Cancer Research Targets  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heckman, C. A.
Right arrow Articles by Boxer, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heckman, C. A.
Right arrow Articles by Boxer, L. M.
[Cancer Research 63, 6666-6673, October 15, 2003]
© 2003 American Association for Cancer Research


Regular Articles

Critical Elements of the Immunoglobulin Heavy Chain Gene Enhancers for Deregulated Expression of Bcl-21

Caroline A. Heckman, Thai Cao, Lina Somsouk, Hong Duan, John W. Mehew, Chun-yi Zhang and Linda M. Boxer2

Center for Molecular Biology in Medicine, Veterans Affairs Palo Alto Health Care System and the Department of Medicine, Stanford University School of Medicine, Stanford, California 94305


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Translocation of the bcl-2 gene to the immunoglobulin heavy chain gene is the most common alteration in follicular lymphoma. The result is the deregulated expression of bcl-2 and increased resistance to cell death. Regulation of the immunoglobulin heavy chain gene is controlled in part by four DNase I-hypersensitive regions located 3' of the gene. Here, we show that these four enhancer regions also contribute to bcl-2 up-regulation in t(14;18) cells. The enhancers are able to individually or in combination activate bcl-2 promoter activity. The HS4 enhancer region was found to impart the largest positive effect on the bcl-2 promoter, activating it by 6-fold, whereas addition of the HS1,2 region with HS4 increased promoter activity by approximately 9-fold. Nuclear factor {kappa}B binding sites were shown to be primarily responsible for the positive activity contributed by the HS1,2 and HS4 regions, and we observed the in vivo interaction of these factors with the human immunoglobulin heavy chain gene enhancer regions in t(14;18) cells. In addition, two Sp1 binding sites in HS4 were also found to positively influence bcl-2 activity, and Sp1 was observed to interact with the human HS4 enhancer in vivo. These results suggest that the interactions of the nuclear factor {kappa}B and Sp1 transcription factors with the immunoglobulin heavy chain enhancer region are important for bcl-2 deregulation in t(14;18) cells.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The t(14;18) translocation involves the bcl-2 gene on chromosome 18 and the IgH gene on chromosome 14 (1, 2, 3) . This translocation is present in the majority of follicular lymphomas and results in the deregulated expression of bcl-2. Increased levels of Bcl-2 protect the cells from apoptosis (4 , 5) and enhance resistance to chemotherapeutic agents (6, 7, 8, 9) .

Two promoters mediate initiation of bcl-2 gene transcription. In B cells, the 5' promoter is the most active, whereas there is very little transcription from the 3' promoter. Several factors that regulate bcl-2 transcription have been identified. A CRE3 mediates the positive regulation of the 5' promoter (P1). We have shown that this activity is due to both CREB and NF-{kappa}B family members binding to this site (10, 11, 12) . The CRE site is required for the increased expression of bcl-2 in activated B cells and for the rescue of immature B cells from calcium-dependent apoptosis, and the activation of CREB is mediated by protein kinase C (11) . The CRE site is also required for bcl-2 expression in neuronal cells (13) , prostate cancer cells (14) , and cardiomyocytes (15) and for estrogen receptor activation of the bcl-2 promoter in mammary cells (16) . Both insulin-like growth factor I and Akt/protein kinase B induce the bcl-2 promoter through the CRE site (17 , 18) . The bcl-2 promoter also contains WT1 binding sites, which act as negative regulators of bcl-2 in t(14;18) cells (19) and HeLa cells (20) and as positive regulators in sporadic Wilms’ tumors (21) . Although these transcription factors play a role in the deregulated bcl-2 expression in t(14;18) lymphoma cells, it is likely that regulatory regions of the immunoglobulin heavy chain locus influence bcl-2 expression as well.

Studies on the regulation of the immunoglobulin heavy chain gene have identified several enhancers (22) . Four B-cell-specific DNase I-hypersensitive sites, HS1 to HS4, are located 10–35 kb 3' of the murine C{alpha} gene (23, 24, 25, 26) . The activity of the individual enhancer regions varies during B-cell differentiation (23 , 27 , 28) , and these enhancers function as a locus control region in B cells (23) . Enhancers are also located downstream of two human C{alpha} genes, and these regions share some homology with the murine enhancers, although they are not as well characterized (29, 30, 31) . Several transcription factor-binding sites have been identified in these enhancer regions, including sites for NF-{kappa}B (32, 33, 34) , Oct (32, 33, 34) , Pax5/BSAP [B-cell lineage-specific activator protein (35 , 36) ], Bach2/Maf (37) , AP1 (38) , and Ets proteins (38, 39, 40) .

In this study, we describe the activation of the bcl-2 promoter by the immunoglobulin heavy chain gene 3' enhancers. Enhancer region HS4 is the most active with the bcl-2 promoter, and different combinations of the 3' enhancers show increased activation of bcl-2 expression. NF-{kappa}B proteins play an important role through sites in HS1,2 and HS4. In vivo binding of NF-{kappa}B to these sites was demonstrated by ChIP assays in t(14;18) lymphoma cells. In addition, two Sp1 sites are required for the activity of the HS4 enhancer with the bcl-2 promoter. These sites have not been previously described as important for the regulation of the immunoglobulin gene promoters.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Constructs.
The bcl-2 promoter-luciferase reporter construct for transient transfections has been described previously (11 , 19) . Creation of the IgH enhancer-bcl-2 promoter-luciferase reporter constructs was accomplished by PCR amplification of the DNase I-hypersensitive regions HS1,2, HS3, and HS4 from mouse genomic DNA with primers based on the published sequence, which incorporated unique restriction sites. Hypersensitive regions 1 and 2 (HS1,2) were amplified together due to their close proximity to each other, whereas hypersensitive regions 3 and 4 (HS3 and HS4) were amplified separately. The following sequences were used as primers: 5' HS1,2, TACGTATGATAGAGAGGAGATGACAGAAGG; 3' HS1,2, GTCGACCCAACTGCAGTTGACAAACTGAGCAG; 5' HS3, GTCGACTCTAGAACCACATGCGATCTAAGGG; 3' HS3, TCGCGAGATCATTGAGCTCCGGCTCTAACAAC; 5' HS4, TCGCGACTGCAGACTCACTGTTCACCATGAACCC; and 3' HS4, ACGCGTAGCTTGGAGTTAGGTGGGTAGGTGAGTGC. PCR amplification of the HS1,2 region resulted in a 1564-bp product, whereas HS3 amplification produced a 1182-bp amplicon, and amplification of the HS4 regions resulted in a 1381-bp product. The PCR products were cloned into a TA cloning vector (Clontech). A linker containing four unique restriction sites was cloned into the bcl-2 promoter-luciferase reporter construct, and the enhancer sequences were then inserted individually or in different combinations using the unique sites. The 5' deletions of HS1,2 and HS4 were created by PCR amplification using 5' primers based on different regions of the enhancer, which contained the unique restriction site, and the 3' primers described above. These amplified sequences were cloned into a TA vector (Clontech and Invitrogen) and then substituted for the full-length sequences in the reporter construct. Similarly, the 3' deletions were created with the 5' primers described above and with new 3' primers representing different regions of the enhancers. All deletions were cloned into a reporter construct containing the bcl-2 promoter with the full-length sequences of the other enhancer regions, and all constructs were confirmed by sequence analysis.

The episomal IgH enhancer-bcl-2-luciferase reporter construct was created by digesting pREP4 (Invitrogen) with SalI and then gel-purifying the backbone fragment containing the EBV oriP and EBNA-1 sequences and ligating it with a linker sequence. The IgH enhancer, bcl-2 promoter, and firefly luciferase sequences were then inserted into the modified episomal vector through the unique restriction sites contained in the linker. To create an episomal Renilla luciferase vector, the Renilla luciferase cDNA was removed from the pRL-TK vector (Promega) and subcloned into the NheI and BamHI sites of pREP4 (Invitrogen). The I{kappa}B{alpha}-SR expression vector was a gift from Dr. Arnold Rabson (University of Medicine and Dentistry of New Jersey).

Site-Directed Mutagenesis.
Mutation of the HS4 NF-{kappa}B binding site was described previously (41) . To mutate the two HS4 Sp1 binding sites and the HS1,2 NF-{kappa}B binding site, Stratagene’s Chameleon Double-Stranded Site-Directed Mutagenesis kit was used with the following primers: HS4, 5' Sp1, GCATGGTGCTGGGACGGGTTGGCCCTGG; HS4 3' Sp1, CCAGTCTGGGTACCTGTCCTATACACCCCAAAGAAGC; and HS1,2 NF-{kappa}B, GGCCTATGCTGGGAGTCGAGCATCCCCAAGGCTGG. Although neither HS4 region contained an exact Sp1 binding site, both contained a GGA sequence that was changed to the underlined bases. The NF-{kappa}B binding site in HS1,2 is indicated by bold type, and the mutated bases are underlined. Incorporation of the mutations was confirmed by sequence analysis.

Transfections.
The DHL-4 cell line is a human B-cell line containing the t(14;18) translocation and has been described previously (10) . These cells were maintained in RPMI 1640 with 10% FCS, L-glutamine, penicillin, and streptomycin. For each transient reporter gene assay, 2 x 107 cells at mid-log phase were pelleted and washed twice with unsupplemented RPMI 1640. The cells were resuspended in 0.75 ml of RPMI 1640 and mixed with 20 µg of DEAE-dextran. The cells were then placed in a 0.4-cm electroporation cuvette with 10 µg of the reporter plasmid and 0.1 µg of the pRL-TK vector (Promega) containing the Renilla luciferase cDNA. Electroporation was carried out at 975 µF and 320 V using the Bio-Rad Gene Pulser. The electroporated cells were allowed to recover at 37°C in 25 ml of supplemented RPMI 1640 for approximately 48 h. These cells were then pelleted, washed twice with PBS solution, and resuspended in 100 µl of passive lysis buffer (Promega). The firefly and Renilla luciferase activities in the cell lysates were quantitated using Promega’s Dual Luciferase Assay System on a Femtomaster FB12 luminometer (Zylux). Results were normalized to the Renilla luciferase activity. All transfections were performed at least six times using two different plasmid preparations. In the cotransfection assays, either 5 µg of the I{kappa}B{alpha}-SR expression vector or an empty expression vector was included with 10 µg of the reporter construct and 0.1 µg of pRL-TK. Transfected cells were incubated for 48 h before analysis. For transfection of the episomal vectors, the same conditions were used except that 10 µg of the reporter construct and 5 µg of the episomal Renilla vector were used for each transfection. Hygromycin was added to a final concentration of 400 µg/ml 24 h after transfection. The cells were allowed to recover for 3–6 days and then assayed for luciferase activity as described previously.

EMSA.
The double-stranded oligonucleotides of the HS4 NF-{kappa}B binding site and the consensus NF-{kappa}B binding site have been described previously (41) . The oligonucleotides of the HS4 Sp1 binding sites and the HS1,2 NF-{kappa}B binding site are listed below with mutated bases in bold type(the noncoding sequences are shown 3' to 5'): HS4 5' Sp1, CTGGGGGAGGTTGGCCCTGGATCAG and GACCCCCTCCAACCGGGACCTAGTC; HS4 mut 5' Sp1, CTGGGACGGGTTGGCCCTGGATCAG and GACCCTGCCCAACCGGGACCTAGTC; HS4 3' Sp1, GTGGAATACACCCCAAAG and CACCTTATGTGGGGTTTC; HS4 mut 3' Sp1, GTCCTATACACCCCAAAG and CAGGATATGTGGGGTTTC; HS1,2 NF-{kappa}B, ATGCTGGGAGTCCCCCATCCCCAAG and TACGACCCTCAGGGGGTAGGGGTTC; and HS1,2 mut NF-{kappa}B, ATGCTGGGAGTCGAGCATCCCCAAGGGAC and TACGACCCTCAGCTCGTAGGGGTTCCCTG. The oligonucleotides were synthesized with 5' overhangs, annealed, and labeled with [{alpha}-32P]dCTP using Klenow polymerase. The binding conditions have been described previously (42 , 43) . For DNA competition experiments, a 100-fold molar excess of unlabeled oligonucleotide was added before the 20-min room temperature incubation with nuclear extract and labeled probe. For the supershift experiments, 4 µg of antibody were added to the completed binding reaction, and this was incubated for 1 h at 4°C. All antibodies were acquired from Santa Cruz Biotechnology. Electrophoresis was performed in a 0.5x Tris borate-EDTA 5% polyacrylamide gel at 20 mA and 4°C.

ChIP Assay.
The ChIP assay was performed as outlined previously (12) . For PCR amplification, the following oligonucleotide sequences from the human IgH locus were used as primers: HS4 NF-{kappa}B and 5' Sp1 sense, CAGGCACAAACACATTCTTGCA; HS4 NF-{kappa}B and 5' Sp1 antisense, GAATAGTCAGGAATCCTGCAAAC; HS4 3' Sp1 sense, GCAGGATTCCTGACTATTCACAC; HS4 3' Sp1 antisense, CAGATCTTCTCCTAGCAGGGTC; HS1,2 NF-{kappa}B sense, CATGGCAGGACCCACTTTCCTCAC; and HS1,2 NF-{kappa}B antisense, TCGGGCCTCAGGGCTCTGCATC. Amplification of the HS4 NF-{kappa}B and 5' Sp1 immunoprecipitated samples required 34 cycles and an annealing temperature of 55°C. For amplification of the HS4 3' Sp1 ChIP samples, 44 cycles and an annealing temperature of 65°C were used. Amplification of the HS1,2 NF-{kappa}B site required 32 cycles and a 60°C annealing temperature. PCR products were resolved on 2% agarose gels and visualized by ethidium bromide staining.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Increased bcl-2 Promoter Activity with the Immunoglobulin Heavy Chain Gene 3' Enhancers.
The activity of the IgH 3' enhancers is believed to contribute to bcl-2 deregulation in t(14;18) lymphomas. To determine which enhancer regions activate the bcl-2 promoter, we created a series of reporter constructs containing the bcl-2 promoter with the luciferase reporter gene and different combinations of the IgH 3' enhancers. A schematic diagram of the IgH enhancer regions that were cloned is shown in Fig. 1ACitation , and the different reporter constructs are illustrated in Fig. 1BCitation . DNase I-hypersensitive regions 1 and 2 were amplified and cloned together due to their close proximity to each other. As shown in Fig. 1CCitation , each enhancer region alone showed some positive regulatory activity with the bcl-2 promoter. HS4 demonstrated the strongest contribution with a 6-fold increase in promoter activity, whereas the HS1,2 region increased promoter activity by 2.6-fold, and HS3 alone displayed only a 1.8-fold increase. Additionally, combinations of the enhancer regions exhibited additive effects. The combination of HS1,2 and 4 (HS124) increased bcl-2 promoter activity by 8.8-fold, and all four enhancer regions (HS1234) resulted in a 10-fold increase in bcl-2 promoter activity.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Increased bcl-2 promoter activity in the presence of immunoglobulin heavy chain enhancers. A, schematic diagram of the immunoglobulin heavy chain region and the DNase I-hypersensitive regions. There are four tissue- and cell-specific DNase I-hypersensitive sites, HS1–HS4. HS1 and HS2 are located close together and were amplified as one sequence. B, illustration of the bcl-2 promoter-luciferase reporter constructs with cloned IgH 3' DNase I-hypersensitive regions. C, results from transient transfections of DHL-4 cells with the bcl-2 promoter-luciferase-enhancer reporter constructs. Luciferase activity was normalized to the activity of the construct containing the bcl-2 promoter without any enhancers. The activity of that construct was given a value of 100, and the activity of all other transfections was plotted relative to that value.

 
Identification of the Active Regions of HS4.
Enhancer HS4 was the most active one with the bcl-2 promoter. To locate the elements that contributed to this activity, we first constructed a series of 5' deletions of the HS4 region as shown in Fig. 2ACitation . Results from transfections of DHL-4 cells with reporter constructs containing these deletions showed a sharp drop in activity between HS4 bases 652 and 663 (Fig. 2B)Citation . Analysis of this region revealed a NF-{kappa}B binding site that was described in other studies examining IgH gene expression (33) and c-myc deregulation in t(8;14) lymphomas (41) .



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Identification of the active regions in HS4 with the bcl-2 promoter. A, diagram of the HS4 5' deletion constructs with the location of the NF-{kappa}B site indicated. B, results of transient transfection analysis with the bcl-2 promoter and the 5' deletions of HS4 in DHL-4 cells. The activity of the bcl-2 promoter with all four enhancer regions (HS1–HS4) was assigned a value of 100, and the activity from the other transfections was plotted relative to that value. C, diagram of the HS4 3' deletion constructs with the location of the Sp1 and NF-{kappa}B sites indicated. D, results of transient transfection analysis of the 3' deletions of HS4 and the bcl-2 promoter.

 
To further identify elements that could not be distinguished through the 5' deletions, we also constructed a number of HS4 deletions starting from the 3' end (Fig. 2C)Citation . Transfection of these reporter constructs into DHL-4 cells resulted in the identification of two new positive regulatory regions (Fig. 2D)Citation . The first region was just 3' of the NF-{kappa}B binding site between bases 729 and 770 and contained a weak Sp1 consensus sequence. The second region was at the very 3' end of the HS4 sequence between bases 1067 and 1083. This site had little resemblance to known transcription factor binding sites, although there was some homology to a Rel consensus sequence. Neither region had been described in previous studies of IgH gene regulation, yet both appeared to contribute to bcl-2 activation in t(14;18) lymphoma cells.

NF-{kappa}B and Sp1 Interact with Sequences in HS4 in Vitro.
To determine whether NF-{kappa}B family members interacted with HS4 in DHL-4 cells, we used DHL-4 nuclear extract with a sequence representing the NF-{kappa}B binding site for EMSA. As shown in Fig. 3ACitation , Lane 1, a specific complex was observed with the HS4 NF-{kappa}B binding site in vitro. This complex could be competed with a 100-fold molar excess of the wild-type competitor or a NF-{kappa}B consensus sequence (Fig. 3ACitation , Lanes 2 and 4), but little competition was observed with the addition of a 100-fold molar excess of a sequence containing a mutation to the NF-{kappa}B site or a nonspecific sequence (Fig. 3ACitation , Lanes 3 and 5). The addition of antibodies specific for NF-{kappa}B family members p50, p52, RelA, c-Rel, and RelB all resulted in a supershifts or diminishment of the specific complex, therefore indicating the presence of these proteins in the complex with the HS4 NF-{kappa}B binding site (Fig. 3ACitation , Lanes 6–10).



View larger version (71K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. In vitro protein binding analysis of regulatory elements in the HS4 region. A, EMSA of the HS4 NF-{kappa}B site with DHL-4 nuclear extract. Lane 1 contains no competitor; Lanes 2–5 contain a 100-fold excess of cold HS4 NF-{kappa}B site (WT), mutated HS4 NF-{kappa}B site (Mut), a NF-{kappa}B consensus site, and a nonspecific sequence (NS), respectively; Lanes 6–11 contain antibodies for p50, p52, RelA, c-Rel, RelB, or a non-transcription factor protein ({alpha}NS), respectively. B, EMSA of the HS4 5' Sp1 site. Lane 1 contains no competitor; Lanes 2–4 contain a 100-fold molar excess of cold HS4 5' Sp1 site (WT), mutated Sp1 site (Mut), and a nonspecific sequence (NS), respectively; Lanes 5 and 6 contain antibodies against Sp1 or a non-transcription factor protein, respectively. C, EMSA of the HS4 3' Sp1 site. Lane 1 contains no competitor; Lanes 2–4 contain a 100-fold molar excess of cold HS4 3' Sp1 site (WT), mutated Sp1 site (Mut), and a nonspecific sequence (NS), respectively; Lanes 5 and 6 contain antibodies against Sp1 or a non-transcription factor protein, respectively.

 
From the 3' deletion analysis of HS4, two positive regulatory regions were identified. The 5' region contained a weak consensus sequence for a Sp1 binding site. To assess specific protein interaction with this sequence, a labeled double-stranded oligonucleotide was incubated with DHL-4 nuclear extract. As shown in Fig. 3BCitation , complex formation with the labeled probe was observed, and the complexes could be competed with a 100-fold molar excess of unlabeled wild-type competitor, but not with a 100-fold molar excess of a sequence containing a mutation to the Sp1 binding site or with a nonspecific sequence (Fig. 3BCitation , Lanes 1–4). The addition of an antibody specific for Sp1 resulted in a supershift, indicating the presence of Sp1 in these complexes, whereas no change in complex formation was observed with the addition of an antibody specific for a non-transcription factor protein (Fig. 3BCitation , Lanes 5 and 6).

Although the second positive regulatory region identified through 3' deletion analysis of HS4 most closely resembled a Rel binding site, EMSA results indicated that the Rel and NF-{kappa}B family members did not interact with this site (data not shown). However, we found that specific complexes formed with this region with DHL-4 nuclear extract in EMSA (Fig. 3CCitation , Lane 1). These complexes were competed with a 100-fold molar excess of unlabeled wild-type sequence (Fig. 3CCitation , Lane 2). Closer examination of the sequence revealed a slight similarity to the Sp1 site described above, and when a similar mutation was made in this region, the mutated sequence failed to compete for the specific complexes, as did a nonspecific sequence (Fig. 3CCitation , Lanes 3 and 4). In addition, incubation with a Sp1 antibody resulted in a supershift, which was not observed upon incubation with a nonspecific antibody (Fig. 3Citation C, Lanes 5 and 6). We therefore concluded that Sp1 interacted with this region of HS4 as well.

In Vivo Analysis of NF-{kappa}B and Sp1 Interaction with HS4 in t(14;18) Cells.
Although we observed NF-{kappa}B family members interacting with the HS4 sequence in vitro, we wished to determine whether a similar observation could be made in vivo. Using the ChIP assay as described by Boyd and Farnham (44) , chromatin isolated from formaldehyde-treated DHL-4 cells was subjected to immunoprecipitation reactions using antibodies specific for the NF-{kappa}B family members p50, p52, c-Rel, RelA, and RelB. An anti-IgG antibody was used as a nonspecific control. The precipitated DNA was subjected to PCR amplification using primers specific for the human IgH HS4 region containing the NF-{kappa}B binding site. As shown in Fig. 4ACitation , these primers produced a 174-bp amplicon that could be observed with the positive control (total chromatin) and when the chromatin was precipitated with antibodies specific for p50, c-Rel, RelA, and RelB. Use of the p52 antibody resulted in a very weak positive signal, whereas no amplification was observed with three negative controls (no chromatin, no antibody, and {alpha}IgG; Fig. 4ACitation ). Due to the close proximity of the NF-{kappa}B site to the 5' Sp1 site, the same primers were used to analyze Sp1 binding to this region of HS4. Use of a Sp1 antibody in the immunoprecipitation reaction resulted in the isolation of the same region of HS4, indicating the in vivo interaction with Sp1. A different set of primers was used to analyze for in vivo Sp1 binding to the region of HS4 encompassing the 3' Sp1 site. As shown in Fig. 4CCitation , the Sp1 antibody could precipitate a sequence that could be PCR-amplified using this second set of primers. Due to the close proximity of the two Sp1 sites, the ChIP assay does not allow us to distinguish between occupancy at one site or the other. Although the results of these assays do not establish the exact binding sites of either NF-{kappa}B or Sp1, they do demonstrate the in vivo interaction of the NF-{kappa}B and Sp1 transcription factors with these regions of the human IgH HS4 sequence in t(14;18) cells.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. NF-{kappa}B and Sp1 interact with the human IgH HS4 enhancer in vivo. A, ChIP analysis of the HS4 NF-{kappa}B site in DHL-4 cells. The cross-linked chromatin was precipitated with specific antibodies as indicated. The positive control is represented by the total input fraction. Negative controls included a no chromatin sample, no antibody sample, and nonspecific antibody ({alpha}IgG). Precipitated DNA was analyzed by PCR using primers that amplified a 174-bp region that included the NF-{kappa}B site. B, ChIP analysis of the HS4 5' Sp1 site. The same primer set that was used in A was used to amplify the 174-bp region that included the 5' Sp1 site. C, ChIP analysis of the HS4 3' Sp1 site. The PCR primers amplified a 183-bp sequence that included the 3' Sp1 site.

 
Deletion Analysis of HS1,2.
The other region of the IgH enhancer that contributed the most positive regulatory activity to the bcl-2 promoter was HS1,2. To identify the elements mediating this activity, we constructed a series of 5' deletions of this region (Fig. 5A)Citation . Transfection of these deletion constructs into DHL-4 cells resulted in the identification of one positive regulatory region between bases 800 and 811 in HS1,2 (Fig. 5B)Citation . Analysis of the sequence within this region showed that it contained a NF-{kappa}B binding site that has been described previously (32, 33, 34) . Although we also constructed a series of 3' deletions within HS1,2, transfection of these constructs did not reveal any other major positive regulatory regions (data not shown). We therefore concluded that the sequence containing the NF-{kappa}B binding site was the primary regulatory region of HS1,2 mediating positive activity on the bcl-2 promoter.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Identification of the active regions in HS1,2 with the bcl-2 promoter. A, diagram of the HS1,2 5' deletion constructs with the location of the NF-{kappa}B site indicated. B, results of transient transfection analysis with the bcl-2 promoter and the 5' deletions of HS1,2 in DHL-4 cells. The activity of the bcl-2 promoter with all four enhancer regions (HS1–HS4) was assigned a value of 100, and the activity from the other transfections was plotted relative to that value.

 
In Vitro and in Vivo Interaction of NF-{kappa}B with HS1,2 in t(14;18) Cells.
To identify which NF-{kappa}B family members interacted with the HS1,2 site in DHL-4 cells, we performed EMSA with a labeled probe containing the HS1,2 NF-{kappa}B binding site. From this analysis, we observed specific protein complex formation on this probe (Fig. 6Citation A, Lane 1). This complex could be competed with the addition of a 100-fold molar excess of unlabeled wild-type probe or a probe containing the NF-{kappa}B consensus sequence (Fig. 6Citation A, Lanes 2 and 4). However, the complex could not be competed with a 100-fold molar excess of a probe containing a mutation to the HS1,2 NF-{kappa}B binding site or with a nonspecific sequence (Fig. 6Citation A, Lanes 3 and 5). The addition of antibodies specific for NF-{kappa}B family members p50 and c-Rel resulted in supershifts of the complex, indicating the presence of these proteins in the complex (Fig. 6Citation A, Lanes 6 and 9).



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. In vitro and in vivo protein binding analysis of the HS1,2 active site. A, EMSA of the HS1,2 NF-{kappa}B site. Lane 1 contains no competitor; Lanes 2–5 contain a 100-fold molar excess of cold HS1,2 NF-{kappa}B site (WT), mutated NF-{kappa}B site (Mut), a NF-{kappa}B consensus sequence, and a nonspecific sequence (NS), respectively; Lanes 6–12 contain antibodies to p50, p52, RelA, c-Rel, RelB, Sp1, and a non-transcription factor protein ({alpha}NS), respectively. B, ChIP analysis of the human IgH HS1,2 NF-{kappa}B site. Cross-linked chromatin was fractionated using the indicated specific antibodies. The PCR primers amplified a 181-bp sequence that included the NF-{kappa}B site.

 
To determine whether the same proteins interacted with the human IgH HS1,2 sequence in vivo, we performed a ChIP assay using primers that would specifically amplify the HS1,2 region encompassing the corresponding NF-{kappa}B binding site. The primers produced a 181-bp amplicon that could be observed with the positive control (total chromatin), but not with the three negative controls (no chromatin, no antibody, and {alpha}IgG; Fig. 6BCitation ). However, immunoprecipitation using antibodies specific for p50, p52, c-Rel, RelA, and RelB all resulted in the isolation of the sequence containing the HS1,2 NF-{kappa}B binding site (Fig. 6B)Citation . From these data, we concluded that NF-{kappa}B interacted with the HS1,2 sequence in DHL-4 cells.

Functional Analyses of the HS1,2 and HS4 NF-{kappa}B and Sp1 Binding Sites.
To determine the relevance of the NF-{kappa}B and Sp1 binding sites in the HS4 region to bcl-2 promoter activity, mutations were created within those sites in separate reporter constructs, and all three sites were mutated in a single construct (Fig. 7A)Citation . As shown in Fig. 7BCitation , mutation of the HS4 NF-{kappa}B site reduced bcl-2 promoter activity by 62%. Mutation of the 3' Sp1 site resulted in a 49% decrease in bcl-2 promoter activity, whereas mutation of the 5' Sp1 site resulted in a 25% decrease in activity. A construct containing mutations to all three regulatory sites in HS4 exhibited only 30% promoter activity compared with the wild-type construct. This was essentially the same as the activity of a construct that contained only HS1,2 and HS3, suggesting that the NF-{kappa}B and two Sp1 sites were the critical elements mediating bcl-2 deregulation by HS4. Similar functional analysis was performed with the HS1,2 NF-{kappa}B binding site (Fig. 7A)Citation . The mutation of this site resulted in a 30% decrease in promoter activity as compared with the wild-type enhancer sequence (Fig. 7C)Citation . By replacing the wild-type HS1,2 and HS4 sequences with the mutated sequences, bcl-2 promoter activity was reduced to 26% (Fig. 7C)Citation . This was similar to the activity of a construct containing the bcl-2 promoter with only the HS3 enhancer region (Fig. 7C)Citation . To further verify the importance of NF-{kappa}B in mediating bcl-2 deregulation in t(14;18) cells, the HS1234 construct was cotransfected with an expression vector containing the cDNA for the I{kappa}B{alpha} super-repressor. This expression vector, which produces a mutant I{kappa}B{alpha} protein that retains the NF-{kappa}B p50/p65 heterodimer in the cytoplasm, was able to reduce the activity of the IgH enhancer-bcl-2 promoter construct by 60% (Fig. 7C)Citation . This was greater than the decrease in activity we had observed previously with constructs containing only the bcl-2 promoter (12) , indicating that NF-{kappa}B most likely acts through the IgH 3' enhancer sequences as well as through the promoter. However, the decrease in activity induced by I{kappa}B{alpha}-SR was not as great as that observed with the construct containing mutations to the HS1,2 and HS4 NF-{kappa}B and Sp1 sites (mHS1,2+mHS4), supporting the importance of the two HS4 Sp1 sites.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Functional analyses of the HS4 NF-{kappa}B and Sp1 sites and the HS1,2 NF-{kappa}B site. A, diagram of the bcl-2 promoter-IgH enhancer constructs with the mutated sites indicated. B, results from transient transfections of DHL-4 cells with reporter constructs containing mutations to the regulatory elements within the HS4 enhancer. The activity of the bcl-2 promoter with all four enhancer regions (HS1–HS4) was assigned a value of 100, and the activity from the other transfections was plotted relative to that value. C, DHL-4 transient transfection results from a reporter construct containing a mutation to the HS1,2 NF-{kappa}B binding site with the wild-type sequences of HS3 and HS4 (HS12 mNF-{kappa}B) or with wild-type HS3 and mutated HS4 sequences (mHS12+mHS4). The mutant HS4 sequence contained changes to the HS4 NF-{kappa}B and the two Sp1 binding sites. The activity of the mutant constructs was normalized to the activity of the wild-type construct (HS1234), which was assigned a value of 100. The HS1234 construct was also transfected with the I{kappa}B{alpha}-SR expression vector. The activity derived from this transfection was plotted relative to the activity of the HS1234 construct transfected with an empty expression vector, which was given a value of 100. D, luciferase activity of episomal reporter constructs transfected into DHL-4 cells. HS1,2 and HS4 sequences containing mutations to NF-{kappa}B and/or Sp1 sites were cloned into an episomal reporter vector. Transfected cells were treated with hygromycin 24 h after transfection, and selected cells were assayed for luciferase activity 4 days after transfection. The activities of the reporter constructs containing mutant enhancer sequences were normalized to the activity of the construct containing the wild-type sequence, which was designated as 100.

 
Other studies have shown that promoter activation and generation of DNase I hypersensitive regions may be dependent on the presence of chromatin (45 , 46) . To assess whether the activity observed from the transiently transfected mutant constructs was reflected by constructs capable of chromatin restructuring, the wild-type and mutated enhancer sequences were cloned into an episomal vector containing the EBNA-1 cDNA and the EBV origin of replication. Transfection of these constructs into DHL-4 cells resulted in bcl-2 promoter activities similar to those activities observed with the transient transfection assays (Fig. 7D)Citation , thereby supporting our observations from those results. The reduction in promoter activity induced by the mutations was somewhat less with the episomal vectors as compared with the transiently transfected vectors, indicating the possibility that other factors can mediate bcl-2 activation from the enhancer sequences. Nevertheless, the results obtained from both sets of constructs demonstrate that the NF-{kappa}B and Sp1 binding sites of HS1,2 and HS4 are important for bcl-2 up-regulation in t(14;18) cells in the presence and absence of organized chromatin.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although it has been assumed that the deregulated bcl-2 expression in t(14;18) cells is mediated in part by the immunoglobulin heavy chain gene regulatory region, this has not been demonstrated, nor was it known which elements of that region were responsible for the deregulation. In these studies, we found that the four DNase I-hypersensitive regions within the IgH 3' enhancer were able to activate the bcl-2 promoter in the t(14;18) cell line DHL-4. Of those four hypersensitive regions, we demonstrated that HS4 had the most influence on bcl-2 promoter activity. This is similar to the situation in pre-B and plasmacytoma cells, where HS4 is the most active enhancer region. We also showed that the HS1,2 region was capable of activating the promoter independently. By itself, HS3 increased bcl-2 promoter activity by only a minor amount. Other studies of HS3 have shown that it is contains elements that act as negative effectors of the IgH 3' enhancer (37) , and preliminary studies in our laboratory have confirmed this. However, it is possible that the HS3 region was not active in our model system or those used in other studies. It is also likely that there are regions of the IgH 3' enhancers other than the HS sequences that are capable of driving transcription. DNase I-hypersensitive regions are associated with an open chromatin structure and therefore chromatin remodeling factors, but there are other sequences that are active without the presence of such factors. Nonetheless, this is the first study to show specific elements in the HS1,2 and HS4 regions that are capable of mediating bcl-2 up-regulation.

Our analyses of the IgH 3' enhancers showed that NF-{kappa}B sites in HS1,2 and HS4 and two Sp1 sites in HS4 were largely responsible for the positive influence on the bcl-2 promoter. We demonstrated by EMSA the in vitro interaction of the NF-{kappa}B and Sp1 transcription factors with specific IgH 3' enhancer sequences and by ChIP assay the in vivo interaction of those factors with regions of the enhancers containing those sequences. The NF-{kappa}B and Sp1 elements are conserved in the human IgH enhancers as well as in the murine IgH enhancers, suggesting that they play important roles in the regulation of IgH gene expression. Whereas it has been established that the NF-{kappa}B sites are required for HS1,2 and HS4 enhancer activity on the {lambda}1 promoter during all stages of B-cell development, the two Sp1 sites we identified in this study have not been described previously. Our studies with chromatin templates showed that mutation of the NF-{kappa}B and Sp1 sites did not completely abolish the activation of the bcl-2 promoter, suggesting that there are chromatin-dependent elements within the IgH 3' enhancers that contribute to bcl-2 deregulation.

Although the NF-{kappa}B and Sp1 elements described in these studies appeared to be functional without chromatin formation in transient assays, it is likely that both are involved in coactivator recruitment and chromatin restructuring, along with basal transcription factor recruitment. In the HIV 5' long terminal repeat, both NF-{kappa}B and Sp1 binding are required to establish nuclease-hypersensitive sites and for chromatin remodeling in the enhancer (47 , 48) . Formation of these hypersensitive sites and nucleosome disruption are necessary for transcriptional activity mediated by the long terminal repeat. Another study of the tumor necrosis factor {alpha}-responsive A20 gene promoter has shown that Sp1 binding is required for constitutive association of the general transcription apparatus to the promoter and is also necessary for transcriptional induction by NF-{kappa}B (49) . Additionally, both factors are known to interact with coactivators that are responsible for changes in chromatin structure. For example, the cooperation of Sp1 with BRG1-containing SWI/SNF chromatin remodeling complexes can be essential for specific promoter activation (50, 51, 52) . Likewise, interaction of both Sp1 and RelA with the p300 histone acetyltransferase can result in gene activation (53 , 54) , whereas interaction of RelA or p50 with the histone deacetylase HDAC-1 leads to suppression of gene expression (55) . It will be interesting to elucidate in future studies possible coactivator associations as well as the exact mechanism of gene activation.

We have shown previously that NF-{kappa}B is constitutively active in t(14;18) cells and acts to up-regulate bcl-2 expression through CREB and Sp1 binding sites in the bcl-2 promoter, whereas the NF-{kappa}B inhibitor I{kappa}B{alpha}-SR can decrease endogenous bcl-2 expression (12) . Mutation of the CRE site in the bcl-2 promoter region decreased the activation of the bcl-2 promoter by the IgH enhancers (10) . In this study, we found that transfection of the I{kappa}B{alpha}-SR expression vector resulted in decreased activity of the IgH enhancer- bcl-2 reporter construct. Although it is difficult to assess whether this repression was mediated by sequences in the enhancer or in the promoter, the percentage decrease observed with the enhancer construct was greater than what we had previously observed when only the bcl-2 promoter was present. This suggests that NF-{kappa}B can activate bcl-2 through enhancer sequences as well. Given that nuclear levels of NF-{kappa}B are abnormally high in t(14;18) cells, whereas no difference has been observed with Sp1 expression (data not shown), it seems reasonable to expect that NF-{kappa}B may play a more significant role in bcl-2 deregulation. A number of therapies targeting NF-{kappa}B activity have recently been developed. The results we present here suggest that these therapies may be useful in the treatment of t(14;18) lymphomas.


    ACKNOWLEDGMENTS
 
We thank Kayoko Kanda for assistance in mutating the NF-{kappa}B sites and Minh Ho for preparation of nuclear extracts.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grant CA56764. Back

2 To whom requests for reprints should be addressed, at Hematology, CCSR 1155, 269 Campus Drive, Stanford University School of Medicine, Stanford, CA 94305-5156. Phone: (650) 849-0551; Fax: (650) 858-3982; E-mail: lboxer{at}stanford.edu Back

3 The abbreviations used are: CRE, cAMP-responsive element; CREB, CRE-binding protein; NF-{kappa}B, nuclear factor {kappa}B; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation assay. Back

Received 2/11/03. Revised 6/25/03. Accepted 7/30/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Cleary M. L., Smith S. D., Sklar J. Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell, 47: 19-28, 1986.[Medline]
  2. Tsujimoto Y., Croce C. Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc. Natl. Acad. Sci. USA, 83: 5214-5218, 1986.[Abstract/Free Full Text]
  3. Tsujimoto Y., Gorham J., Cossman J., Jaffe E., Croce C. M. The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. Science (Wash. DC), 229: 1390-1393, 1985.[Abstract/Free Full Text]
  4. Hockenberry D., Nunez G., Milliman C., Schreiber R. D., Korsmeyer S. J. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature (Lond.), 348: 334-336, 1990.[Medline]
  5. Vaux D. L., Cory S., Adams J. M. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature (Lond.), 335: 440-442, 1988.[Medline]
  6. Desoize B. Anticancer drug resistance and inhibition of apoptosis. Anticancer Res., 14: 2291-2294, 1994.[Medline]
  7. Reed J. C., Kitada S., Takayama S., Miyashita T. Regulation of chemoresistance by the bcl-2 oncoprotein in non-Hodgkin’s lymphoma and lymphocytic leukemia cell lines. Ann. Oncol., 5(Suppl.1): S61-S65, 1994.
  8. Schmitt C. A., Lowe S. W. Bcl-2 mediates chemoresistance in matched pairs of primary Eµ-myc lymphomas in vivo. Blood Cells Mol. Dis., 27: 206-216, 2001.[Medline]
  9. Schmitt C. A., Rosenthal C. T., Lowe S. W. Genetic analysis of chemoresistance in primary murine lymphomas. Nat. Med., 6: 1029-1035, 2000.[Medline]
  10. Ji L., Mochon E., Arcinas M., Boxer L. M. CREB proteins function as positive regulators of the translocated bcl-2 allele in t(14;18) lymphomas. J. Biol. Chem., 271: 22687-22691, 1996.[Abstract/Free Full Text]
  11. Wilson B. E., Mochon E., Boxer L. M. Induction of bcl-2 expression by phosphorylated CREB proteins during B-cell activation and rescue from apoptosis. Mol. Cell. Biol., 16: 5546-5556, 1996.[Abstract]
  12. Heckman C. A., Mehew J. W., Boxer L. M. NF-{kappa}B activates bcl-2 expression in t(14;18) lymphoma cells. Oncogene, 21: 3898-3908, 2002.[Medline]
  13. Riccio A., Ahn S., Davenport C. M., Blendy J. A., Ginty D. D. Mediation by a CREB family transcription factor of NGF-dependent survival of sympathetic neurons. Science (Wash. DC), 286: 2358-2361, 1999.[Abstract/Free Full Text]
  14. Huang H., Cheville J. C., Pan Y., Roche P. C., Schmidt L. J., Tindall D. J. PTEN induces chemosensitivity in PTEN-mutated prostate cancer cells by suppression of bcl-2 expression. J. Biol. Chem., 276: 38830-38836, 2001.[Abstract/Free Full Text]
  15. Mehrhof F. B., Muller F. U., Bergmann M. W., Li P., Wang Y., Schmitz W., Dietz R., von Harsdorf R. In cardiomyocyte hypoxia, insulin-like growth factor-I-induced antiapoptotic signaling requires phosphatidylinositol-3-OH-kinase-dependent and mitogen-activated protein kinase-dependent activation of the transcription factor cAMP response element-binding protein. Circulation, 104: 2088-2094, 2001.[Abstract/Free Full Text]
  16. Dong L., Wang W., Wang F., Stoner M., Reed J. C., Harigai M., Samudio I., Kladde M. P., Vyhlidal C., Safe S. Mechanisms of transcriptional activation of bcl-2 gene expression by 17ß-estradiol in breast cancer cells. J. Biol. Chem., 274: 32099-32107, 1999.[Abstract/Free Full Text]
  17. Pugazhenthi S., Miller E., Sable C., Heidenreich K. A., Boxer L. M., Reusch J. E. B. Insulin-like growth factor induces bcl-2 promoter through the transcription factor cAMP-response element-bindng protein. J. Biol. Chem., 274: 27529-27535, 1999.[Abstract/Free Full Text]
  18. Pugazhenthi S., Nesterova A., Sable C., Heidenreich K. A., Boxer L. M., Heasley L. E., Reusch J. E. B. Akt/protein kinase B up-regulates bcl-2 expression through cAMP-response element-binding protein. J. Biol. Chem., 275: 10761-10766, 2000.[Abstract/Free Full Text]
  19. Heckman C., Mochon E., Arcinas M., Boxer L. M. The WT1 protein is a negative regulator of the normal bcl-2 allele in t(14;18) lymphomas. J. Biol. Chem., 272: 19609-19614, 1997.[Abstract/Free Full Text]
  20. Hewitt S. M., Hamada S., McDonnell T. J., Rauscher F. J. I., Saunders G. F. Regulation of the proto-oncogenes bcl-2 and c-myc by the Wilms’ tumor suppressor gene, WT1.. Cancer Res., 55: 5386-5389, 1995.[Abstract/Free Full Text]
  21. Mayo M. W., Wang C. Y., Drouin S. S., Madrid L. V., Marshall A. F., Reed J. C., Weissman B. E., Baldwin A. S. WT1 modulates apoptosis by transcriptionally upregulating the bcl-2 proto-oncogene. EMBO J., 18: 3990-4003, 1999.[Medline]
  22. Arulampalam V., Eckhardt L., Pettersson S. The enhancer shift: a model to explain the developmental control of IgH gene expression in B-lineage cells. Immunol. Today, 18: 549-554, 1997.[Medline]
  23. Madisen L., Groudine M. Identification of a locus control region in the immunoglobulin heavy-chain locus that deregulates c-myc expression in plasmacytoma and Burkitt’s lymphoma cells. Genes Dev., 8: 2212-2226, 1994.[Abstract/Free Full Text]
  24. Michaelson J. S., Giannini S. L., Birshtein B. K. Identification of 3'{alpha}-hs4, a novel Ig heavy chain enhancer element regulated at multiple stages of B cell differentiation. Nucleic Acids Res., 23: 975-981, 1995.[Abstract/Free Full Text]
  25. Pettersson S., Cook G. P., Bruggemann M., Williams G. T., Neuberger M. S. A second B cell-specific enhancer 3' of the immunoglobulin heavy chain locus. Nature (Lond.), 344: 165-168, 1990.[Medline]
  26. Saleque S., Singh M., Litter R. D., Giannini S. L., Michaelson J. S., Birshtein B. K. Dyad symmetry within the mouse 3' IgH regulatory region includes two virtually identical enhancers (C {alpha}3'E and hs3). J. Immunol., 158: 4780-4787, 1997.[Abstract]
  27. Chauveau C., Pinaud E., Cogne M. Synergies between regulatory elements of the immunoglobulin heavy chain locus and its palindromic 3' locus control region. Eur. J. Immunol., 28: 3048-3056, 1998.[Medline]
  28. Ong J., Stevens S., Roeder R. G., Eckhardt L. A. 3' Immunoglobulin heavy chain enhancer elements shift synergistic interactions during B cell development. J. Immunol., 160: 4896-4903, 1998.[Abstract/Free Full Text]
  29. Chen C., Birshtein B. K. Virtually identical enhancers containing a segment of homology to murine 3' IgH-E(hs1,2) lie downstream of human Ig C{alpha}1 and C{alpha}2 genes. J. Immunol., 159: 1310-1318, 1997.[Abstract]
  30. Mills F., Harindranath N., Mitchell M., Max E. Enhancer complexes located downstream of both human immunoglobulin C {alpha} genes. J. Exp. Med., 186: 845-858, 1997.[Abstract/Free Full Text]
  31. Pinaud E., Aupetit C., Chauveau C., Cogne M. Identification of a homolog of the C{alpha}3'/hs3 enhancer and of an allelic variant of the 3'IgH/hs1,2 enhancer downstream of the human immunoglobulin {alpha}1 gene. Eur. J. Immunol., 27: 2981-2985, 1997.[Medline]
  32. Laurencikiene J., Deveikaite V., Severinson E. HS1,2 enhancer regulation of germline {epsilon} and {gamma}2b promoters in murine B lymphocytes: evidence for specific promoter-enhancer interactions. J. Immunol., 167: 3257-3265, 2001.[Abstract/Free Full Text]
  33. Michaelson J. S., Singh M., Snapper C. M., Sha W. C., Baltimore D., Birshtein B. K. Regulation of 3' IgH enhancers by a common set of factors, including {kappa}B-binding proteins. J. Immunol., 156: 2828-2839, 1996.[Abstract]
  34. Zelazowski P., Shen H., Snapper C. M. NF-kB/p50 and NF-kB/c-Rel differentially regulate the activity of the 3'{alpha}E-hs1,2 enhancer in normal murine B cells in an activation-dependent manner. Int. Immunol., 12: 1167-1172, 2000.[Abstract/Free Full Text]
  35. Singh M., Birshtein B. K. NF-HB (BSAP) is a repressor of the murine immunoglobulin heavy-chain 3'{alpha} enhancer at early stages of B-cell differentiation. Mol. Cell. Biol., 13: 3611-3622, 1993.[Abstract/Free Full Text]
  36. Singh M., Birshtein B. K. Concerted repression of an immunoglobulin heavy-chain enhancer, 3'{alpha}E(hs1,2). Proc. Natl. Acad. Sci. USA, 93: 4392-4397, 1996.[Abstract/Free Full Text]
  37. Muto A., Hoshino H., Madisen L., Yanai N., Obinata M., Karasuyama H., Hayashi N., Nakauchi H., Yamamoto M., Groudine M., Igarashi K. Identification of Bach2 as a B-cell-specific partner for small Maf proteins that negatively regulate the immunoglobulin heavy chain gene 3' enhancer. EMBO J., 17: 5734-5743, 1998.[Medline]
  38. Grant P. A., Thompson C. B., Pettersson S. IgM receptor-mediated transactivation of the IgH 3' enhancer couples a novel Elf-1-AP-1 protein complex to the developmental control of enhancer function. EMBO J., 14: 4501-4513, 1995.[Medline]
  39. Grant P. A., Arulampalam V., Ahrlund-Richter L., Pettersson S. Identification of Ets-like lymphoid specific elements within the immunoglobulin heavy chain 3' enhancer. Nucleic Acids Res., 20: 4401-4408, 1992.[Abstract/Free Full Text]
  40. Linderson Y., Cross D., Neurath M. F., Pettersson S. NFE, a new transcriptional activator that facilitates p50 and c-Rel-dependent IgH 3' enhancer activity. Eur. J. Immunol., 27: 468-475, 1997.[Medline]
  41. Kanda K., Hu H-M., Zhang L., Grandchamps J., Boxer L. M. NF-{kappa}B activity is required for the deregulation of c-myc expression by the immunoglobulin heavy chain enhancer. J. Biol. Chem., 275: 32338-32346, 2000.[Abstract/Free Full Text]
  42. Ji L., Arcinas M., Boxer L. M. NF-{kappa}B sites function as positive regulators of expression of the translocated c-myc allele in Burkitt’s lymphoma. Mol. Cell. Biol., 14: 7967-7974, 1994.[Abstract/Free Full Text]
  43. Phan S. C., Feeley B., Withers D., Boxer L. M. Identification of an inducible regulator of c-myb expression during T- cell activation. Mol. Cell. Biol., 16: 2387-2393, 1996.[Abstract]
  44. Boyd K. E., Farnham P. J. Coexamination of site-specific transcription factor binding and promoter activity in living cells. Mol. Cell. Biol., 19: 8393-8399, 1999.[Abstract/Free Full Text]
  45. Armstrong J. A., Bieker J. J., Emerson B. M. A SWI/SNF-related chromatin remodeling complex, E-RC1, is required for tissue-specific transcriptional regulation by EKLF in vitro. Cell, 95: 93-104, 1998.[Medline]
  46. Liu R., Liu H., Chen X., Kirby M., Brown P. O., Zhao K. Regulation of CSF1 promoter by the SWI/SNF-like BAF complex. Cell, 106: 309-318, 2001.[Medline]
  47. Pazin M. J., Sheridan P. L., Cannon K., Cao Z., Keck J. G., Kadanaga J. T., Jones K. A. NF-{kappa}B-mediated chromatin reconfiguration and transcriptional activation of the HIV-1 enhancer in vitro. Genes Dev., 10: 37-49, 1996.[Abstract/Free Full Text]
  48. Widlak P., Gaynor R. B., Garrard W. T. In vitro chromatin assembly of the HIV-1 promoter.ATP-dependent polar repositioning of nucleosomes by Sp1 and NF-{kappa}B. J. Biol. Chem., 272: 17654-17661, 1997.[Abstract/Free Full Text]
  49. Ainbinder E., Revach M., Wolstein O., Moshonov S., Diamant N., Dikstein R. Mechanism of rapid transcriptional induction of tumor necrosis factor {alpha}-responsive genes by NF-{kappa}B. Mol. Cell. Biol., 22: 6354-6362, 2002.[Abstract/Free Full Text]
  50. Kadam S., McAlpine G. S., Phelan M. L., Kingston R. E., Jones K. A., Emerson B. M. Functional selectivity of recombinant mammalian SWI/SNF subunits. Genes Dev., 14: 2441-2451, 2000.[Abstract/Free Full Text]
  51. Liu H., Kang H., Liu R., Chen X., Zhao K. Maximal induction of a subset of interferon target genes requires the chromatin-remodeling activity of the BAF complex. Mol. Cell. Biol., 22: 6471-6479, 2002.[Abstract/Free Full Text]
  52. Kadam S., Emerson B. M. Transcriptional specificity of human SWI/SNF BRG1 and BRM chromatin remodeling complexes. Mol. Cell, 11: 377-389, 2003.[Medline]
  53. Gerritsen M. E., Williams A. J., Neish A. S., Moore S., Shi Y., Collins T. CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. Sci. USA, 94: 2927-2932, 1997.[Abstract/Free Full Text]
  54. Kundu T. K., Palhan V. B., Wang Z., An W., Cole P. A., Roeder R. G. Activator-dependent transcription from chromatin in vitro involving targeted histone acetylation by p300. Mol. Cell, 6: 551-561, 2000.[Medline]
  55. Zhong H., May M. J., Jimi E., Ghosh S. The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/p300 or HDAC-1. Mol. Cell, 9: 625-636, 2002.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. M. Souto-Carneiro, R. Fritsch, N. Sepulveda, M. J. Lagareiro, N. Morgado, N. S. Longo, and P. E. Lipsky
The NF-{kappa}B Canonical Pathway Is Involved in the Control of the Exonucleolytic Processing of Coding Ends during V(D)J Recombination
J. Immunol., January 15, 2008; 180(2): 1040 - 1049.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T.-Y. Yeh, J.-Z. Chuang, and C.-H. Sung
Dynein light chain rp3 acts as a nuclear matrix-associated transcriptional modulator in a dynein-independent pathway
J. Cell Sci., August 1, 2005; 118(15): 3431 - 3443.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Duan, C. A. Heckman, and L. M. Boxer
Histone Deacetylase Inhibitors Down-Regulate bcl-2 Expression and Induce Apoptosis in t(14;18) Lymphomas
Mol. Cell. Biol., March 1, 2005; 25(5): 1608 - 1619.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heckman, C. A.
Right arrow Articles by Boxer, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heckman, C. A.
Right arrow Articles by Boxer, L. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online