Cancer Research Annual Meeting 2010  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lavergne, E.
Right arrow Articles by Combadière, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lavergne, E.
Right arrow Articles by Combadière, C.
[Cancer Research 63, 7468-7474, November 1, 2003]
© 2003 American Association for Cancer Research


Immunology

Fractalkine Mediates Natural Killer-Dependent Antitumor Responses in Vivo1

Elise Lavergne2, Behazine Combadière2, Olivia Bonduelle, Mutsunori Iga, Ji-Liang Gao, Maud Maho, Alexandre Boissonnas, Philip M. Murphy, Patrice Debré and Christophe Combadière3

Laboratoire d’Immunologie Cellulaire et Tissulaire, Institut National de la Santé et de la Recherche Médicale U543, Hôpital Pitié-Salpêtrière, 75634 Paris cedex 13, France [E. L., B. C., O. B., M. I., M. M., A. B., P. D., C. C.], and Laboratory of Host Defenses, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland 20892 [J-L. G., P. M. M.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CX3CR1 has been described previously as a marker of human cytotoxic effector cells. We evaluated the possibility of using its ligand, CX3CL1, to redirect immune response against tumors. When murine lymphoma cell lines (EL4 and its derivative EG7) stably transfected with human-CX3CL1 were injected s.c. into C57BL/6 mice, the tumor growth was severely impaired when compared with the growth of control cell lines. This antitumor effect of CX3CL1 was also found in T- and B-cell-deficient Rag1-/- mice but vanished in natural killer (NK) cell-deficient beige mice and in CX3CR1-/- mice, suggesting the involvement of CX3CR1-expressing NK cells. In addition, increased NK cell infiltration was observed in CX3CL1-producing tumors compared with controls. The effect of CX3CR1 on tumor growth required host cytotoxic effector cell functions because both IFN{gamma}-/- and perforin-/- mice were resistant to CX3CL1 antitumor effect. Finally, intratumoral injection of DNA plasmid coding for a chimeric immunoglobulin presenting the CX3CL1 chemokine domain provided strong antitumor activity. Together, these data demonstrate that the CX3CL1 can reduce incidence and size of lymphoma in vivo through increased recruitment of activated NK cytotoxic cells. These findings offer the first evidence of the potential of chimeric immunoglobulin-chemokines in anticancer therapy.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A new approach to anticancer therapies involves the redistribution and activation of competent cells into the vicinity of the developing tumor. Chemokines, proinflammatory cytokines that coordinate the deployment and activation of leukocytes at injury sites by signaling through a family of G protein-coupled receptors (1, 2, 3) , may be good candidates for this task (4) . The chemokine superfamily is divided into four subgroups (CC, CXC, CX3C, and C), based on the spacing of the first cysteine pair of the N-terminal domain (5) . Development of therapeutic targeting systems requires precise knowledge of the complex cellular and molecular processes involved (6, 7, 8) . Some chemokines seem to intensify innate and adaptive antitumor immune responses by recruiting subsets of leukocytes, whereas others seem to favor cancer metastasis by directing the spread of tumor cells (9 , 10) or to promote tumor growth by modulating neovascularization (11, 12, 13) . It is, thus, difficult to ascertain the effect of a specific chemokine without directly assessing its in vivo function. Many CC and CXC chemokines have been tested, but there are thus far no data for the CX3C chemokine.

CX3CL1 (previously known as fractalkine) is the only member of the CX3C subfamily (14) . Unlike any other chemokine, except CXCL16 (15) , it exists in two isoforms: a membrane-anchored form in which the chemokine module is presented to the cell surface on a long mucin-like stalk and a soluble form that results from proteolytic cleavage. Interestingly, the soluble CX3CL1 is reported to recruit lymphocytes and monocytes (14 , 16) , whereas membrane-bound CX3CL1 directly mediates the capture and firm adhesion of leukocytes expressing its receptor CX3CR1 under flow conditions (17 , 18) . CX3CR1 is a typical seven-transmembrane receptor coupled with Gi-type G proteins (17 , 19) . The expression pattern of CX3CR1 in the human lymphoid system is associated mostly with cytotoxic effector CD4+, CD8+, and NK4 cells (20) , but only with monocytes and NK and dendritic cells (DC) in mice (21) . We, thus, postulated that CX3CR1 might be a potential in vivo target for controlling lymphocyte and NK cell trafficking in cancer and might, thus, be used in antitumor therapy. We used two approaches to investigate this possibility: the standard inoculation into mice of tumor cells transfected with the chemokine of interest or direct injection into the tumor of DNA coding for chemokine fused to immunoglobulin, an approach pioneered by Biragyn et al. (22 , 23) . Here, we show that CX3CL1 recruits activated NK cells into the tumor and leads to in vivo reduction of tumor growth.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mice.
Wild-type C57BL/6 (B6) females were obtained from Elevage Janvier (Le Genest, Saint Isle, France). The B6 background perforin-deficient (Perf-/-), C57BL/10-Rag1-deficient (Rag1-/-), and NIH III (beige x nude x xid) mice were purchased from Charles River Breeding Laboratories (Saint-Aubin les Elbeufs, France). The IFN{gamma}-deficient (IFN{gamma}-/-) mice came from The Jackson Laboratory (Bar Harbor, ME). The CX3CR1-/- mice have been described previously (24) . All mice were housed at the Nouvelle Animalerie Commune of Pitié-Salpêtrière under specific pathogen-free conditions and used for experiments at 6–10 weeks of age. All animal experimental protocols were approved by the local animal experimentation ethics committee at the animal facility of Pitié-Salpêtrière.

Cell Lines.
The dimethylbenzanthracene-induced lymphoma EL4 and its chicken ovalbumin-expressing derivative EG7 were purchased from the American Type Culture Collection (Manassas, VA). HEK cells and CX3CR1-transfected HEK cells have been described previously (19) . Transfast (Promega, Charbonnières, France) was used in accordance with the manufacturer’s instructions to transfect EL4 and EG7 cells with pBlast-CX3CL1 plasmid (Invivogen, San Diego, CA). Transfectants were selected by adding 10 µg/ml blasticidin (Invivogen) and then maintained with 5 µg/ml blasticidin. Cells were tested for CX3CL1 expression by flow cytometric analysis and ELISA before the in vivo experiments. Parental cell lines transfected with the empty plasmid pBlast were used as controls.

ELISA.
CX3CL1 concentrations in the culture supernatants were measured with a specific ELISA using capture and detection CX3CL1 antibodies from R&D Systems (Minneapolis, MN).

In Vitro Chemotaxis Assay.
Chemotaxis was assayed in a 96-well chemotaxis chamber (NeuroProbe, Cabin John, MD). NK cells were purified from spleens with an NK purification kit (Miltenyi Biotec, Paris, France) according to the manufacturer’s instruction. Flow cytometric analysis confirmed that the enriched cell populations were 95% pure. Cells were labeled for 30 min at 37°C with 5-chloromethylfluorescein diacetate (Molecular Probes, Leiden, the Netherlands) in RPMI 1640 (Life Technologies, Inc., Cergy-Pontoise, France) and resuspended in HBSS supplemented with 0.1% BSA at 1 x 106 per milliliter. Dilutions of tumor cell culture supernatant and human recombinant CX3CL1 (Prepotech, Rocky Hill, NJ) were placed in the lower chamber, and 5 x 104 spleen-purified NK cells were seeded on the membrane. The 96-well plate was then incubated for 1 h at 37°C, 100% humidity, and 5% CO2. The filter top surface was rinsed with PBS, and the plate centrifuged for 2 min at 1500 rpm. Fluorescence was measured with a Packard Fusion microplate analyzer (Perkin-Elmer Life Sciences Inc., Boston, MA).

Animal Models.
Five to 10 mice per group received s.c. injections in the right flank with 2 x 105 tumor cells in 100 µl of PBS. Tumor size was measured three times a week with a caliper, and tumor volume was estimated from the following formula: width x length x (width + length)/2. Mice were sacrificed when the tumor volume reached ~15,000 mm3. When tested, 10 µg of immunoglobulin-CX3CL1 DNA plasmid or control DNA mixed with in vivo JetPei transfecting reagent (Qbiogen, Illkirch, France) were injected at the tumor site, on day 5 after tumor inoculation.

Flow Cytometry.
Cell surface antigens were characterized with a standard staining method with the following mAbs, except the PE-conjugated antihuman chemokine domain of CX3CL1 (clone 51637.11; R&D Systems, Abingdon, United Kingdom), and were from BD Biosciences PharMingen (Le Pont de Claix, France): FITC-conjugated antimouse CD3 (clone 145-2C11), PE-conjugated antimouse CD49/pan NK (DX5), peridinin chlorophyll-a protein cyanine 5.5-conjugated antimouse CD8 (clone Ly-2), biotin-conjugated antimouse CD4 (clone L3T4) plus allophycocyanin-streptavidin, PE-conjugated anti-H-2Kb (clone AF6-88.5), antimouse CD70 (FR70), and antimouse CD80 (B7-1). Cell suspensions were incubated with appropriate fluorochrome-conjugated mAbs and run for four-color fluorescence staining on a cytofluorometer (FACSCalibur, Becton Dickinson) and analyzed with Cell Quest software.

CX3CL1 Binding Assay.
Binding assays were performed with 125I-CX3CL1 (Amersham Pharmacia Biotech, Piscataway, NJ) in duplicate with 5 x 104 CX3CR1-expressing HEK cells, as described previously (25) . Briefly, cells were incubated in a total volume of 200 µl of PBS containing 1 mg/ml BSA and 0.01% azide (pH 7.4) with 50 pM 125I-CX3CL1 and increasing concentrations of unlabeled human CX3CL1 (PeproTech). After 2 h at 37°C, unbound chemokines were separated from cells by centrifugation in 1 ml of PBS with 10% sucrose. Gamma emissions were then counted in the cell pellet (1272 CLINIGAMMA; LKB Wallac, Saint Quentin en Yvelines, France).

Chimeric Immunoglobulin-CX3CL1 Construct.
PstI-tailed forward primer AAAACTGCAGATGGCTCCGATATCTCTGTCG and NotI-tailed reverse primer ATATGCGGCCGCGCCATTTCGAGTTAGGGC were used to amplify the signal sequence and chemokine domain of CX3CL1 corresponding to amino acids 1–100. The modified mouse IgG2a Fc domain, corresponding to amino acids 97–329 and derived from pVRC mIL-2/immunoglobulin (26) , a generous gift from Dr. D. Barouch (Division of Viral Pathogenesis, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA), was amplified with NotI-tailed primer ATAAGCGGCCGCACATCCCAGAGGGCCCACAATC and BglII-tailed primer GGAAGATCTTCATTTACCCGGAGGCCGGGAGAA. Amplification reactions were performed in standard conditions with 1 unit of Pfu DNA polymerase (Stratagene, La Jolla, CA). The PCR cycling began at 95°C for 5 min, followed by 20 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min, and ended with 10 min at 72°C. A 0.3-kb PstI-NotI CX3CL1 fragment and a 0.7-kb NotI-BglII immunoglobulin fragment were directly subcloned into a cloning site of pVRC plasmid, as described previously (26) . Low endotoxin plasmid was prepared on a large scale (ANANSA, Le Perray en Yvelines, France). Flow cytometric analysis, ELISA, and immunoblotting with the cell lysate and supernatant of Chinese hamster ovary cells transfected with this construct confirmed the expression of the chimeric protein, also produced and purified by ANANSA.

Statistical Analysis.
We handled, analyzed, and graphically represented the data with Prism 2.01 (GraphPad Software, San Diego, CA). Statistical comparisons used paired two-sample t tests for means and the nonparametric Mann-Whitney U test. Statistical significance was set at P < 0.05.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Production of Biologically Active CX3CL1 in the Transfected EL4 Lymphoma Cell Line.
The H-2b lymphoma EL4 and its derivative EG7, which expresses chicken ovalbumin peptides, were transfected with cDNA that encoded the full-length CX3CL1 or a control vector. CX3CL1-positive cells were then sorted by flow cytometry using a specific mAb directed against the extracellular chemokine domain of CX3CL1. The same mAb used for intracytoplasmic staining confirmed chemokine expression in both the CX3CL1-EL4 and CX3CL1-EG7 cell lines, as shown in Fig. 1ACitation (data not shown for EG7 cells). Although CX3CL1-EL4 cells were sorted for chemokine expression, approximately 30–50% did not express CX3CL1 (Fig. 1A)Citation . Repeated sorting did not improve expression, suggesting a rapid turnover of CX3CL1 in tumor cell lines.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Transfected EL4 tumor cells produce and secrete biologically active CX3CL1. The EL4 cell line was transfected with the CX3CL1 or control plasmid. A, CX3CL1 expression was compared by flow cytometry with a mAb directed against the extracellular domain of CX3CL1 in transfected cell lines. Dotted lines and bold lines represent, respectively, the control vector- and CX3CL1-transfected cell lines in the presence of anti-CX3CL1 mAb. B, production of CX3CL1 was measured by ELISA in the supernatant of EL4 and CX3CL1-EL4 cells cultured for 1, 24, 48, and 96 h. C, CX3CL1-EL4 supernatant is chemotactic for NK cells. Dilutions by one-half of the supernatants were tested for their potency to induce splenic NK cell migration. Chemotaxis in response to 10 nM recombinant CX3CL1 is also graphed. Results are expressed as percentage ± SE of mean of migrated NK cells. Data represent the mean of two experiments run in triplicate.

 
We investigated whether murine lymphoma produces effective proteases able to release the soluble form of CX3CL1. ELISA at different time points indicated that CX3CL1 was efficiently processed from the cell surface and that soluble CX3CL1 accumulated progressively in supernatant, reaching up to ~7 nM on day 4 after passage (Fig. 1B)Citation . Similar results were obtained with EG7 cells (data not shown). In addition, the EL4 or EG7 cells transfection did not affect MHC class I antigens, nor did it induce expression of costimulatory molecules such as CD70 and CD80, according to flow cytometry (data not shown). Furthermore, transfected tumor cell lines and their respective controls did not differ in their in vitro growth, measured after [3H]thymidine incorporation (data not shown). This finding suggests that CX3CL1 had no direct effect on EL4 cell proliferation.

Cell chemotaxis assays assessed and compared the functional potencies of the supernatants collected from control EL4 and CX3CL1-EL4 cell culture and of recombinant CX3CL1 (Fig. 1C)Citation . We chose to study NK cell chemotaxis in response to CX3CL1-EL4 supernatant because NK cells express CX3CR1 more highly than any other murine lymphocytes. The chemotaxis results in Fig. 1CCitation showed that supernatants from CX3CL1-EL4, diluted by half, repeatedly induced NK cell recruitment, as did 10 nM recombinant CX3CL1. NK chemotaxis was not affected by dilution of control supernatant. In similar experiments performed with NK cells from CX3CR1-/- mice, no migration in response to supernatants from CX3CL1-EL4 was detected, indicating that NK cells specifically migrated in response to CX3CL1 (data not shown). In conclusion, tumor cells transfected with a plasmid encoding the hCX3CL1 produced and secreted a chemokine that is biologically active for murine NK cells.

CX3CL1 Inhibited Tumor Development.
We next evaluated the ability of CX3CL1-transfected tumor cell lines to form solid tumors in mice. Tumors grew progressively and dose-dependently under the skin of C57BL/6 mice (data not shown). Reliable tumor establishment, however, required injection of at least 2 x 105 EL4 cells. In these conditions, all of the mice developed a solid tumor that was measurable on day 7 and grew over a period of 3 weeks (Fig. 2A)Citation . Growth of CX3CL1-EL4 tumors was, however, significantly slower than that of the control tumors. On day 20, the mean volume of the CX3CL1-EL4 tumors was half that of the controls. In a second model, we used EG7 cells, a more immunogenic cell line that expresses chicken ovalbumin. The EG7 tumors grew more slowly than the EL4 cells in C57BL/6 mice. After injection of 2 x 105 EG7 control cells, 90% of the mice developed a solid tumor by day 15 whereas only 25% of the CX3CL1-EG7 cell-injected mice had a tumor on day 30 (Fig. 2B)Citation . Constitutive expression of CX3CL1, therefore, inhibited solid tumor growth.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. CX3CL1 inhibits tumor development. C57BL/6 mice received s.c. injections of EL4 (A) or EG7 (B) cells transfected with control plasmid ({blacksquare}) or CX3CL1 plasmid ({square}). A, tumor volume was measured as described in "Materials and Methods" and expressed in mm3. Each data point represents the mean tumor volume ± SE of 16 mice. B, the number of mice without palpable tumor is indicated as a percentage of the total number of mice that received injections (n = 8).

 
The CX3CL1 Antitumor Effect Was T- and B-Cell Independent but NK Cell Dependent.
To determine whether immune effector cells were involved in the growth inhibition of solid tumors expressing CX3CL1, we repeated the injection of CX3CL1-transfected EL4 and EG7 cells in lymphocyte-deficient (Rag1-/-) mice. They were also protected by CX3CL1: the size of EL4 tumors was significantly reduced (Fig. 3A)Citation , and the frequency of EG7 tumors was decreased (Fig. 3B)Citation . These data demonstrate that the CX3CL1 antitumor effect is independent of T and B cells. We also investigated whether CX3CL1 generated antitumor immunity by injecting in the contralateral flank of tumor-bearing C57BL/6 mice. The absence of any effect on the subsequent challenge suggests that the CX3CL1 mechanisms that generate these antitumor growth effects is independent of antigen-specific immune response. To test the possibility that this effect might still be generated by a nonantigen-specific immune response involving NK cells, tumor cell lines were injected in NIH III mice deficient in lymphocytes and NK cells (Fig. 4A)Citation . EL4 and CX3CL1-EL4 tumor growth was indistinguishable in these animals. Taken together, these data demonstrate that NK cells play a crucial role in the antitumor effect mediated by CX3CL1.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. CX3CL1 inhibits tumor development in T-cell and B-cell-deficient mice. C57BL/10 Rag1-/- mice received s.c. injections of EL4 (A) or EG7 (B) cells transfected with control plasmid ({blacksquare}) or CX3CL1 plasmid ({square}). A, tumor volume was measured as described in "Materials and Methods" and expressed in mm3. Each data point represents the mean tumor volume ± SE of five mice. B, the number of mice without palpable tumor is indicated as a percentage of the total number of mice that received injections (n = 5).

 


View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. The in vivo CX3CL1 antitumor effect is dependent of innate immune response and CX3CR1 expression. NIH III (A) and CX3CR1-/- (B) mice received s.c. injections of EL4 cells transfected with control plasmid ({blacksquare}) or CX3CL1 plasmid ({square}). Tumor volume was measured as described in "Materials and Methods" and expressed in mm3. Each data point represents the mean tumor volume ± SE of five mice.

 
To test whether the protective effect of CX3CL1 requires the expression of its receptor, we performed similar experiments in CX3CR1-/- mice (Fig. 4B)Citation . The similar rates of EL4 tumor development in CX3CR1-/- and control animals indicates that CX3CR1 either does not have a direct effect on tumor growth or is dispensable, because of functional redundancy in the chemokine network. CX3CR1-/- mice did not, however, show any CX3CL1 antitumor activity, which suggests that NK cells expressing CX3CR1 mediate the CX3CL1 antitumor effect. The results in NIH III and CX3CR1-/- mice also indicated that the tumorigenicity of genetically modified tumor cell lines expressing CX3CL1 does not change through mechanisms related to cell culture selection bias independent of CX3CL1.

Tumor-secreted CX3CL1 Induced NK Cell Recruitment.
We investigated the leukocyte infiltration into tumors that did and did not express CX3CL1, as well as the ipsilateral draining lymph nodes. Organs and tumors were harvested between days 10 and 14, and flow cytometry using mAbs directed against CD3, CD4, CD8, and NK cells analyzed the cell contents. Typically, lymph nodes from EL4-injected mice contained 2.0 ± 0.2% Ly49+CD3- cells, 15.1 ± 1.6% CD4+CD3+ cells, and 13.6 ± 1.5% CD8+CD3+ T cells (Fig. 5A)Citation . The T-cell and NK cell content in lymph nodes did not differ between the mice receiving injections of control EL4 cells and those receiving CX3CL1-EL4 cells (Fig. 5B)Citation . Lymphocyte-associated tumor cell contents were composed of 5.9 ± 1.6% Ly49+CD3- cells, 5.7 ± 1.2% CD4+CD3+ cells, and 3.6 ± 0.5% CD8+CD3+ T cells (Fig. 5C)Citation . Surprisingly, the CX3CL1-producing tumors contained twice as many NK cells (10.6 ± 1.8%; P = 0.04). CX3CL1 may, therefore, affect NK cell trafficking directly. The percentages of CD4+CD3+ and CD8+CD3+ T cells did not differ, being 5.5 ± 1.1% and 1.9 ± 0.4%, respectively. The chemotactic effect of CX3CL1, thus, appeared to be restricted to NK cell attraction.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Local secretion of CX3CL1 increases NK cell infiltration into tumors. Mice were killed at different days after tumor cell line injections and paired for tumor volume. Tumors (A and B) and lymph nodes (C) were surgically removed, and single-cell suspensions were prepared. After staining with mAbs specific for CD3, CD4, CD8, and NK cells, cells were analyzed by fluorescence-activated cell sorting to measure the percentages of the subpopulation in the overall tumor infiltration. Tumor cells were excluded from the analysis based on size and structure. Representative stainings are shown in A, with percentages of cells indicated in each quadrant. B and C, results, shown as percentage ± SE, are from 10 mice in each control group ({blacksquare}) and CX3CL1 group ({square}) in two independent experiments.

 
The CX3CL1 Antitumor Effect Was IFN{gamma} and Perforin Dependent.
To identify the effector pathways that mediate the antitumor effects of CX3CL1, we repeated the tumor engraftment in knockout mice missing genes involved in tumor protection, such as IFN{gamma} and perforin. The CX3CL1 antitumor effect vanished completely in IFN{gamma}-/- mice (Fig. 6A)Citation and was reduced by half in perforin-/- mice (Fig. 6B)Citation . These results also indicate that cytolytic effector cells are involved in the CX3CL1 antitumor effect because perforin controls the cytotoxic potency of effector cells, including NK cells, and IFN{gamma} is a direct activator of NK cells.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. The in vivo CX3CL1 antitumor effect depends on IFN{gamma} and perforin. EL4 transfected with control plasmid ({blacksquare}) or CX3CL1 plasmid ({square}) were injected s.c. in C57BL/6 mice deficient for IFN{gamma} (A) and for perforin (B). Tumor volume was measured as described in "Materials and Methods" and expressed in mm3. Each data point represents the mean tumor volume ± SE of six mice.

 
Intratumoral DNA Injection of Chimeric Immunoglobulin-CX3CL1 Generated Strong Antitumor Activity.
We constructed a DNA plasmid called pVRC-CX3CL1 that fused the coding sequence of the CX3CL1 chemokine domain to the Fc{gamma}2a domain of immunoglobulin (26) . The chimeric protein immunoglobulin-CX3CL1 was tested in a conventional binding assay with CX3CR1-transfected HEK cells (Fig. 7A)Citation . Immunoglobulin-CX3CL1 potently competed for radiolabeled CX3CL1 bound to CX3CR1 with a half-maximal inhibitory concentration of approximately 1 nM. As described previously, no other recombinant chemokine, except CX3CL1, specifically binds to CX3CR1-transfected HEK cells (19) . We then determined the in vivo antitumor activity of the immunoglobulin-CX3CL1 by injecting 10 µg of pVRC-CX3CL1 or pVRC-immunoglobulin control plasmid into growing tumors 7 days after engraftment (Fig. 7B)Citation . One week afterward, the mean size of the tumor injected with pVRC-CX3CL1 was approximately half that of the tumor injected with the control plasmid (P < 0.05). This antitumor effect remains significant for a period of 20 days. Intratumoral injection of immunoglobulin-CX3CL1 was repeated in NIH III mice, and the antitumoral effect vanished (Fig. 7B)Citation . These results indicate that lymphocytes and NK cells are critical in the antitumor effect mediated by immunoglobulin-CX3CL1. These data are consistent with an antitumor effect caused by CX3CL1 expression in the tumor cell line and associated with increased NK cell infiltration. They support the use of DNA coding for chimeric immunoglobulin-CX3CL1 as a potential strategy to reduce the size of encapsulated solid tumors.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Chimeric immunoglobulin-CX3CL1 binds CX3CR1-expressing cells and generates antitumor activity. A, the binding properties of chimeric immunoglobulin-CX3CL1 and recombinant CX3CL1 were compared in a radioligand competition binding assay. Data represent the mean of two experiments run in duplicate and expressed as percentage ± SD of maximal specific binding. B, Seven days after EL4 tumor engraftment, plasmid coding for chimeric immunoglobulin-CX3CL1 (open symbols) and control immunoglobulin (filled symbols) were injected into the tumors of C57BL/6 (squares) or NIH III (circles) mice. Tumor volume was measured as described in "Materials and Methods" and expressed in mm3. Each data point represents the mean tumor volume ± SE of six mice.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we show that local production of CX3CL1 inhibits the development of s.c. solid tumors. The protective effect seemed to be mediated through increased recruitment of activated NK cells, the cytolytic function of which is directed against MHC class I targets. We validated, for the first time, the use of DNA coding for chimeric immunoglobulin-CX3CL1 as a potential strategy in cancer immunotherapy.

The role of chemokines in tumor development is ambiguous, because some appear to favor tumor growth (9, 10, 11, 12, 13) , but others promote antitumor responses (7 , 8 , 27) . The model for the latter activity proposes that chemokines first recruit effector cells in the tumor vicinity, then activate and exacerbate antitumor responses and may finally lead to antitumor immunity. Inhibition of tumor development has been mediated through different pathways that depend on the chemokine targets and tumor types (8 , 27) .

Here, we provide evidence that the CX3CL1 chemokine, the only member of the CX3C chemokine family, mediates antitumor activity. This effect seems to rely solely on NK cells because Rag-/- mice, devoid of B cells, T cells, and NK T cells, were protected by CX3CL1 whereas tumor cell growth in NIH III mice deficient in NK cells was unaffected. Furthermore, increased NK cell infiltration was observed at 10–14 days after tumor inoculation. Surprisingly, other cell types found in the tumors did not change (in particular, lymphocyte and monocyte content remained constant), although they have been reported to be responsive to human and murine CX3CL1 (14 , 16) . Tumor infiltration by monocytes and DC was assessed with mAbs directed against monocyte/macrophage marker F4/80 and DC marker CD11c, but cell recruitment did not seem to differ between control and CX3CL1-producing tumors. In humans, CX3CR1 is expressed on CD8 effector cells, as we (28) and others (20) have shown. Therapeutic tools based on CX3CL1 may recruit a wider range of cell types in humans.

In our model, CX3CL1 did not fully contain the growth of EL4 cells but blocked tumor formation induced by the less aggressive EG7 cell line. Several hypotheses may explain the failure to eradicate this poorly immunogenic tumor cell line. First, it is now clear that NK cells are ineffective in containing large tumors. Second, the CX3CL1 concentration may limit this. Third, CX3CL1 may recruit NK cells that are ineffective against MHC class I tumor cells; even when more NK cells were recruited, NK activity did not increase in the presence of CX3CL1 (data not shown). CX3CL1-EL4 cells on day 20 after injection expressed one-tenth the amount of CX3CL1 that they did in culture. The antibiotic pressure that maintains high CX3CL1 production in culture is absent in vivo, and the tumor cells ultimately may produce substantially less CX3CL1 in vivo. Thus, the CX3CL1 antitumor effect was greatly improved by using viral constructs to mediate chemokine production and maintaining high levels of in vivo transgene expression.

Unlike other chemokine-transfected EL4 cell lines that primarily secrete their product, the CX3CL1-transfected cell line also expresses the chemokine at the cell surface. Although soluble CX3CL1 is a potent murine NK cell chemoattractant, the potential role of membrane-anchored CX3CL1 is far from obvious. The potency of membrane CX3CL1 in capturing cells in flow conditions is not relevant here because the tumor is encapsulated. CX3CL1-mediated adherence enhances NK cell cytolytic activity against endothelial cells. This chemokine may, therefore, play a role in vascular damage (29) . It may also mediate angiogenesis in rheumatoid arthritis (30) . We did not, however, observe any neovascularization, that would, in any case, have favored tumor growth.

The CX3CL1 antitumor effect required IFN{gamma} production, probably because IFN{gamma} is a potent priming agent for NK cell responses. The capacity to secrete IFN{gamma} remains the most critical antitumor effector mechanism in vivo, because it directly inhibits tumor growth (31 , 32) and enhances antigen presentation through up-regulation of MHC class I on tumor cells (33, 34, 35) . Effector T cells (Tc1) from IFN{gamma}-/- mice are less effective than control T cells in controlling tumor growth (36 , 37) . The redistribution of T cells and macrophages to spleen of tumor-bearing mice is markedly lower from IFN{gamma}-/- mice than from control animals. This suggests that IFN{gamma} has a key role in deploying effector cells (37) . It is also a potent inducer of inflammatory chemokines, including CXCL10 (38) , CXCL9, and CX3CL1 (39 , 40) , that may participate in leukocyte deployment. Finally, CX3CL1 may amplify the Th1 polarizing loop, as described previously (41) .

We also demonstrated that the antitumor effect of CX3CL1 is dependent of CX3CR1 expression, because the EL4 tumors expressing, or not, CX3CL1 grew similarly in CX3CR1-/- mice. This finding also indicates that CX3CL1 antitumor activity relies on host responses and not on intrinsic modifications of tumor cell lines. Surprisingly, the growth of the untransfected EL4 tumors was also similar in CX3CR1-/- and control mice. Accordingly, either the physiopathological response against this type of tumor does not involve CX3CR1 or chemokine functional redundancy makes CX3CR1 dispensable. We also showed that therapeutic intervention pushes the host to exploiting new effector pathways to resolve disorders and that CX3CL1 may be able to mobilize NK cells in immuno-compromised environments to mount antitumor responses critical for immuno-compromised patients.

In conclusion, this study provides evidence that local production of CX3CL1 promotes antitumor activity by improving NK recruitment. The CX3CL1 was produced by transfecting tumor cell lines with appropriate plasmids or by directly injecting DNA coding for chimeric immunoglobulin-chemokines into the tumor. This strategy of using chemokines fused to immunoglobulin previously elicited strong humoral antitumor immunity (22 , 23) . Here, we chose to fuse CX3CL1 to the Fc domain of the immunoglobulin, a process that extends the period of cytokine efficacy by the half-life of the immunoglobulin (42) . This approach generated strong antitumor activity, mainly through recruitment of cytolytic NK cells. The large panel of chemokines with potent antitumor activity, together with recent advances in protein engineering, may lead to therapeutic tools that induce both humoral and cellular immune responses and may be very efficacious in the treatment of cancer.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Association pour la Recherche sur le Cancer, the Ligue Nationale contre le Cancer, the French Ministry of Research (Action Concertée Incitative "Jeunes chercheurs"), and association "Objectifs Recherche Vaccin SIDA" (ORVACS). E. L. and A. B. were supported by fellowships from the French Ministry of Research and Technology. M. I. received support from ORVACS. Back

2 These authors contributed equally to this work. Back

3 To whom requests for reprints should be addressed, at Institut National de la Santé et de la Recerche Médicale U543, Hôpital Pitié-Salpêtrière, 91 Boulevard de l’Hôpital, Assistance Publique-Hôpitaux de Paris, 75634 Paris cedex 13, France. Phone: 33-1407-79892; Fax: 33-1407-79734; E-mail: combad{at}ccr.jussieu.fr Back

4 The abbreviations used are: NK, natural killer; HEK, human embryonic kidney; PE, phycoerythrin; mAb, monoclonal antibody. Back

Received 1/27/03. Revised 7/17/03. Accepted 8/13/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Springer T. A. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell, 76: 301-314, 1994.[Medline]
  2. Campbell J. J., Butcher E. C. Chemokines in tissue-specific and microenvironment-specific lymphocyte homing. Curr. Opin. Immunol., 12: 336-341, 2000.[Medline]
  3. Rossi D., Zlotnik A. The biology of chemokines and their receptors. Annu. Rev. Immunol., 18: 217-242, 2000.[Medline]
  4. Homey B., Muller A., Zlotnik A. Chemokines: agents for the immunotherapy of cancer?. Nat. Rev. Immunol., 2: 175-184, 2002.[Medline]
  5. Zlotnik A., Yoshie O. Chemokines: a new classification system and their role in immunity. Immunity, 12: 121-127, 2000.[Medline]
  6. Wang J. M., Deng X., Gong W., Su S. Chemokines and their role in tumor growth and metastasis. J. Immunol. Methods, 220: 1-17, 1998.[Medline]
  7. Balkwill F., Mantovani A. Inflammation and cancer: back to Virchow?. Lancet, 357: 539-545, 2001.[Medline]
  8. Vicari A. P., Caux C. Chemokines in cancer. Cytokine Growth Factor Rev., 13: 143-154, 2002.[Medline]
  9. Muller A., Homey B., Soto H., Ge N., Catron D., Buchanan M. E., McClanahan T., Murphy E., Yuan W., Wagner S. N., Barrera J. L., Mohar A., Verastegui E., Zlotnik A. Involvement of chemokine receptors in breast cancer metastasis. Nature (Lond.), 410: 50-56, 2001.[Medline]
  10. Menten P., Saccani A., Dillen C., Wuyts A., Struyf S., Proost P., Mantovani A., Wang J. M., Van Damme J. Role of the autocrine chemokines MIP-1{alpha} and MIP-1ß in the metastatic behavior of murine T cell lymphoma. J. Leukocyte Biol., 72: 780-789, 2002.[Abstract/Free Full Text]
  11. Norgauer J., Metzner B., Schraufstatter I. Expression and growth-promoting function of the IL-8 receptor ß in human melanoma cells. J. Immunol., 156: 1132-1137, 1996.[Abstract]
  12. Owen J. D., Strieter R., Burdick M., Haghnegahdar H., Nanney L., Shattuck-Brandt R., Richmond A. Enhanced tumor-forming capacity for immortalized melanocytes expressing melanoma growth stimulatory activity/growth-regulated cytokine ß and {gamma} proteins. Int. J. Cancer, 73: 94-103, 1997.[Medline]
  13. Moore B. B., Arenberg D. A., Stoy K., Morgan T., Addison C. L., Morris S. B., Glass M., Wilke C., Xue Y. Y., Sitterding S., Kunkel S. L., Burdick M. D., Strieter R. M. Distinct CXC chemokines mediate tumorigenicity of prostate cancer cells. Am. J. Pathol., 154: 1503-1512, 1999.[Abstract/Free Full Text]
  14. Bazan J. F., Bacon K. B., Hardiman G., Wang W., Soo K., Rossi D., Greaves D. R., Zlotnik A., Schall T. J. A new class of membrane-bound chemokine with a CX3C motif. Nature (Lond.), 385: 640-644, 1997.[Medline]
  15. Matloubian M., David A., Engel S., Ryan J. E., Cyster J. G. A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat. Immunol., 1: 298-304, 2000.[Medline]
  16. Pan Y., Lloyd C., Zhou H., Dolich S., Deeds J., Gonzalo J. A., Vath J., Gosselin M., Ma J., Dussault B., Woolf E., Alperin G., Culpepper J., Gutierrez-Ramos J. C., Gearing D. Neurotactin, a membrane-anchored chemokine upregulated in brain inflammation. Nature (Lond.), 387: 611-617, 1997.[Medline]
  17. Imai T., Hieshima K., Haskell C., Baba M., Nagira M., Nishimura M., Kakizaki M., Takagi S., Nomiyama H., Schall T. J., Yoshie O. Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell, 91: 521-530, 1997.[Medline]
  18. Fong A. M., Robinson L. A., Steeber D. A., Tedder T. F., Yoshie O., Imai T., Patel D. D. Fractalkine and CX3CR1 mediate a novel mechanism of leukocyte capture, firm adhesion, and activation under physiologic flow. J. Exp. Med., 188: 1413-1419, 1998.[Abstract/Free Full Text]
  19. Combadiere C., Salzwedel K., Smith E. D., Tiffany H. L., Berger E. A., Murphy P. M. Identification of CX3CR1. A chemotactic receptor for the human CX3C chemokine fractalkine and a fusion coreceptor for HIV-1. J. Biol. Chem., 273: 23799-23804, 1998.[Abstract/Free Full Text]
  20. Nishimura M., Umehara H., Nakayama T., Yoneda O., Hieshima K., Kakizaki M., Dohmae N., Yoshie O., Imai T. Dual functions of fractalkine/CX3C ligand 1 in trafficking of perforin+/granzyme B+ cytotoxic effector lymphocytes that are defined by CX3CR1 expression. J. Immunol., 168: 6173-6180, 2002.[Abstract/Free Full Text]
  21. Jung S., Aliberti J., Graemmel P., Sunshine M. J., Kreutzberg G. W., Sher A., Littman D. R. Analysis of fractalkine receptor CX(3)CR1 function by targeted deletion and green fluorescent protein reporter gene insertion. Mol. Cell. Biol., 20: 4106-4114, 2000.[Abstract/Free Full Text]
  22. Biragyn A., Tani K., Grimm M. C., Weeks S., Kwak L. W. Genetic fusion of chemokines to a self tumor antigen induces protective, T-cell dependent antitumor immunity. Nat. Biotechnol., 17: 253-258, 1999.[Medline]
  23. Biragyn A., Surenhu M., Yang D., Ruffini P. A., Haines B. A., Klyushnenkova E., Oppenheim J. J., Kwak L. W. Mediators of innate immunity that target immature, but not mature, dendritic cells induce antitumor immunity when genetically fused with nonimmunogenic tumor antigens. J. Immunol., 167: 6644-6653, 2001.[Abstract/Free Full Text]
  24. Combadiere C., Potteaux S., Gao J. L., Esposito B., Casanova S., Lee E. J., Debre P., Tedgui A., Murphy P. M., Mallat Z. Decreased atherosclerotic lesion formation in CX3CR1/apolipoprotein E double knockout mice. Circulation, 107: 1009-1016, 2003.[Abstract/Free Full Text]
  25. Moatti D., Faure S., Fumeron F., Amara M., Seknadji P., McDermott D. H., Debre P., Aumont M. C., Murphy P. M., de Prost D., Combadiere C. Polymorphism in the fractalkine receptor CX3CR1 as a genetic risk factor for coronary artery disease. Blood, 97: 1925-1928, 2001.[Abstract/Free Full Text]
  26. Barouch D. H., Santra S., Steenbeke T. D., Zheng X. X., Perry H. C., Davies M. E., Freed D. C., Craiu A., Strom T. B., Shiver J. W., Letvin N. L. Augmentation and suppression of immune responses to an HIV-1 DNA vaccine by plasmid cytokine/Ig administration. J. Immunol., 161: 1875-1882, 1998.[Abstract/Free Full Text]
  27. Fujiwara H., Hamaoka T. Coordination of chemokine and adhesion systems in intratumoral T cell migration responsible for the induction of tumor regression. Int. Immunopharmacol., 1: 613-623, 2001.[Medline]
  28. Combadiere B., Faure S., Autran B., Debre P., Combadiere C. The chemokine receptor CX3CR1 controls homing and anti-viral potencies of CD8 effector-memory T lymphocytes in HIV-infected patients. AIDS, 17: 1279-1290, 2003.[Medline]
  29. Yoneda O., Imai T., Goda S., Inoue H., Yamauchi A., Okazaki T., Imai H., Yoshie O., Bloom E. T., Domae N., Umehara H. Fractalkine-mediated endothelial cell injury by NK cells. J. Immunol., 164: 4055-4062, 2000.[Abstract/Free Full Text]
  30. Volin M. V., Woods J. M., Amin M. A., Connors M. A., Harlow L. A., Koch A. E. Fractalkine: a novel angiogenic chemokine in rheumatoid arthritis. Am. J. Pathol., 159: 1521-1530, 2001.[Abstract/Free Full Text]
  31. Krasagakis K., Garbe C., Zouboulis C. C., Orfanos C. E. Growth control of melanoma cells and melanocytes by cytokines. Recent Res. Cancer Res., 139: 169-182, 1995.[Medline]
  32. Farrar J. D., Katz K. H., Windsor J., Thrush G., Scheuermann R. H., Uhr J. W., Street N. E. Cancer dormancy. VII. A regulatory role for CD8+ T cells and IFN-{gamma} in establishing and maintaining the tumor-dormant state. J. Immunol., 162: 2842-2849, 1999.[Abstract/Free Full Text]
  33. Boehm U., Klamp T., Groot M., Howard J. C. Cellular responses to interferon-{gamma}. Annu. Rev. Immunol., 15: 749-795, 1997.[Medline]
  34. Wong L. H., Hatzinisiriou I., Devenish R. J., Ralph S. J. IFN-{gamma} priming up-regulates IFN-stimulated gene factor 3 (ISGF3) components, augmenting responsiveness of IFN-resistant melanoma cells to type I IFNs. J. Immunol., 160: 5475-5484, 1998.[Abstract/Free Full Text]
  35. Dobrzanski M. J., Reome J. B., Dutton R. W. Immunopotentiating role of IFN-{gamma} in early and late stages of type 1 CD8 effector cell-mediated tumor rejection. Clin. Immunol., 98: 70-84, 2001.[Medline]
  36. Dobrzanski M. J., Reome J. B., Dutton R. W. Therapeutic effects of tumor-reactive type 1 and type 2 CD8+ T cell subpopulations in established pulmonary metastases. J. Immunol., 162: 6671-6680, 1999.[Abstract/Free Full Text]
  37. Helmich B. K., Dutton R. W. The role of adoptively transferred CD8 T cells and host cells in the control of the growth of the EG7 thymoma: factors that determine the relative effectiveness and homing properties of Tc1 and Tc2 effectors. J. Immunol., 166: 6500-6508, 2001.[Abstract/Free Full Text]
  38. Luster A. D., Unkeless J. C., Ravetch J. V. {gamma}-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature (Lond.), 315: 672-676, 1985.[Medline]
  39. Fujimoto K., Imaizumi T., Yoshida H., Takanashi S., Okumura K., Satoh K. Interferon-{gamma} stimulates fractalkine expression in human bronchial epithelial cells and regulates mononuclear cell adherence. Am. J. Respir. Cell Mol. Biol., 25: 233-238, 2001.[Abstract/Free Full Text]
  40. Ludwig A., Berkhout T., Moores K., Groot P., Chapman G. Fractalkine is expressed by smooth muscle cells in response to IFN-{gamma} and TNF-{alpha} and is modulated by metalloproteinase activity. J. Immunol., 168: 604-612, 2002.[Abstract/Free Full Text]
  41. Fraticelli P., Sironi M., Bianchi G., D’Ambrosio D., Albanesi C., Stoppacciaro A., Chieppa M., Allavena P., Ruco L., Girolomoni G., Sinigaglia F., Vecchi A., Mantovani A. Fractalkine (CX3CL1) as an amplification circuit of polarized Th1 responses. J. Clin. Invest., 107: 1173-1181, 2001.[Medline]
  42. Zheng X. X., Steele A. W., Nickerson P. W., Steurer W., Steiger J., Strom T. B. Administration of noncytolytic IL-10/Fc in murine models of lipopolysaccharide-induced septic shock and allogeneic islet transplantation. J. Immunol., 154: 5590-5600, 1995.[Abstract]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
K. Dorgham, A. Ghadiri, P. Hermand, M. Rodero, L. Poupel, M. Iga, O. Hartley, G. Gorochov, C. Combadiere, and P. Deterre
An engineered CX3CR1 antagonist endowed with anti-inflammatory activity
J. Leukoc. Biol., October 1, 2009; 86(4): 903 - 911.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Saudemont, F. Garcon, H. Yadi, M. Roche-Molina, N. Kim, A. Segonds-Pichon, A. Martin-Fontecha, K. Okkenhaug, and F. Colucci
p110{gamma} and p110{delta} isoforms of phosphoinositide 3-kinase differentially regulate natural killer cell migration in health and disease
PNAS, April 7, 2009; 106(14): 5795 - 5800.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. Sobolev, P. Stern, A. Lacy-Hulbert, and R. O. Hynes
Natural Killer Cells Require Selectins for Suppression of Subcutaneous Tumors
Cancer Res., March 15, 2009; 69(6): 2531 - 2539.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D Engelmann, D Koczan, P Ricken, U Rimpler, J Pahnke, Z Li, and B M Putzer
Transcriptome analysis in mouse tumors induced by Ret-MEN2/FMTC mutations reveals subtype-specific role in survival and interference with immune surveillance
Endocr. Relat. Cancer, March 1, 2009; 16(1): 211 - 224.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Rodero, Y. Marie, M. Coudert, E. Blondet, K. Mokhtari, A. Rousseau, W. Raoul, C. Carpentier, F. Sennlaub, P. Deterre, et al.
Polymorphism in the Microglial Cell-Mobilizing CX3CR1 Gene Is Associated With Survival in Patients With Glioblastoma
J. Clin. Oncol., December 20, 2008; 26(36): 5957 - 5964.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Hermand, F. Pincet, S. Carvalho, H. Ansanay, E. Trinquet, M. Daoudi, C. Combadiere, and P. Deterre
Functional Adhesiveness of the CX3CL1 Chemokine Requires Its Aggregation: ROLE OF THE TRANSMEMBRANE DOMAIN
J. Biol. Chem., October 31, 2008; 283(44): 30225 - 30234.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Wendel, I. E. Galani, E. Suri-Payer, and A. Cerwenka
Natural Killer Cell Accumulation in Tumors Is Dependent on IFN-{gamma} and CXCR3 Ligands
Cancer Res., October 15, 2008; 68(20): 8437 - 8445.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Jia, N. V. Serbina, K. Brandl, M. X. Zhong, I. M. Leiner, I. F. Charo, and E. G. Pamer
Additive Roles for MCP-1 and MCP-3 in CCR2-Mediated Recruitment of Inflammatory Monocytes during Listeria monocytogenes Infection
J. Immunol., May 15, 2008; 180(10): 6846 - 6853.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Cittera, M. Leidi, C. Buracchi, F. Pasqualini, S. Sozzani, A. Vecchi, J. D. Waterfield, M. Introna, and J. Golay
The CCL3 Family of Chemokines and Innate Immunity Cooperate In Vivo in the Eradication of an Established Lymphoma Xenograft by Rituximab
J. Immunol., May 15, 2007; 178(10): 6616 - 6623.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Matsuda, T. C. George, J. Hagman, and L. Gapin
Temporal Dissection of T-bet Functions
J. Immunol., March 15, 2007; 178(6): 3457 - 3465.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S Vitale, B Cambien, B F Karimdjee, R Barthel, P Staccini, C Luci, V Breittmayer, F Anjuere, A Schmid-Alliana, and H Schmid-Antomarchi
Tissue-specific differential antitumour effect of molecular forms of fractalkine in a mouse model of metastatic colon cancer
Gut, March 1, 2007; 56(3): 365 - 372.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Wald, I. D. Weiss, H. Wald, H. Shoham, Y. Bar-Shavit, K. Beider, E. Galun, L. Weiss, L. Flaishon, I. Shachar, et al.
IFN-{gamma} Acts on T Cells to Induce NK Cell Mobilization and Accumulation in Target Organs.
J. Immunol., April 15, 2006; 176(8): 4716 - 4729.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Y. Chen, S. R. Green, F. Almazan, and O. Quehenberger
The Amino Terminus and the Third Extracellular Loop of CX3CR1 Contain Determinants Critical for Distinct Receptor Functions
Mol. Pharmacol., March 1, 2006; 69(3): 857 - 865.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Barlic, D. H. McDermott, M. N. Merrell, J. Gonzales, L. E. Via, and P. M. Murphy
Interleukin (IL)-15 and IL-2 Reciprocally Regulate Expression of the Chemokine Receptor CX3CR1 through Selective NFAT1- and NFAT2-dependent Mechanisms
J. Biol. Chem., November 19, 2004; 279(47): 48520 - 48534.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Lavergne, C. Combadiere, M. Iga, A. Boissonnas, O. Bonduelle, M. Maho, P. Debre, and B. Combadiere
Intratumoral CC Chemokine Ligand 5 Overexpression Delays Tumor Growth and Increases Tumor Cell Infiltration
J. Immunol., September 15, 2004; 173(6): 3755 - 3762.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lavergne, E.
Right arrow Articles by Combadière, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lavergne, E.
Right arrow Articles by Combadière, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online