| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Tumor Virology, Institute for Genetic Medicine, Hokkaido University, Sapporo 060-0815 [D. I., K. T.], and Center for Chronic Viral Diseases, Kagoshima University, Kagoshima 890-8520 [Y. E., M. T.], Japan
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
GC cells express a limited number of EBV genomes (4) , similar to those in Burkitts lymphoma, which are EBNA1, small nonpolyadenylated RNA known as EBER, and the transcripts from the BamHI-A region (BARF0). In addition, LMP2A is weakly positive in some GC cases. This is different from the pattern in nasopharyngeal carcinoma in which LMP1 is also expressed in carcinoma cells in about half of the patients (1) . Concerning the effects of EBV products on epithelial cells, LMP1 has some pleiotropic biological activities (5, 6, 7) , but other gene products do not. We generated recently EBV recombinants with a selectable marker, which makes it possible to select EBV-infected cells even when the efficiency of infection is low or the EBV-uninfected population in culture is able to proliferate (8) . Using the recombinant virus, we found that various carcinoma cell lines can be infected with EBV (9, 10, 11) and that their virus convertants consistently express a limited number of EBV latent genes, as EBV-positive GC cells do, thus indicating that the system could be a model for EBV oncogenesis. Using this system, we demonstrated that EBV promotes gastric epithelial cell growth in the absence of EBNA2 and LMP1 expression (11) .
Here we report that EBV infection induces expression of IGF-I (12
, 13)
in the GC-derived EBV-negative cell line NU-GC-3 (14)
and that the secreted IGF-I acts as an autocrine growth factor. Transfection of individual EBV latent genes into NU-GC-3 cells revealed that the EBER was responsible for IGF-I expression. EBER is
170 nucleotides long and is the most abundant EBV RNA expressed in all of the EBV-associated malignancies (15)
. The present findings suggest that small RNA molecules directly affect the pathogenesis of EBV-positive GC.
| Materials and Methods |
|---|
|
|
|---|
Establishment of EBV-infected NU-GC-3 Cells.
NU-GC-3 cells were infected with rEBV (containing the Neor gene described above) using a "cell-to-cell" infection procedure as described previously (10)
. Cells were maintained in culture medium containing G418 (500 µg/ml).
Immunofluorescence.
Expression of EBNA was examined on acetone:methanol (1:1) -fixed cells by anticomplement immunofluorescence with reference human serum (titer, x640).
Immunoblot Analysis.
Cell lysates were resolved by 8% SDS-PAGE. For protein detection, membranes were probed with anti-LMP1 monoclonal antibody S-12 (kindly provided by Elliott Kieff, Harvard Medical School, Boston, MA) or human serum followed by antimouse or antihuman horseradish peroxidase-conjugated IgG. Membranes were visualized with an ECL Western blotting kit (Amersham Bioscience Corp., Piscataway, NJ).
RT-PCR Analysis.
cDNA aliquots were then subjected to PCR analyses using primer pairs and probes specific for glyceraldehyde-3-phosphate dehydrogenase, and EBV transcripts such as BamHI W, C, and Q promoter (Wp, Cp, and Qp) -initiated mRNA, LMP2A, LMP2B, BARF0, and EBER as described previously (10)
. Sequences of primer pairs used for detection of growth factor mRNA expression were as follows (described as 5' end primer and 3' end primer, respectively), IGF-I: 5'-CACTGTCACTGCTAAATTCA-3', 5'-CTGTGGGCTTGTTGAAATAA-3', IGF-IR: 5'-ACCCGGAGTACTTCAGCGCT, 5'- CACAGAAGCTTCGTTGAGAA, EGF: 5'-TCTCAACACATGCTAGTGGCTGAAATCATGG-3', 5'-TCAATATACATGCACACACCATCATGGAGGC-3', HGF: 5'-CCATGATACCACACGAACACAGC-3', 5'-GTCAAGAGTATAGCACCATGGCCT-3', and IL-1ß: 5'-ATGGCAGAAGTACCTAAGCTCGC-3', 5'-TTGATCGAAGTGGTACGTTAAACACA-3'. For DNA amplification, cDNA was denatured at 94°C for 2 min (IGF-I, IGF-IR, HGF, and IL-1ß) or 5 min (EGF), primer annealing 52°C for 1 min (IGF-I and HGF), 56°C for 1 min (IGF-IR), 63°C for 30 s (EGF), 50°C for 1 min (IL-1ß), and then DNA extension at 72°C for 2.5 min (IGF-I and HGF) or 1 min (IGF-IR, EGF, and IL-1ß) for 3035 cycles (IGF-I, IGF-IR, and HGF) or 3540 cycles (EGF and IL-1ß).
ELISA.
IGF-I production released from cells into the culture supernatant was assayed with an ELISA kit (R&D Systems, Minneapolis, MN) according to the manufacturers protocol.
Plasmids, Transfection, and Cell Cloning.
We used the EBER plasmid that contained 10 tandem repeats of the EBER subfragment (62977325 bp) from the EcoRI K fragment of Akata EBV DNA and Neor gene driven by the SV40 promoter (16)
. The EBNA1 plasmid carries the SV40 promoter-driven Neor and the EBNA1 gene (17)
. The BARF0 plasmid carries the SV40 promoter-driven Neor and the FLAG-tagged BARF0gene (17)
. Each of the plasmids was introduced into NU-GC-3 cells by the electroporation method. For isolation of stable transfectants, transfected cells were selected with complete culture medium containing 500 µg/ml of G418.
Reporter Plasmid Construction and Luciferase Assay.
The IGF-I promoter from -1763 to +68 (18)
was amplified from genomic DNA by PCR. PCR product was digested with MluI and BglII, and then subcloned upstream of the luciferase gene of PGV-basic vector 2 (Wako Pure Chemical Industries, Osaka, Japan). The IGF-I promoter-luciferase plasmid was cotransfected with the EBER plasmid into NU-GC-3 cells or transfected into NU-GC-3/EBER cells, which carried the transfected EBER plasmid and stably expressed EBER. All of the transfections were performed using LIPOFECTAMINE PLUS reagent (Invitrogen) according to the manufacturers protocol. DNA (1 µg) -lipofectin complexes were added to cells grown in each well of six-well culture plates. After 48 h of transfection, cells were lysed, and luciferase activities were determined using Dual-luciferase reporter assay system (Promega). To normalize luciferase activities, activities of PGV reporter plasmid were divided by those of pRL thymidine kinase control vector that was cotransfected as an internal control. From the normalized luciferase activity for each plasmid, the activity of PGV-basic vector 2 vector was subtracted for an enzyme blank and then expressed as a percentage of the expression of the maximal promoter construct, PGV-C3 control vector (Wako), consisting of the SV40 promoter and enhancer connected to the luciferase gene. Reproducibility of results was confirmed by three independent transfections, and each transfection was done in duplicate. Values were expressed as the mean ± SE of three experiments.
| Results |
|---|
|
|
|---|
|
0.3 ng (Fig. 1D)
Next we examined which of the three EBV genes expressed in these cells (EBNA1, EBER, and BARF0) was responsible for IGF-I induction. NU-GC-3 cells were transfected with individual EBV latent genes, and cell clones that stably expressed similar levels of the gene as found in EBV-positive NU-GC-3 cells were selected and analyzed. The results indicated that all of the cell clones transfected with the EBER gene expressed higher levels of IGF-I than those transfected with the control Neor gene (Fig. 1F)
. EBNA1- and BARF0-transfected cell clones expressed IGF-I at levels similar to the Neor-transfected cell clones.
Role of IGF-I on Growth of EBV-Infected GC Cells.
A comparison of growth between EBV-positive and -negative NU-GC-3 cells revealed that EBV clearly promotes growth yielding a higher saturation density in NU-GC-3 cells under low (0.1%) serum conditions (Fig. 2A)
. To assess the role of IGF-I, EBV-positive NU-GC-3 cells were cultured in the presence of anti-IGF-I antibody (R&D Systems). As a result, anti-IGF-I antibody inhibited the growth of EBV-positive NU-GC-3 cells in a dose-dependent manner (Fig. 2B)
. As well, addition of recombinant IGF-I to the culture medium of EBV-negative NU-GC-3 cells allowed these cells to grow at a rate similar to EBV-positive NU-GC-3 cells (Fig. 2C)
. These results indicated that IGF-I was an autocrine growth factor for NU-GC-3 cells.
|
|
|
| Discussion |
|---|
|
|
|---|
Many studies have suggest an important role of IGF-I in neoplastic cell proliferation, showing a positive association between circulating IGF-I levels and risk of developing breast, prostate, and colorectal cancers (12 , 13) .
Regarding GC, several studies have shown that IGF-I receptor is expressed in GC-derived cells, and those cells have a mitogenic response to IGF-I (19 , 20) . Furthermore, normal and neoplastic cells are able to produce IGF-I (21) . A recent study has shown that circulating IGF-I levels in GC are increased compared with control group, and radical surgery, with complete tumor ablation, induces a significant decrease in IGF-I levels (22) . Although it is not known whether IGF-I is the sole determinant of GC development, what we have shown here is that EBER-induced IGF-I acts as an autocrine growth factor in GC cells, and EBV-positive GC biopsies consistently express IGF-I.
In previous articles, we reported that EBER contributes oncogenically to Burkitts lymphoma (16 , 17 , 23) . EBER confers resistance to IFN-induced apoptosis via binding to double-stranded PKR and inhibiting its activation (23) . Moreover, it induces IL-10 expression and secreted IL-10 acts as an autocrine growth factor for Burkitts lymphoma (16) . The present results indicate that EBER makes key contributions to both lymphoid and epithelioid carcinogenesis.
Transient transfection assays indicated that transcription from the IGF-I promoter was activated in stably EBER-expressing cells, whereas it was less prominent in cotransfection studies of EBER with IGF-I promoter. These results suggest that EBER activates IGF-I transcription, but its effect is indirect, and other factors may be involved.
EBER has been reported to bind some cellular proteins such as La, EAP/L22, and PKR (15) . Among them, the association of EBER with PKR has been most intensively studied (23 , 24) . However, treatment of NU-GC-3 cells with a PKR inhibitor did not induce IGF-I expression, making it unlikely that its inhibition by EBER is involved in IGF-I induction (data not shown). The mechanism by which EBER induces IGF-I expression will be fascinating to elucidate.
The present findings suggest a possible new therapeutic strategy against EBV-positive GC. Both existing drugs and various newly developed agents acting through the IGF-I pathways should have great potential as therapeutic or preventive agents for EBV-positive GC.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by grants-in-aid from the Ministry of Education, Science, Sports, Culture, and Technology, Japan. ![]()
2 To whom requests for reprints should be addressed, at Department of Tumor Virology, Institute for Genetic Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo 060-0815, Japan. Phone: 81-11-706-5071; Fax: 81-11-706-7540; E-mail: kentaka{at}med.hokudai.ac.jp ![]()
3 The abbreviations used are: GC, gastric carcinoma; EBER, EBV-encoded small RNA; EBNA, EBV-determined nuclear antigen; LMP, latent membrane protein; IGF, insulin-like growth factor; IGF-IR, insulin-like growth factor I receptor; EGF, epidermal growth factor; HGF, hepatocyte growth factor; IL, interleukin; RT-PCR, reverse transcription-PCR; FBS, fetal bovine serum; Neor, neomycin resistance; rEBV, recombinant EBV; PKR, RNA-activated protein kinase. ![]()
Received 7/29/03. Revised 8/21/03. Accepted 8/26/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Wu, S. Maruo, M. Yajima, T. Kanda, and K. Takada Epstein-Barr Virus (EBV)-Encoded RNA 2 (EBER2) but Not EBER1 Plays a Critical Role in EBV-Induced B-Cell Growth Transformation J. Virol., October 15, 2007; 81(20): 11236 - 11245. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Lin, C.-H. Tsai, J.-S. Chu, J.-Y. Chen, K. Takada, and J.-Y. Shew Dysregulation of HER2/HER3 Signaling Axis in Epstein-Barr Virus-Infected Breast Carcinoma Cells J. Virol., June 1, 2007; 81(11): 5705 - 5713. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Fok, K. Friend, and J. A. Steitz Epstein-Barr virus noncoding RNAs are confined to the nucleus, whereas their partner, the human La protein, undergoes nucleocytoplasmic shuttling J. Cell Biol., May 8, 2006; 173(3): 319 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Satou, J.-i. Yasunaga, M. Yoshida, and M. Matsuoka HTLV-I basic leucine zipper factor gene mRNA supports proliferation of adult T cell leukemia cells PNAS, January 17, 2006; 103(3): 720 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. K. Ruf, K. A. Lackey, S. Warudkar, and J. T. Sample Protection from Interferon-Induced Apoptosis by Epstein-Barr Virus Small RNAs Is Not Mediated by Inhibition of PKR J. Virol., December 1, 2005; 79(23): 14562 - 14569. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nanbo, H. Yoshiyama, and K. Takada Epstein-Barr Virus-Encoded Poly(A)- RNA Confers Resistance to Apoptosis Mediated through Fas by Blocking the PKR Pathway in Human Epithelial Intestine 407 Cells J. Virol., October 1, 2005; 79(19): 12280 - 12285. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yajima, T. Kanda, and K. Takada Critical Role of Epstein-Barr Virus (EBV)-Encoded RNA in Efficient EBV-Induced B-Lymphocyte Growth Transformation J. Virol., April 1, 2005; 79(7): 4298 - 4307. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Holley-Guthrie, W. T. Seaman, P. Bhende, J. L. Merchant, and S. C. Kenney The Epstein-Barr Virus Protein BMRF1 Activates Gastrin Transcription J. Virol., January 15, 2005; 79(2): 745 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yang, K. Aozasa, K. Oshimi, and K. Takada Epstein-Barr Virus (EBV)-Encoded RNA Promotes Growth of EBV-Infected T Cells through Interleukin-9 Induction Cancer Res., August 1, 2004; 64(15): 5332 - 5337. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |