16 (amino acids 411456). In addition, pBIND contains a Renilla luciferase gene under the control of a constitutive promoter to normalize for transfection efficiencies. NOR-1 and EWS/NOR-1 cDNA sequences were amplified and cloned in-frame with the DBD of GAL4 in pBIND, and the Six3 cDNA sequence was amplified and cloned in-frame with the activation domain of VP16 in pACT. The vectors pACT/Six3
C and pACT/Six3
HD were constructed by transferring the truncated Six3 sequences from pcDNA/Six
C and pcDNA/Six3
HD to pACT by restriction enzyme digestions. The p(B1a)8luc reporter vector (24)
and the pCMX/NGFI-B expression vector were obtained from Jeffrey Milbrandt (Washington University School of Medicine, St. Louis, MO) (25)
and Jacques Drouin (Clinical Research Institute of Montreal), respectively. The Nurr1 cDNA (26)
was obtained from Orla M. Conneely (Baylor College of Medicine, Houston, TX) and transferred from pBluescript to pcDNA3.1(+) with the restriction enzymes NotI-ApaI.
GST Pull-down Assays.
The vectors pcDNA/Six3, pcDNA/Six3
C, and pcDNA/Six3
HD and a luciferase control were used in the TnT-T7 Quick Coupled Transcription/Translation System from Promega in the presence of 35S-methionine (Amersham Biosciences). BL21 cells were transformed with the appropriate pGEX-4T-1 expression vector and induced with 2.5 mM isopropyl-1-thio-ß-D-galactopyranoside. Bacterial extracts were incubated with the 35S-methionine-labeled proteins along with Glutathione Sepharose 4B (Pharmacia Biotech) in 20 mM Tris (pH 8.0)/100 mM NaCl/2% NP-40/0.5 mM EDTA. Beads were washed in the same buffer, and bounded proteins were eluted in loading buffer and analyzed by PAGE. Gels were stained with Coomassie blue, dried, and exposed on XAR films (Kodak).
Cell Lines, Transfections, and Western Blot Analyses.
Two immortalized human chondrocyte cell lines, T/C-28 and C-20/A4, were used (27)
. They were grown in DMEM/F12 (1:1) medium with 10% FCS at 37°C and 5% CO2. Transfections were carried out with Lipofectamine Reagent (Life Technologies) following the suppliers instructions in six-well culture plates. For the mammalian two-hybrid experiments, 500 ng of pBIND and pACT expression vectors and pG5luc reporter vector were used for each well. Two to 3 days after transfection, cell extracts were prepared and assayed for firefly and Renilla luciferases using the Dual-Luciferase Reporter Assay System from Promega and a Berthold MiniLumat LB 9506 Luminometer. Each transfection was performed in triplicate, and firefly luciferase activities were normalized with Renilla luciferase activities to correct for transfection efficiencies. The results are expressed as relative light units. For cotransfections of T/C-28 and C-20/A4 cells with increasing amounts of pcDNA/Six3, pcDNA/Six3
C, or pcDNA/Six3
HD expression vectors, 200 ng of p(B1a)8luc reporter vector and pCMV/Gal-normalizing vector and the indicated amounts of pcDNA3.1(+) expression vectors were combined for a total of 800 ng of DNA/well. Two to 3 days after transfections, cell extracts were prepared, and luciferase and galactosidase activities were determined using a Luciferase Assay System from Promega and a Beta-Gal Assay Kit from Clontech. For Western blot analyses, cells were transfected as described, protein extracts were prepared, separated by PAGE, transferred onto Immobilon-P membranes (Millipore), and reacted with an affinity-purified rabbit antibody prepared in our laboratory and directed against the NH2-terminal portion of NOR-1. A goat antirabbit IgG antibody coupled to horseradish peroxidase (Zymed) was applied and after washes detected with a Western Lightning Chemiluminescence kit from Perkin-Elmer.
 |
RESULTS
|
|---|
Coexpression of EWS/NOR-1, Six3, and NOR-1 mRNAs in EMC Tumors.
To determine whether the Six3 protein could be present in EMC tumors expressing EWS/NOR-1, RT-PCR experiments were carried out. Total RNA was extracted from four EMC tumors, and RT-PCR analyses of EWS/NOR-1 fusion mRNAs revealed that three of the cases expressed the type I fusion transcript, whereas one expressed the type II (Fig. 1B
, 239- and 209-bp fragments, respectively; see Ref. 18
for the three types of EWS/NOR-1 fusion transcripts). PCR analyses of the same reverse transcriptase samples revealed that all four contained Six3 and NOR-1 transcripts (Fig. 1B
, 203- and 386-bp fragments, respectively). As a control for the NOR-1 and Six3 PCR reactions, the chondrocyte cell lines C-20/A4 and T/C-28 were analyzed, and the results show that whereas both express NOR-1, only C-20/A4 expresses Six3 (Fig. 1C)
. These results indicate that EMC tumors expressing an EWS/NOR-1 fusion transcript also express Six3 and NOR-1 mRNAs and suggest that the three proteins are coexpressed in the tumor cells.
Six3 Interacts with NOR-1 and EWS/NOR-1 in Vitro.
GST fusion protein assays were used to determine whether Six3 could bind to NOR-1 and EWS/NOR-1 in vitro. As shown in Fig. 2A
, Six3 binds the full-length NOR-1 protein, as reported previously by Ohkura et al. (23)
. Successive COOH-terminal deletions of the AF2 domain, the leucine zipper, and exon 5 corresponding to the hinge region of NOR-1 did not alter significantly the binding of Six3. Deletion of the DBD, however, completely abolished the interaction of Six3 with NOR-1. Similar experiments with EWS/NOR-1 showed that Six3 also binds to the full-length EWS/NOR-1 protein (Fig. 2B)
. However, removal of the DBD of EWS/NOR-1 did not result in a complete loss of binding of Six3. Indeed, successive COOH-terminal deletions showed that the EWS domain alone can bind to Six3 efficiently. To determine the Six3 domain involved in these interactions, deletion mutants lacking the extreme COOH-terminal region (Six3
C) or the homeodomain (Six3
HD) were translated in vitro and used in the GST assay with full-length NOR-1 and EWS/NOR-1 (Fig. 2C)
. The results clearly indicate that the homeodomain of Six3 is required for the interactions to occur.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2. Six3 interacts with NOR-1 and EWS/NOR-1 in vitro in GST fusion protein assays. A, schematic structures of the various GST/NOR-1 fusion proteins used in the GST pull-down assay. Numbers indicate amino acids. Full-length NOR-1 binds efficiently to Six3, as do three COOH-terminal deletions still containing the DBD of NOR-1. Deletion of the DBD, however, completely abolishes the interaction. LZ, leucine zipper; E5, exon 5; S, Six3; L, luciferase; M, molecular weights in kilodaltons. B, schematic structures of the various GST/EWS-NOR-1 fusion proteins used in the GST pull-down assay. The EWS domain is fused to NOR-1 via a sequence of 59 amino acids (hatched box) encoded by a normally untranslated 5' portion of the NOR-1 mRNA present in the fusion transcript. Full-length EWS/NOR-1 binds efficiently to Six3 and successive COOH-terminal deletions until only the EWS domain remains do not significantly alter this binding. AD, activation domain. C, schematic structures of the Six3 deletion mutants used in the GST pull-down assay. Six3 and Six3 C bind efficiently to NOR-1 and EWS/NOR-1. Deletion of the homeodomain (Six3 HD), however, completely abolishes the interactions. SD, six domain.
|
|
Six3 Interacts with NOR-1 and EWS/NOR-1 in Vivo.
To determine whether Six3 could interact with NOR-1 and EWS/NOR-1 in vivo, we used the mammalian two-hybrid technique (28)
and two immortalized human chondrocyte cell lines: (a) T/C-28; and (b) C-20/A4. These cell lines were derived from primary cultures of human chondrocytes using vectors encoding the SV40 large T antigen. The cells display chondrocyte morphology and expression of chondrocyte-specific collagens and proteoglycans and are not tumorigenic when injected into nude mice (27
, 29
, 30)
. Because the cells of origin of EMC tumors are chondrocytes (31)
, we reasoned that these cell lines may present a cellular context more closely resembling the in vivo pathological situation than other cell lines for studying the interactions between Six3 and NOR-1 and EWS/NOR-1. The various pBIND and pACT expression vectors (Fig. 3A)
were used in transient transfection assays along with the pG5luc reporter vector. Fig. 3B
shows that transfection of T/C-28 cells with pACT/Six3 or pBIND/NOR-1 vectors alone resulted in increases in the activity of the reporter gene of 3.1- and 1.5-fold, respectively, compared with the empty vectors. In contrast, transfection of both vectors together resulted in an increase of 14.3-fold, suggesting that NOR-1 and Six3 could interact in T/C-28 cells. When the pACT/Six3
C or pACT/Six3
HD vectors were used instead of pACT/Six3, the activity of the reporter gene fell to 5.7- and 3-fold, respectively, confirming the finding of the GST fusion protein assays (Fig. 2C)
that the homeodomain of Six3 is essential for the interaction with NOR-1. The observation that Six3
C binds less efficiently to NOR-1 than full-length Six3 in the two-hybrid assays, whereas both bind NOR-1 with comparable efficiency in the GST assays, suggests that the COOH-terminal sequences of Six3 are required to stabilize its interaction with NOR-1 in vivo. Fig. 3C
shows the results obtained using EWS/NOR-1 in the two-hybrid assays. Transfection of T/C-28 cells with pBIND/EWS-NOR-1 alone activated the reporter gene
50-fold. This strong activation compared with that of pBIND/NOR-1 is caused by the presence of the EWS domain, which has been characterized previously as a powerful transcription activation sequence (22
, 32)
. When pACT/Six3 was cotransfected with pBIND/EWS/NOR-1, activation of the reporter gene reached 160-fold, suggesting that EWS/NOR-1 interacts with Six3. Again, transfection of pACT/Six3
C or pACT/Six3
HD reduced significantly the activity of the reporter gene to 95- and 75-fold, respectively. Similar results were obtained using the C-20/A4 cell line for both NOR-1 and EWS/NOR-1 (data not shown). Overall, these results strongly suggest that the in vitro interactions characterized by GST fusion protein assays also occur in vivo in human chondrocyte cells.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3. Six3 interacts with NOR-1 and EWS/NOR-1 in vivo in a mammalian two-hybrid assay. A, schematic structure of the proteins encoded by pBIND and pACT expression vectors. Numbers indicate amino acids. LZ, leucine zipper; AD, activation domain; SD, six domain. In B, T/C-28 human chondrocytes were transiently cotransfected with the pG5luc reporter vector and the indicated expression vectors. Cotransfection of NOR-1 and Six3 (pB/N + pA/S) stimulates the reporter gene 14.3-fold compared with the empty expression vectors (pB + pA). Cotransfection of NOR-1 with Six3 C or Six3 HD significantly reduces this stimulation to background levels (pB/N + pA/S C and pB/N + pA/S HD, respectively). In C, cotransfection of T/C-28 cells with EWS/NOR-1 and Six3 (pB/EN + pA/S) stimulates the reporter gene 160-fold compared with the empty expression vectors (pB + pA). Cotransfection of EWS/NOR-1 with Six3 C or Six3 HD significantly reduces this stimulation to near background levels (pB/EN + pA/S C and pB/EN + pA/S HD, respectively). Transfections were performed in triplicate, and the mean value is plotted with the SD (vertical bars). pB, pBIND; pA, pACT; pB/N, pBIND/NOR-1; pA/S, pACT/Six3; pA/S C, pACT/Six3 C; pA/S HD, pACT/Six3 HD; pB/EN, pBIND/EWS-NOR-1.
|
|
Six3 Differentially Regulates the Transcriptional Activities of NOR-1 Subfamily Members and EWS/NOR-1.
To determine whether the transcriptional activities of NOR-1 and EWS/NOR-1 were modified by the interactions with Six3 in chondrocytes, cotransfections with increasing amounts of Six3 expression vector were carried out. The reporter vector used, p(B1a)8luc, contains the NBRE sequence recognized by NOR-1 subfamily members and EWS/NOR-1 (22)
. As shown in Fig. 4A
, NOR-1 alone transactivated the reporter gene in C-20/A4 cells, and the addition of Six3 very significantly enhanced this activity in a dose-dependent manner. Western blot analyses showed that the addition of Six3 did not significantly change the amount of NOR-1 produced (Fig. 4A
, top panel). The same results were obtained when T/C-28 cells were used (Fig. 4C)
. In addition, when Six3
C was expressed instead of Six3, the increase in transcriptional activation was greatly reduced, and when Six3
HD was expressed, the increase was completely abolished (Fig. 4C)
. These results suggest that Six3 enhances the transcriptional activity of NOR-1 by interacting directly with the receptor, as was observed in the GST fusion protein and mammalian two-hybrid assays. When the same experiments were carried out using EWS/NOR-1, the opposite picture emerged. EWS/NOR-1 strongly activated the reporter gene in C-20/A4 cells (Fig. 4B)
, as was observed previously (22)
. Cotransfection with Six3, however, significantly reduced this activation in a dose-dependent manner. Again, Western blot analyses showed that the levels of EWS/NOR-1 were not significantly altered by the addition of Six3 (Fig. 4B
, top panel). The same results were obtained using T/C-28 cells (Fig. 4D)
. The expression of Six3
C also decreased the activation of the reporter gene; however, the expression of Six3
HD had no significant effects (Fig. 4D)
. These results are consistent with our findings in GST fusion protein and mammalian two-hybrid assays. Overall, these results strongly suggest that Six3 differentially regulates the transcriptional activities of NOR-1 and EWS/NOR-1 by interacting directly with the proteins.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 4. Six3 stimulates the transcriptional activity of NOR-1 and represses that of EWS/NOR-1 in human chondrocyte cell lines. Cells were cotransfected with the p(B1a)8luc reporter vector, the pCMV/Gal-normalizing vector, and the indicated amounts of pcDNA expression vectors. In A, increasing amounts (100, 200, and 300 ng) of pcDNA/Six3 expression vector were cotransfected with a fixed amount (100 ng) of pcDNA/NOR-1 expression vector in C-20/A4 cells. pcDNA, pcDNA/Six3, and pcDNA/NOR-1 (100 ng) were transfected alone as controls. Six3 clearly stimulates the transcriptional activity of NOR-1. Top panel, a Western blot showing that NOR-1 protein levels are not altered by increasing amounts of Six3 expression vector. In B, increasing amounts (100, 200, and 300 ng) of pcDNA/Six3 expression vector were cotransfected with a fixed amount (100 ng) of pcDNA/EWS/NOR-1 expression vector in C-20/A4 cells. Six3 clearly represses the transcriptional activity of EWS/NOR-1. Top panel, a Western blot showing that EWS/NOR-1 protein levels are not altered by increasing amounts of Six3 expression vector. C, increasing amounts (100, 200, and 300 ng) of pcDNA/Six3, pcDNA/Six3 C, or pcDNA/Six3 HD expression vectors were cotransfected with a fixed amount (100 ng) of NOR-1 expression vector in T/C-28 cells. Six3 stimulates the activity of NOR-1; however, Six3 C is much less efficient, and Six3 HD is totally inefficient in this respect. In D, increasing amounts (100, 200, and 300 ng) of pcDNA/Six3, pcDNA/Six3 C, or pcDNA/Six3 HD expression vectors were cotransfected with a fixed amount of EWS/NOR-1 expression vector (100 ng) in T/C-28 cells. Six3 represses the activity of EWS/NOR-1, as does Six3 C; however, Six3 HD is much less efficient in this respect. N, NOR-1; S, Six3; S C, Six3 C; S HD, Six3 HD; EN, EWS/NOR-1. Transfections were performed in triplicate, and the mean value is plotted with the SD (vertical bars).
|
|
The GST fusion protein assays showed that Six3 binds to the DBD of NOR-1 (Fig. 2A)
. The DBD of the two other members of the subfamily, Nurr1 and NGFI-B, shows 98 and 91% amino acid identity, respectively, with that of NOR-1 (18)
. On the basis of this homology, we tested the effect of Six3 on the activation potential of Nurr1 and NGFI-B in T/C-28 cells. The expression of both receptors alone activated the reporter gene, and the addition of Six3 had the same effects as with NOR-1, namely a clear increase in the transcriptional activities of Nurr1 and NGFI-B in a dose-dependent manner (Fig. 5, A and B
, respectively). When Six3
HD was added instead of Six3, the increase was not dose dependent for Nurr1 (Fig. 5A)
and completely abolished for NGFI-B (Fig. 5B)
. Thus, Six3 is a coactivator of the NOR-1 subfamily of nuclear receptors in human chondrocytes.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5. Six3 stimulates the transcriptional activities of Nurr1 and NGFI-B in T/C-28 cells. Cells were cotransfected with the p(B1a)8luc reporter vector, pCMV/Gal-normalizing vector, and indicated amounts of pcDNA expression vectors. In A, increasing amounts (100, 200, and 300 ng) of pcDNA/Six3 or pcDNA/Six3 HD expression vectors were cotransfected with a fixed amount (100 ng) of pcDNA/Nurr1 expression vector. pcDNA, pcDNA/Six3, pcDNA/Six3 HD, and pcDNA/Nurr1 (100 ng) were transfected alone as controls. Six3 clearly stimulates the transcriptional activity of Nurr1. N, Nurr1; S, Six3; S HD, Six3 HD. In B, increasing amounts (100, 200, and 300 ng) of pcDNA/Six3 or pcDNA/Six3 HD expression vectors were cotransfected with a fixed amount (100 ng) of pcDNA/NGFI-B expression vector. Six3 clearly stimulates the transcriptional activity of NGFI-B. N, NGFI-B; S, Six3; S HD, Six3 HD. Transfections were performed in triplicate, and the mean value is plotted with the SD (vertical bars).
|
|
 |
DISCUSSION
|
|---|
In this study, we show that the homeotic protein Six3 is a coactivator of the orphan nuclear receptor NOR-1 and a corepressor of the fusion protein EWS/NOR-1 in human chondrocyte cells. Recently, Ohkura et al. (23)
reported that Six3 could repress NOR-1 transactivation in human mammary adenocarcinoma MCF-7 cells. These divergent observations suggest that in different cellular contexts, the effect of Six3 on NOR-1 may vary. In addition, the same authors show that NOR-1 DNA binding and AF2 domains can interact with Six3 in a yeast two-hybrid system (23)
. Our deletion analyses confirm the DBD interaction and are not incompatible with an interaction involving the AF2 domain.
Six3 was originally identified as the mammalian homologue of the Drosophila sine oculis gene involved in eye development (33
, 34)
. In the mouse, it is expressed in the developing brain, mainly in the visual system (34)
. NOR-1 subfamily receptors are also expressed in the developing brain, and regions of overlap with Six3 include the tegmentum for Nurr1, the thalamus for NOR-1 and Nurr1, and the pituitary gland for NOR-1 (14
, 15)
. In humans, Six3 expression has been documented in the embryo at 57 weeks of gestation and in the eye region throughout fetal development (35)
, and mutations in the Six3 gene have been associated with holoprosencephaly (36
, 37)
. Recent studies have shown that Six3 interacts with the Groucho-related family of corepressors and acts as a transcriptional repressor in eye development in zebrafish and the mouse (38
, 39)
. Our results indicate that Six3 may also act as a transcriptional repressor in the context of human EMC tumors.
Considering the highly specific expression pattern of Six3, our finding that it is expressed in EMC cells suggests that it plays a determinant role in the development of these tumors. This role may be to maintain a balance between the transcriptional activities of NOR-1 and EWS/NOR-1, the net result being to deregulate the expression of specific target genes and induce uncontrolled cell proliferation. One observation that supports this hypothesis is that C-20/A4 cells, which express endogenous NOR-1 and Six3, can stably express exogenous EWS/NOR-1 following transfection of a pcDNA/EWS-NOR-1 expression vector and selection of resistant cell clones in G418. T/C-28 cells, however, which express endogenous NOR-1 but not Six3, do not generate any resistant cell clones following a similar protocol.4
This indicates that the presence of Six3 may be required to repress the strong transcriptional activation properties of EWS/NOR-1, which otherwise may lead to cell death. This further suggests that interfering with Six3 expression or function in EMC may lead to tumor cell death.
Six3 is the second homeotic nuclear receptor cofactor identified to date, the first being the Drosophila protein FTZ, which interacts with the FTZ-Factor1 nuclear receptor (40
, 41)
. Recent work has shown that FTZ possesses a functional LXXLL motif located in its NH2-terminal region through which it interacts with the AF2 motif of FTZ-Factor1 (42
, 43)
. In contrast, Six3 does not possess a LXXLL motif; therefore, its binding to NOR-1 represents a novel type of interaction that will be further investigated by deletion mutants and amino acid substitutions in the homeodomain region.
Our observation that Six3 binds the EWS domain of EWS/NOR-1 has two immediate implications. First, Six3 may bind the native EWS protein. The precise role of EWS is unclear; however, it possesses an RNA-binding domain (44)
, associates with both transcription factor IID and RNA polymerase II (45)
, and has transcriptional regulatory properties (46)
. Second, Six3 may be involved in the control of other EWS-containing fusion proteins. Many such fusion proteins have been identified in various tumors (reviewed in Ref. 47
), and some of them, similar to EWS/NOR-1, are potent transcriptional activators attributable to the addition of the EWS domain (32
, 48)
. Therefore, they too may be transcriptionally repressed by Six3.
Finally, a BLAST analysis of the Six3 homeodomain reveals that human Six9 and mouse Six6 show 98% identity in this region with human Six3, and zebrafish Six7 and mouse Six2 show 96 and 73%, respectively. Thus, the hypothesis that other Six family proteins may interact with NOR-1 subfamily members to regulate cell proliferation in various physiological contexts is clearly open to investigation.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Georges Lévesque (Hôpital Saint-François dAssise, Québec), Réal Lagacé (Hôpital Hôtel-Dieu de Québec), Jeffrey Milbrant, Jacques Drouin, and Orla M. Conneely for plasmids and tumor samples; Edouard Khandjian for help with Fig. 1
; and Rachid Mazroui for critical reading of this manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by Grant 44028 from the Canadian Institutes for Health Research and Grant 183693 from the Natural Sciences and Engineering Research Council of Canada (to Y. L.). C. L. was supported by a fellowship from Le Centre de Recherche du Pavillon Saint-François dAssise, and Y. L. is a scholar of Le Fonds de la Recherche en Santé du Québec. 
2 To whom requests for reprints should be addressed, at Centre de Recherche, Pavillon Saint-François dAssise, CHUQ, 10 rue de lEspinay, Québec, Qc, G1L 3L5, Canada. Phone: (418) 525-4402; Fax: (418) 525-4195; E-mail: yves.labelle{at}bcx.ulaval.ca 
3 The abbreviations used are: DBD, DNA binding domain; EMC, extraskeletal myxoid chondrosarcoma; CMV, cytomegalovirus; GST, glutathione S-transferase; RT-PCR, reverse transcription-PCR; FTZ, Fushi tarazu; NBRE, NGFI-B response element; BLAST, Basic Local Alignment Search Tool. 
4 C. Filion and Y. Labelle, unpublished data. 
Received 7/30/02.
Accepted 12/ 2/02.
 |
REFERENCES
|
|---|
- Aranda A., Pascual A. Nuclear hormone receptors and gene expression. Physiol. Rev., 81: 1269-1304, 2001.[Abstract/Free Full Text]
- McKenna N. J., OMalley B. W. Combinatorial control of gene expression by nuclear receptors and coregulators. Cell, 108: 465-474, 2002.[Medline]
- Hermanson O., Glass C. K., Rosenfeld M. G. Nuclear receptors coregulators: multiple modes of modification. Trends Endocrinol. Metab., 13: 55-60, 2002.[Medline]
- Lee J. W., Lee Y. C., Na S-Y., Jung D-J., Lee S-K. Transcriptional coregulators of the nuclear receptor superfamily: coactivators and corepressors. Cell. Mol. Life Sci., 58: 289-297, 2001.[Medline]
- Nuclear Receptors Nomenclature Committee. . Cell, 97: 161-163, 1999.[Medline]
- Ohkura T., Hijikuro M., Yamamoto A., Miki K. Molecular cloning of a novel thyroid/steroid receptor superfamily gene from cultured rat neuronal cells. Biochem. Biophys. Res. Commun., 205: 1959-1965, 1994.[Medline]
- Milbrandt J. Nerve growth factor induces a gene homologous to the glucocorticoid receptor gene. Neuron, 1: 183-188, 1988.[Medline]
- Hazel T. G., Nathans D., Lau L. F. A gene inducible by serum growth factors encodes a member of the steroid and thyroid hormone receptor superfamily. Proc. Natl. Acad. Sci. USA, 85: 8444-8448, 1988.[Abstract/Free Full Text]
- Scearce L. M., Laz T. M., Hazel T. G., Lau L. F., Taub R. RNR-1, a nuclear receptor in the NGFI-N/Nur77 family that is rapidly induced in regenerating liver. J. Biol. Chem., 268: 8855-8861, 1993.[Abstract/Free Full Text]
- Hedvat C. V., Irving S. G. The isolation and characterization of MINOR, a novel mitogen-induced nuclear orphan receptor. Mol. Endocrinol., 9: 1692-1700, 1995.[Abstract]
- Woronicz J. D., Calnan B., Ngo V., Winoto A. Requirement for the orphan steroid receptor Nur77 in apoptosis of T-cell hybridomas. Nature (Lond.), 367: 277-281, 1994.[Medline]
- Liu Z-G., Smith S. W., McLaughlin K. A., Schwartz L. M., Osborne B. A. Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate-early gene nur77. Nature (Lond.), 367: 281-284, 1994.[Medline]
- Cheng L. E-C., Chan F. K-M., Cado D., Winoto A. Functional redundancy of the Nur77 and Nor-1 orphan steroid receptors in T-cell apoptosis. EMBO J., 16: 1865-1875, 1997.[Medline]
- Zetterström R. H., Solomin L., Mitsiadis T., Olson L., Perlmann T. Retinoid X receptor heterodimerization and developmental expression distinguishes the orphan nuclear receptors NGFI-B. Nurr1 and Nor1. Mol. Endocrinol., 10: 1656-1666, 1996.
- Maruyama K., Tsukada T., Bandoh S., Sasaki K., Ohkura N., Yamaguchi K. Expression of the putative transcription factor NOR-1 in the nervous, the endocrine and the immune systems and the developing brain of the rat. Mol. Neuroendocrinol., 65: 2-8, 1997.
- Maltais A., Labelle Y. Structure and expression of the mouse gene encoding the orphan nuclear receptor TEC. DNA Cell Biol., 19: 121-130, 2000.[Medline]
- Ponnio T., Burton Q., Pereira F. A., Wu D. K., Conneely O. M. The nuclear receptor Nor-1 is essential for proliferation of the semicircular canals of the mouse ear. Mol. Cell. Biol., 22: 935-945, 2002.[Abstract/Free Full Text]
- Labelle Y., Zucman J., Stenman G., Kindblom L-G., Knight J., Turc-Carel C., Dockhorn-Dworniczak B., Mandahl N., Desmaze C., Peter M., Aurias A., Delattre O., Thomas G. Oncogenic conversion of a novel orphan nuclear receptor by chromosome translocation. Hum. Mol. Genet., 4: 2219-2226, 1995.[Abstract/Free Full Text]
- Sjögren H., Meis-Kindblom J. M., Kindblom L-G., Aman P., Stenman G. Fusion of the EWS-related gene TAF2N to TEC in extraskeletal myxoid chondrosarcoma. Cancer Res., 59: 5064-5067, 1999.[Abstract/Free Full Text]
- Sjögren H., Wedell B., Meis-Kindblom J. M., Kindblom L-G., Stenman G. Fusion of the NH2-terminal domain of the basic helix-loop-helix protein TCF12 to TEC in extraskeletal myxoid chondrosarcoma with translocation t(9;15) (q22;q21). Cancer Res., 60: 6832-6835, 2000.[Abstract/Free Full Text]
- Ohkura N., Yaguchi H., Tsukada T., Yamaguchi K. The EWS/NOR1 fusion gene product gains a novel activity affecting pre-mRNA splicing. J. Biol. Chem., 277: 535-543, 2002.[Abstract/Free Full Text]
- Labelle Y., Bussières J., Courjal F., Goldring M. B. The EWS/TEC fusion protein encoded by the t(9;22) chromosomal translocation in human chondrosarcomas is a highly potent transcriptional activator. Oncogene, 18: 3303-3308, 1999.[Medline]
- Ohkura N., Ohkubo T., Murayama K., Tsukada T., Yamaguchi K. The orphan nuclear receptor NOR-1 interacts with the homeobox containing protein Six3. Dev. Neurosci., 23: 17-24, 2001.[Medline]
- Wilson T. E., Fahrner T. J., Johnston M., Milbrandt J. Identification of the DNA binding site for NGFI-B by genetic selection in yeast. Science (Wash. DC), 252: 1296-1300, 1991.[Abstract/Free Full Text]
- Maira M., Martens C., Philips A., Drouin J. Heterodimerization between members of the Nur subfamily of orphan nuclear receptors as a novel mechanism for gene activation. Mol. Cell. Biol., 19: 7549-7557, 1999.[Abstract/Free Full Text]
- Law S. W., Conneely O. M., DeMayo F. J., OMalley B. W. Identification of a new brain-specific transcription factor. NURR1. Mol. Endocrinol., 6: 2129-2135, 1992.
- Goldring M. B., Birkhead J. R., Suen L-F., Yamin R., Mizuno S., Glowacki J., Arbiser J. L., Apperley J. F. Interleukin-1ß-modulated gene expression in immortalized human chondrocytes. Clin. Investig., 94: 2307-2316, 1994.
- Dang C. V., Barrett J., Villa-Garcia M., Resar L. M., Kato G. J., Fearon E. R. Intracellular leucine zipper interactions suggest c-Myc hetero-oligomerization. Mol. Cell. Biol., 11: 954-962, 1991.[Abstract/Free Full Text]
- Kokenyesi R., Tan L., Robbins J. R., Goldring M. B. Proteoglycan production by immortalized human chondrocyte cell lines cultured under conditions that promote expression of the differentiated phenotype. Arch. Biochem. Biophys., 383: 79-90, 2000.[Medline]
- Loeser R. F., Sadiev S., Tan L., Goldring M. B. Integrin expression by primary and immortalized human chondrocytes: evidence of a differential role for alpha1beta1 and alpha2beta1 integrins in mediating chondrocyte adhesion to types II and VI collagen. Osteoarthritis Cartilage, 8: 96-105, 2000.[Medline]
- Weiss S. W., Goldblum J. R. Enzinger and Weisss Soft Tissue Tumors 1368-1379, Mosby St. Louis 2001.
- May W. A., Lessnick S. L., Braun B. S., Klemsz M., Lewis B. C., Lunsford L. B., Hromas R., Denny C. T. The Ewings sarcoma EWS/FLI-1 fusion gene encodes a more potent transcriptional activator and is a more powerful transforming gene than FLI-1. Mol. Cell. Biol., 13: 7393-7398, 1993.[Abstract/Free Full Text]
- Cheyette B. N. R., Green P. J., Martin K., Garren H., Hartenstein V., Zipursky S. L. The drosophila sine oculis locus encodes a homeodomain-containing protein required for the development of the entire visual system. Neuron, 12: 977-996, 1994.[Medline]
- Oliver G., Mailhos A., Wehr R., Copeland N. G., Jenkins N. A., Gruss P. Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development, 121: 4045-4055, 1995.[Abstract]
- Granadino B., Gallardo M. E., Lopez-Rios J., Sanz R., Ramos C., Ayuso C., Bovolenta P., Rodriguez de Cordoba Genomic cloning, structure, expression pattern, and chromosomal location of the human SIX3 gene. Genomics, 55: 100-105, 1999.[Medline]
- Wallis D. E., Roessler E., Hehr U., Nanni L., Wiltshire T., Richieri-Costa A., Gillessen-Kaesbach G., Zackai E. H., Rommens J., Muenke M. Mutations in the homeodomain of the human SIX3 gene cause holoprosencephaly. Nat. Genet., 22: 196-198, 1999.[Medline]
- Pasquier L., Dubourg C., Blayau M., Lazaro L., Le Marec B., David V., Odent S. A new mutation in the six-domain of SIX3 gene causes holoprosencephaly. Eur. J. Hum. Genet., 8: 797-800, 2000.[Medline]
- Kobayashi M., Nishikawa K., Suzuki T., Yamamoto M. The homeobox protein Six3 interacts with the Groucho corepressor and acts as a transcriptional repressor in eye and forebrain formation. Dev. Biol., 232: 315-326, 2001.[Medline]
- Zhu C. C., Dyer M. A., Uchikawa M., Kondoh H., Lagutin O. V., Oliver G. Six3-mediated auto repression and eye development requires its interaction with members of the Groucho-related family of co-repressors. Development, 129: 2835-2849, 2002.[Abstract/Free Full Text]
- Guichet A., Copeland J. W., Erdelyi M., Hlousek D., Zavorszky P., Ho J., Brown S., Percival-Smith A., Krause H. M., Ephrussi A. The nuclear receptor homologue Ftz-F1 and the homeodomain protein Ftz are mutually dependent cofactors. Nature (Lond.), 385: 548-552, 1997.[Medline]
- Yu Y., Li W., Su K., Yussa M., Han W., Perrimon N., Pick L. The nuclear hormone receptor Ftz-F1 is a cofactor for the Drosophila homeodomain protein Ftz. Nature (Lond.), 385: 552-555, 1997.[Medline]
- Schwartz C. J. E., Sampson H. M., Hlousek D., Percival-Smith A., Copeland J. W. R., Simmonds A. J., Krause H. M. FTZ-Factor1 and Fushi tarazu interact via conserved nuclear receptor and coactivator motifs. EMBO J., 20: 510-519, 2001.[Medline]
- Yussa M., Lohr U., Su K., Pick L. The nuclear receptor Ftz-F1 and homeodomain protein Ftz interact through evolutionarily conserved protein domains. Mech. Dev., 107: 39-53, 2001.[Medline]
- Ohno T., Ouchida M., Lee L., Gatalica Z., Roa V. N., Reddy E. S. P. The EWS gene, involved in Ewing family of tumors, malignant melanoma of soft parts and desmoplastic small round cell tumors, codes for an RNA binding protein with novel regulatory domains. Oncogene, 9: 3087-3097, 1994.[Medline]
- Bertolotti A., Melot T., Acker J., Vigneron M., Delattre O., Tora L. EWS, but not EWS-FLI-1, is associated with both TFIID and RNA polymerase II: interactions between two members of the TET family. EWS and hTAFII68, and subunits of TFIID and RNA polymerase II complexes. Mol. Cell. Biol., 18: 1489-1497, 1998.[Abstract/Free Full Text]
- Rossow K. L., Janknecht R. The Ewings sarcoma gene product functions as a transcriptional activator. Cancer Res., 61: 2690-2695, 2001.[Abstract/Free Full Text]
- Kim J., Pelletier J. Molecular genetics of chromosome translocations involving EWS and related family members. Physiol. Genomics, 1: 127-138, 1999.[Abstract/Free Full Text]
- Fujimura Y., Ohno T., Siddique H., Lee L., Rao V. N., Reddy E. S. P. The EWS-ATF-1 gene involved in malignant melanoma of soft parts with t(12;22) chromosome translocation, encodes a constitutive transcriptional activator. Oncogene, 12: 159-167, 1996.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Fu, L. Luo, N. Luo, X. Zhu, and W. T. Garvey
NR4A Orphan Nuclear Receptors Modulate Insulin Action and the Glucose Transport System: POTENTIAL ROLE IN INSULIN RESISTANCE
J. Biol. Chem.,
October 26, 2007;
282(43):
31525 - 31533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Manavathi, S. Peng, S. K. Rayala, A. H. Talukder, M. H. Wang, R.-A. Wang, S. Balasenthil, N. Agarwal, L. J. Frishman, and R. Kumar
Repression of Six3 by a corepressor regulates rhodopsin expression
PNAS,
August 7, 2007;
104(32):
13128 - 13133.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al.
International Union of Pharmacology. LXVI. Orphan Nuclear Receptors
Pharmacol. Rev.,
December 1, 2006;
58(4):
798 - 836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-S. Chang, M. D. Anway, S. S. Rekow, and M. K. Skinner
Transgenerational Epigenetic Imprinting of the Male Germline by Endocrine Disruptor Exposure during Gonadal Sex Determination
Endocrinology,
December 1, 2006;
147(12):
5524 - 5541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Wu, A. Li, M. Rao, M. Liu, V. Dailey, Y. Yang, D. Di Vizio, C. Wang, M. P. Lisanti, G. Sauter, et al.
DACH1 Is a Cell Fate Determination Factor That Inhibits Cyclin D1 and Breast Tumor Growth.
Mol. Cell. Biol.,
October 1, 2006;
26(19):
7116 - 7129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Reichenberger, R. D. Coletta, A. P. Schulte, M. Varella-Garcia, and H. L. Ford
Gene Amplification Is a Mechanism of Six1 Overexpression in Breast Cancer
Cancer Res.,
April 1, 2005;
65(7):
2668 - 2675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, S. Ghosh, Y. Nishi, T. Yanase, H. Nawata, and Y. Hu
The Orphan Nuclear Receptors NURR1 and NGFI-B Modulate Aromatase Gene Expression in Ovarian Granulosa Cells: A Possible Mechanism for Repression of Aromatase Expression upon Luteinizing Hormone Surge
Endocrinology,
January 1, 2005;
146(1):
237 - 246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Coletta, K. Christensen, K. J. Reichenberger, J. Lamb, D. Micomonaco, L. Huang, D. M. Wolf, C. Muller-Tidow, T. R. Golub, K. Kawakami, et al.
The Six1 homeoprotein stimulates tumorigenesis by reactivation of cyclin A1
PNAS,
April 27, 2004;
101(17):
6478 - 6483.
[Abstract]
[Full Text]
[PDF]
|
 |
|