Cancer Research Annual Meeting 2010  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lovat, P. E.
Right arrow Articles by Piacentini, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lovat, P. E.
Right arrow Articles by Piacentini, M.
[Cancer Research 63, 7310-7313, November 1, 2003]
© 2003 American Association for Cancer Research


Regular Articles

Bak

A Downstream Mediator of Fenretinide-Induced Apoptosis of SH-SY5Y Neuroblastoma Cells1

Penny E. Lovat, Serafina Oliverio, Marco Corazzari, Carlo Rodolfo, Marco Ranalli, Bojidar Goranov, Gerry Melino, Christopher P. F. Redfern2 and Mauro Piacentini

Northern Institute for Cancer Research, University of Newcastle Upon Tyne, Newcastle Upon Tyne NE2 4HH, United Kingdom, [P. E. L., B. G., C. P. F. R.]; Department of Biology, University of Rome Tor Vergata, Rome, 00133, Italy [S. O., C. R.]; Istituto Dermatopatico Immacolata–Istituto per Ricovero per la Cura a Carattere Scientifico Biochemistry Laboratory, Department of Experimental Medicine, University of Rome Tor Vergata, Rome, 00133, Italy [M. R., G. M.]; and Istituto Nazionale per la Malattie Infettive–Istituto per Ricovero per la Cura a Carattere Scientifico Lazzaro Spallanzani, Rome, 00149, Italy [M. C., M. P.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Unlike 13-cis-retinoic acid, the synthetic retinoid fenretinide [N-(4-hydroxyphenyl)retinamide] induces apoptosis of neuroblastoma cells by mechanisms involving retinoic acid receptors and oxidative stress. After screening a cDNA array for apoptosis-related genes, the Bcl2-related protein Bak was identified as a fenretinide-inducible gene in SH-SY5Y neuroblastoma cells, and this was confirmed by Western blotting and flow cytometry. Although fenretinide acts synergistically in vitro with chemotherapeutic drugs, these drugs did not induce Bak expression. Retinoic acid receptor antagonists did not block the induction of Bak by fenretinide. Conversely, Bak induction was blocked by the antioxidant vitamin C. Overexpression of Bak increased apoptosis in both the presence and absence of fenretinide, whereas expression of antisense Bak inhibited fenretinide-induced apoptosis. Bak expression was also induced in cells overexpressing the stress-induced transcription factor GADD153, but Bak expression was inhibited in cells expressing an antisense GADD153 construct. These results suggest that Bak is a downstream mediator of an oxidative stress pathway leading to apoptosis of SH-SY5Y neuroblastoma cells in response to fenretinide.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Neuroblastoma is responsible for 15% of all pediatric deaths from malignancy (1) . 13-cis-Retinoic acid, a compound that differentiates neuroblastoma cells in vitro, increases event-free survival when used to treat residual disease after chemotherapy and bone marrow transplantation (2) and is now included in most treatment regimes for neuroblastoma. However, retinoic acid may also increase the resistance of neuroblastoma cells to chemotherapy (3) . This problem might be overcome using retinoids with different biological properties. Fenretinide [N-(4-hydroxyphenyl)retinamide], a retinoic acid analogue, is able to induce apoptosis of neuroblastoma in vitro, unlike retinoic acid (4 , 5) , and is also synergistic with cisplatin, etoposide, or carboplatin (6) in the induction of neuroblastoma-cell apoptosis. Fenretinide-induced apoptosis in neuroblastoma cells is apparently mediated by RARs3 and oxidative stress acting together, although the evidence for the involvement of RARs stems only from studies with RAR-specific antagonists (5, 6, 7) . An increase in reactive oxygen species is detectable within 6 h of treating neuroblastoma cells with fenretinide (5) , and this oxidative stress pathway is characterized by an induction of the stress response transcription factor GADD153 (CHOP) via a fenretinide-dependent increase in 12-lipoxygenase activity (7) . Both the induction of reactive oxygen species and subsequent apoptosis are blocked by pretreating the cells with antioxidants (5) .

Fenretinide-induced apoptosis of neuroblastoma cells is caspase dependent and involves the mitochondrial release of cytochrome c independently of mitochondrial permeability transition (5) . Bak, a proapoptotic member of the Bcl2 family, was found to be one of a small number of genes up-regulated in SH-SY5Y cells by treatment with fenretinide (7) . In view of the role of Bcl2 family proteins in the control of apoptosis and the possibility that these proteins may be key elements in the synergy between fenretinide and chemotherapeutic drugs, the aim of this study was to determine whether Bak has a functional role in apoptosis induced by fenretinide.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Cell Culture and Treatments.
Human SH-SY5Y neuroblastoma cells and stably transfected derivatives (8) were grown in a 1:1 mixture of DMEM and Ham’s F-12 medium (Life Technologies, Inc., Ltd., Paisley, United Kingdom), supplemented with 10% fetal bovine serum [Life Technologies, Inc. (culture medium)] and grown in a humidified atmosphere of 5% CO2 in air. For all experiments, cells were seeded into tissue culture flasks (Costar, Bucks, United Kingdom) and allowed to attach overnight before treatment. The seeding density varied according to the type of experiment. For apoptosis and immunofluorescence measurements by flow cytometry, 0.4 x 106 or 2 x 106 cells, respectively, were seeded into 25-cm2 tissue culture flasks in 5 ml of culture medium. For Western blot experiments, 6 x 106 cells were seeded into 75-cm2 flasks in 10 ml of culture medium. Fenretinide (Janssen-Cilag Ltd., Basserdorf, Switzerland) was added to cultures in ethanol, and an equal volume of ethanol (<0.1% of culture volume) was used to treat control cells. Stock solutions of cisplatin (100 mM, freshly prepared in DMSO; Sigma Chemical Co., Poole, United Kingdom) were diluted in culture medium. The antioxidant vitamin C (ascorbic acid sodium salt; Sigma Chemical Co.) was freshly diluted in PBS and added to a final concentration of 100 µM 2 h before 22 h of treatment with fenretinide; cell cultures were washed once with PBS after removal of vitamin C before addition of fenretinide. The RARß/{gamma} antagonists CD2665 and Ro 41-5253 were dissolved in DMSO and added to cultures at final concentrations of 1 µM in the presence or absence of fenretinide for 24 h. Construction and characteristics of the clonally selected SH-SH5Ytet12 cells and SH-SH5Ytet12 cells stably transfected with sense GADD153 and antisense GADD153 have been described by Lovat et al. (7) . The characteristics of stably transfected cells were maintained by periodic culture in the presence of blasticidin (2.5 µg/ml; SH-SH5Ytet12 cells) or blasticidin (2.5 µg/ml) and zeocin (150 µg/ml; sense and antisense Bak and GADD153 SH-SH5Ytet12 transfectants).

Flow Cytometry.
Apoptosis was evaluated by flow cytometry of PI-stained cells as previously described (7) . Cells for immunofluorescence flow cytometry were detached by trypsinization and washed with 2 ml of PBS before fixation in 500 µl of 4% paraformaldehyde in PBS for 10 min at room temperature. After washing twice with PBS, cells were permeabilized with 500 µl of 0.5% Triton X-100 (Sigma Chemical Co.) in PBS for 2 min at room temperature. The cells were then washed twice with PBS and incubated for 1 h at room temperature in the presence or absence of a polyclonal goat antihuman Bak antibody (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:100. The binding of antibody was visualized with a rabbit antigoat FITC-conjugated antibody (Molecular Probes, Leiden, the Netherlands), and 20,000 events were acquired for flow cytometry as described previously (7) .

Western Blotting.
Total protein was extracted from SH-SY5Y cells treated in the presence or absence of fenretinide for 2–48 h; 25 µg of total protein were separated by electrophoresis through 12.5% SDS-PAGE gels and blotted onto nitrocellulose (5) . Bak was identified with the same antibody used for flow cytometry experiments diluted 1:500 and detected by chemiluminescence (5) using a horseradish peroxidase-conjugated antigoat IgG (Jackson ImmunoResearch Laboratories Inc.) diluted 1:500. Bax was detected with a mouse monoclonal antibody (Santa Cruz Biotechnology), and Bcl-xl was detected with a rabbit polyclonal antibody (Santa Cruz Biotechnology), all diluted 1:1000 and detected by chemiluminescence as described for Bak. The protein loading in each track was compared using a mouse monoclonal anti-ß-tubulin antibody (Sigma Chemical Co.) diluted 1:1000. Band intensities were compared by densitometry using ImageMaster software (Amersham PLC, Little Chalfont, United Kingdom).

Transfection of Sense and Antisense Bak cDNA into SH-SY5Y Cells.
Bak cDNA (646 bp) was amplified by reverse transcription-PCR, primed with poly-d(T), from SH-SY5Y cells treated with 3 µM fenretinide for up to 8 h. The primers for PCR were 5'Bak (TCGGATCCAAATGGCTTCGGGGCAAGGCCC; the BamHI site is underlined) and 3'Bak (GAATTCCTTGGGAGTCATGATTTGAAGA; the EcoRI site is underlined); the conditions for PCR were denaturation at 95°C for 5 min followed by 35 cycles of 95°C (45 s), 60°C (45 s), and 72°C (1 min) and finally 72°C for 10 min. The PCR product was purified using a QIAquick PCR purification kit (Qiagen), digested with BamHI and EcoRI, repurified using QIAquick Nucleotide Removal Kit (Qiagen), and ligated into pcDNA4/TO vector (Invitrogen) in the sense and antisense orientations. The identity and orientation of the PCR product were confirmed by sequencing. For cloning in an antisense orientation, the EcoRI recognition sequence in the 3' primer was replaced with a HindIII site. Recipient cells were prepared by stable transfection of the pcDNA6/TR Tet repressor plasmid (Invitrogen) into SH-SY5Y cells (7) and are referred to as SH-SY5Ytet12. Sense and antisense Bak constructs in pcDNA4/TO were transfected into SH-SY5Ytet12 cells using LipofectAMINE 2000, and stably transfected cells were selected with zeocin (250 µg/ml) and blasticidin (5 µg/ml). A mixed population of stably transfected cells was treated with control vehicle (ethanol), tetracycline (added in ethanol to 1 µg/ml), fenretinide (10 µM), or tetracycline and fenretinide (1 µg/ml and 10 µM, respectively) and analyzed for apoptosis by flow cytometry and Western blotting. In the tetracycline experiments, cells were treated with tetracycline for 24 h before the addition of fenretinide, and incubation continued for 24 h before analysis. Thus, cells were pre-exposed to tetracycline and treated with fenretinide in the presence of tetracycline.


    RESULTS AND DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Immunofluorescence flow cytometry and Western blotting experiments confirmed that Bak protein was induced in SH-SY5Y cells after 24–48 h in response to fenretinide (Fig. 1)Citation . Because fenretinide synergizes with cisplatin, etoposide, or carboplatin to give increased levels of apoptosis (6 , 9) , we asked whether these chemotherapeutic drugs also induce Bak expression. However, after treating SH-SY5Y cells with concentrations of cisplatin (Fig. 1)Citation , carboplatin, or etoposide (data not shown) that induce 30–40% apoptosis, there was no detectable induction of Bak.



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Induction of Bak by fenretinide in SH-SY5Y cells. A, flow cytometry immunofluorescence profiles for Bak antibody staining of control SH-SY5Y cells (gray and dotted line) and SH-SY5Y cells treated for 24 h with 3 µM fenretinide (FenR; solid black line). B, Western blot of SH-SY5Y cells treated with 3 µM fenretinide for 0–48 h and probed for Bak; after 48 h, Bak was induced 1.6-fold above control levels (corrected for loading using the tubulin signal intensity). C, flow cytometry immunofluorescence profiles for Bak antibody staining of control SH-SY5Y cells (gray and dotted line) and SH-SY5Y cells treated for 24 h with 1 µM cisplatin (solid black line). Results for cells treated with carboplatin or etoposide were similar to the data shown for cisplatin-treated cells. D, flow cytometry immunofluorescence profiles for Bak antibody staining of control SH-SY5Y cells (light gray-filled trace) and cells treated for 24 h with 1 µM CD2665 in the presence (solid black line) or absence (gray and dotted line) of 3 µM fenretinide (FenR). Similar results were obtained using the RAR{alpha} antagonist Ro 41-5253. In A, C, and D, the trace for control SH-SY5Y cells stained with secondary antibody alone is shown as the light gray-filled trace. E, flow cytometry immunofluorescence profiles for Bak antibody staining of control SH-SY5Y cells pretreated with 100 µM vitamin C for 2 h (light gray-filled trace) or treated for 24 h with 3 µM fenretinide with (gray and dotted line) or without pretreatment with 100 µM vitamin C for 2 h (solid black line). With respect to E, note that the traces for Bak expression in control cells without vitamin C or fenretinide are as shown by the light gray-filled traces in A, C, and D.

 
Fenretinide-induced apoptosis is inhibited by antagonists to RARß/{gamma} receptors, but not by RAR{alpha} antagonists (5) . Although these reagents are effective in inhibiting retinoic acid-induced gene expression in SH-SY5Y cells (7) , neither the RAR{alpha} antagonist Ro 41-5253 nor the RARß/{gamma} antagonist CD2665 had any apparent effect on the induction of Bak in response to fenretinide (Fig. 1)Citation . Conversely, pretreating SH-SY5Y cells with the antioxidant vitamin C before a 24-h exposure to fenretinide blocked the induction of Bak (Fig. 1)Citation . These results suggest that Bak was induced in relation to an oxidative stress pathway of fenretinide action that is independent of RARs.

To demonstrate a functional role of Bak in the fenretinide-induced apoptosis of SH-SY5Y cells, Bak cDNA was cloned into a tetracycline-inducible vector in both sense and antisense orientations and stably transfected into SH-SY5Ytet12 cells. Stably transfected cells selected by zeocin and blasticidin tend to be more resistant to drug-induced apoptosis, and therefore higher concentrations of fenretinide were used to induce apoptosis in these cells compared with wild-type cells. Relative to control, uninduced cells, the induction of Bak with tetracycline increased cell death in the absence of fenretinide from 10% in the control, untreated cells to nearly 70% after induction of Bak with tetracycline (Fig. 2)Citation . Although the cell death response to fenretinide treatment was not increased, this was already at 90% with the fenretinide concentration used. Western blot data demonstrated that Bak was induced 4-fold by tetracycline in the transfected cells (Fig. 2)Citation . In contrast, the induction of antisense Bak with tetracycline did not increase apoptosis relative to untreated control cells (Fig. 3)Citation . Furthermore, although fenretinide induced death in nearly 70% of cells (Fig. 3E)Citation , this response to fenretinide was effectively blocked by the induction of antisense Bak with tetracycline (Fig. 3)Citation . Similar results were obtained using RNA interference (data not shown). Western blotting data for these experiments with the inducible antisense Bak clones confirmed that Bak was induced 2-fold in response to fenretinide, but this induction was blocked by adding tetracycline to induce expression of the antisense Bak cDNA construct (Fig. 3F)Citation . Although fenretinide does not alter levels of Bcl2 in SH-SY5Y neuroblastoma cells (5) , it is possible that other Bcl2-related proteins are regulated in response to fenretinide. To investigate this, Western blots of proteins extracted from the sense and antisense Bak cells were probed with antibodies against the antiapoptotic protein Bcl-xl and the proapoptotic Bax (Fig. 4A)Citation . However, there was no consistent change in the expression of Bax or Bcl-xl in response to fenretinide or in response to the induction of sense or antisense Bak with tetracycline. These results clearly demonstrate that the induction of Bak is required for fenretinide-induced apoptosis of SH-SY5Y cells.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Transfection of sense Bak cDNA. A–D, flow cytometry profiles of PI-stained SH-SY5Ytet12 cells stably transfected with sense Bak cDNA after treatment with control vehicle (A, Ctrl), tetracycline (B, +Tet; 1 µg/ml for 48 h), tetracycline and fenretinide (C, +Tet + FenR; 1 µg/ml tetracycline for 48 h and 10 µM fenretinide for the last 24 h of tetracycline treatment), or fenretinide alone (D, +FenR; 10 µM for 24 h) and analyzed for apoptosis by flow cytometry. E, summary of data for three consecutive experiments with cells treated as described for A–D; error bars represent SE. F, Western blot results for Bak and tubulin (loading control) expression after treatment with ethanol (vehicle control; Ctrl), tetracycline (+Tet), tetracycline and fenretinide (+Tet+FenR), or fenretinide alone (+FenR) as described in A–D and in the same population of cells. After correcting for variation in loading using the tubulin band intensity, Bak was induced 4-fold relative to control cells by tetracycline, 4.5-fold by tetracycline and fenretinide, and 2.6-fold by fenretinide alone.

 


View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Transfection of antisense Bak cDNA. A–D, flow cytometry profiles of PI-stained SH-SY5Ytet12 cells stably transfected with antisense Bak cDNA after treatment with control vehicle (A, Ctrl), tetracycline (B, +Tet; 1 µg/ml for 48 h), tetracycline and fenretinide (C, +Tet + FenR; 1 µg/ml for 48 h and 10 µM for 24 h, respectively, as described in the Fig. 2Citation legend), or fenretinide alone (D, +FenR; 10 µM for 24 h) and analyzed for apoptosis by flow cytometry. E, summary of data for three consecutive experiments with cells treated as described for A–D; error bars represent SE. F, Western blot results for Bak and tubulin (loading control) expression after treatment with ethanol (vehicle control; Ctrl), tetracycline (+Tet), tetracycline and fenretinide (+Tet+FenR), or fenretinide alone (+FenR) as described in A–D and in the same population of cells. After correcting for variation in loading using the tubulin band intensity, Bak was reduced to approximately half (0.49-fold) the level in control cells by tetracycline or tetracycline with fenretinide (0.6-fold) but induced 2-fold by fenretinide in the absence of tetracycline.

 


View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. A, Western blot results for Bcl-xl, Bax, and tubulin (loading control) expression in SH-SY5Ytet12 cells stably transfected with sense or antisense Bak cDNA after treatment with control vehicle (a, Ctrl), tetracycline (b, +Tet; 1 µg/ml for 48 h), tetracycline and fenretinide (c, +Tet+FenR; 1 µg/ml for 48 h and 10 µM for 24 h, respectively, as described in the Fig. 2Citation legend), or fenretinide alone (d, +FenR; 10 µM for 24 h). In sense and antisense Bak cells without induction of the construct (i.e., no tetracycline), there was no consistent change in expression of Bcl-xl or Bax in response to fenretinide and no alteration in expression of these proteins after the addition of tetracycline. B, induction of Bak in response to fenretinide in SH-SY5Ytet12 cells (Tet12, ) and SH-SY5Ytet12 cells stably transfected with tetracycline-inducible sense (GADD S 7; {square}) or antisense- (GADD AS 8; {blacksquare}) GADD153 cDNA. Expression of the sense or antisense GADD153 cDNA was induced with tetracycline (Tet; 1 µg/ml for 24 h before addition of 10 µM fenretinide or control vehicle for 24 h). Western blotting (7) and immunofluorescence flow cytometry (data not shown) confirmed that GADD153 was induced by tetracycline in the sense clone and that the induction of GADD153 in response to fenretinide was blocked by tetracycline in the antisense clone. Bak induction in response to fenretinide (FenR), control vehicle (ctrl), or tetracycline in the presence (Tet + FenR) or absence of fenretinide (Tet) was measured by flow cytometry and is expressed relative to control cells. Bar heights are the means and range of duplicate experiments.

 
The data from these experiments show that Bak was induced in SH-SY5Y neuroblastoma cells in response to fenretinide and was required for fenretinide-induced apoptosis. GADD153 is also induced by fenretinide, but relatively faster, reaching a peak at about 8 h (7) . Considerable evidence indicates that GADD153 mediates cellular responses to oxidant injury (10) , and mediating ER stress may be one of its main functions (11 , 12) . Because Bak is associated with the ER (13 , 14) , neuroblastoma cell apoptosis in response to fenretinide may be mediated by an ER stress pathway in which GADD153 and Bak are major components. GADD153 is a member of the CCAAT/enhancer-binding protein family of transcription factors (15) and may have important regulatory interactions with members of the Bcl2 family (16 , 17) . Clearly, GADD153 may play a role in fenretinide-induced apoptosis of SH-SY5Y neuroblastoma cells by regulating the expression of proapoptotic proteins such as Bak.

To test the hypothesis that GADD153 is responsible for the induction of Bak, we compared the level of Bak expression in SH-SY5Ytet12 cells stably transfected with tetracycline-inducible sense or antisense GADD153 cDNA (7) . By immunofluorescence flow cytometry, SH-SY5Ytet12cells showed a 1.6-fold induction of Bak in response to fenretinide (Fig. 4B)Citation . A sense GADD153 clone (S7) showed induction of Bak when GADD153 was induced in response to tetracycline alone, and in these cells, Bak was induced to the same level whether treated with tetracycline or fenretinide alone or with both reagents together (Fig. 4B)Citation . In SH-SY5Ytet12 cells stably transfected with tetracycline-inducible antisense GADD153, Bak was induced by fenretinide in the absence of tetracycline and was not induced by tetracycline alone. Conversely, induction of antisense GADD153 by tetracycline reduced the induction of Bak in response to fenretinide by 50% (Fig. 4B)Citation . These results demonstrate that the induction of GADD153 independently of fenretinide leads to the induction of Bak. Therefore, it is possible that GADD153 directly regulates Bak expression. However, because expression of the antisense GADD153 construct did not completely abolish Bak induction in response to fenretinide, it is possible that GADD153-independent mechanisms induced by fenretinide contribute to Bak induction in these cells.

Studies on other cell types have shown that Bak can induce the release of cytochrome c from mitochondria, independently of mitochondrial permeability transition, in combination with BH3-domain-only members of the Bcl2 family (18) . Therefore, the induction of Bak may be a key event leading to cytochrome c release and subsequent apoptosis in fenretinide-treated neuroblastoma cells. Clearly, the regulation of Bak by fenretinide may represent a novel molecular target to investigate with respect to designing or modifying therapeutic strategies for neuroblastoma.


    ACKNOWLEDGMENTS
 
We thank Janssen-Cilag Ltd. for supplying fenretinide, Dr. U. Reichert (Galderma, Sophia Antipolis, France) for supplying CD2665, and Roche for supplying Ro 41-5253.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This research was funded in the United Kingdom by Cancer and Leukemia in Childhood and The Neuroblastoma Society and by Telethon E872, Associazione Italiana per la Ricerca sul Cancro, Ministry of Universities and Research-cofin, European Union (QLG1-1999-00739) and Consiglio Nazionale delle Ricerche in Italy. M. R. was supported by a fellowship from Fondazione Italiana per la Ricerca sul Cancro. Back

2 To whom requests for reprints should be addressed, at Northern Institute for Cancer Research, 4th Floor, Cookson Building, Medical School, University of Newcastle, Newcastle upon Tyne NE2 4HH, United Kingdom. Fax: 44-191-222-8129; E-mail: chris.redfern{at}ncl.ac.uk Back

3 The abbreviations used are: RAR, retinoic acid receptor; PI, propidium iodide; ER, endoplasmic reticulum. Back

Received 2/25/03. Revised 6/23/03. Accepted 7/14/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Maris J. M., Matthay K. K. Molecular biology of neuroblastoma. J. Clin. Oncol., 17: 2264-2279, 1999.[Abstract/Free Full Text]
  2. Matthay K. K., Villablanca J. G., Seeger R. C., Stram D. O., Harris R. E., Ramsy N. K., Swift P., Shimada H., Black C. T., Brodeur G. M., Gerbing R. B., Reynolds C. P. Treatment of high risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis retinoic acid. N. Engl. J. Med., 341: 1165-1173, 1999.[Abstract/Free Full Text]
  3. Lasorella A., Iavarone A., Israel M. A. Differentiation of neuroblastoma enhances Bcl-2 expression and induces alterations of apoptosis and drug resistance. Cancer Res., 55: 4711-4716, 1995.[Abstract/Free Full Text]
  4. Meister B., Fink F. M., Hittmair A., Marth C., Widschwendter M. Antiproliferative activity and apoptosis induced by retinoic acid receptor-{gamma} selectively binding retinoids in neuroblastoma. Anticancer Res., 18: 1777-1786, 1998.[Medline]
  5. Lovat P. E., Ranalli M., Annichiarrico-Petruzzelli M., Bernassola F., Piacentini M., Malcolm A. J., Pearson A. D. J., Melino G., Redfern C. P. F. Effector mechanisms of fenretinide-induced apoptosis in neuroblastoma. Exp. Cell Res., 260: 50-60, 2000.[Medline]
  6. Lovat P. E., Ranalli M., Bernassola F., Tilby M. J., Malcolm A. J., Pearson A. D. J., Piacentini M., Melino G., Redfern C. P. F. Synergistic induction of apoptosis of neuroblastoma by fenretinide or CD437 in combination with chemotherapeutic drugs. Int. J. Cancer, 88: 977-985, 2000.[Medline]
  7. Lovat P. E., Oliverio S., Ranalli M., Corrazzari M., Rodolfo C., Bernassola F., Aughton K., Maccarrone M., Campbell Hewson Q. D., Pearson A. D. J., Melino G., Piacentini M., Redfern C. P. F. GADD153 and 12-lipoxygenase mediate fenretinide-induced apoptosis of neuroblastoma. Cancer Res., 62: 5158-5167, 2002.[Abstract/Free Full Text]
  8. Biedler J. L., Helsan L., Spengler B. A. Morphology and growth, tumorigenicity and cytogenetics of human neuroblastoma cells in continuous culture. Cancer Res., 33: 2643-2652, 1973.[Abstract/Free Full Text]
  9. Lovat P. E., Ranalli M., Bernassola F., Tilby M., Malcolm A. J., Pearson A. D. J., Piacentini M., Melino G., Redfern C. P. F. Distinct properties of fenretinide and CD437 lead to synergistic responses with chemotherapeutic reagents. Med. Pediatr. Oncol., 35: 663-668, 2000.[Medline]
  10. Guyton K. Z., Xu Q., Holbrook N. J. Induction of the mammalian stress response gene GADD153 oxidative stress by oxidative stress: role of AP-1 element. Biochem. J., 314: 546-554, 1996.
  11. Ron D., Habener J. F. CHOP, a novel developmentally regulated nuclear protein dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription. Genes Dev., 6: 439-453, 1992.[Abstract/Free Full Text]
  12. Oyadomari S., Koizumi A., Takeda K. Targeted disruption of the chop gene delays endoplasmic reticulum stress-mediated diabetes. J. Clin. Investig., 109: 525-532, 2002.[Medline]
  13. Daniel P. T. Dissecting the pathways to death. Leukemia (Baltimore), 14: 2035-2044, 2000.
  14. Nutt L. K., Pataer A., Pahler J., Fang B., Roth J., McConkey D. J., Swisher S. G. Bax and Bak promote apoptosis by modulating endoplasmic reticular and mitochondrial Ca2+ stores. J. Biol. Chem., 277: 9219-9225, 2002.[Abstract/Free Full Text]
  15. Matsumoto M., Minami M., Takeda K., Sakao Y., Akira S. Ectopic expression of CHOP (GADD 153) induces apoptosis in M1 myeloblastic leukaemia cells. FEBS Lett., 395: 143-147, 1996.[Medline]
  16. Tombal B., Weeraratna A. T., Denmeade S. R., Isaacs J. T. Thapsigargin induces a calmodulin/calcineurin-dependent apoptotic cascade responsible for the death of prostatic cancer cells. Prostate, 43: 303-317, 2000.[Medline]
  17. McCullough K. D., Martindale J. L., Klotz L. O., Aw T. Y., Holbrook N. J. Gadd 153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol. Cell. Biol., 21: 1249-1259, 2001.[Abstract/Free Full Text]
  18. Korsmeyer S. J., Wei M. C., Saito M., Weiler S., Oh K. J., Schlesinger P. H. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ., 7: 1166-1173, 2000.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S.-Y. Kim, M. Seo, Y. Kim, Y.-I. Lee, J.-M. Oh, E.-A. Cho, J.-S. Kang, and Y.-S. Juhnn
Stimulatory Heterotrimeric GTP-binding Protein Inhibits Hydrogen Peroxide-induced Apoptosis by Repressing BAK Induction in SH-SY5Y Human Neuroblastoma Cells
J. Biol. Chem., January 18, 2008; 283(3): 1350 - 1361.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
P. E. Lovat, F. Di Sano, M. Corazzari, B. Fazi, R. P. Donnorso, A. D. J. Pearson, A. G. Hall, C. P. F. Redfern, and M. Piacentini
Gangliosides Link the Acidic Sphingomyelinase-Mediated Induction of Ceramide to 12-Lipoxygenase-Dependent Apoptosis of Neuroblastoma in Response to Fenretinide
J Natl Cancer Inst, September 1, 2004; 96(17): 1288 - 1299.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lovat, P. E.
Right arrow Articles by Piacentini, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lovat, P. E.
Right arrow Articles by Piacentini, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online