| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Laboratoire dImmunologie Cellulaire et Tissulaire, Institut National de la Santé et de la Recherche Médicale U543, Hôpital Pitié-Salpêtrière, 75634 Paris cedex 13, France [E. L., B. C., O. B., M. I., M. M., A. B., P. D., C. C.], and Laboratory of Host Defenses, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland 20892 [J-L. G., P. M. M.]
| ABSTRACT |
|---|
|
|
|---|
-/- and perforin-/- mice were resistant to CX3CL1 antitumor effect. Finally, intratumoral injection of DNA plasmid coding for a chimeric immunoglobulin presenting the CX3CL1 chemokine domain provided strong antitumor activity. Together, these data demonstrate that the CX3CL1 can reduce incidence and size of lymphoma in vivo through increased recruitment of activated NK cytotoxic cells. These findings offer the first evidence of the potential of chimeric immunoglobulin-chemokines in anticancer therapy. | INTRODUCTION |
|---|
|
|
|---|
CX3CL1 (previously known as fractalkine) is the only member of the CX3C subfamily (14) . Unlike any other chemokine, except CXCL16 (15) , it exists in two isoforms: a membrane-anchored form in which the chemokine module is presented to the cell surface on a long mucin-like stalk and a soluble form that results from proteolytic cleavage. Interestingly, the soluble CX3CL1 is reported to recruit lymphocytes and monocytes (14 , 16) , whereas membrane-bound CX3CL1 directly mediates the capture and firm adhesion of leukocytes expressing its receptor CX3CR1 under flow conditions (17 , 18) . CX3CR1 is a typical seven-transmembrane receptor coupled with Gi-type G proteins (17 , 19) . The expression pattern of CX3CR1 in the human lymphoid system is associated mostly with cytotoxic effector CD4+, CD8+, and NK4 cells (20) , but only with monocytes and NK and dendritic cells (DC) in mice (21) . We, thus, postulated that CX3CR1 might be a potential in vivo target for controlling lymphocyte and NK cell trafficking in cancer and might, thus, be used in antitumor therapy. We used two approaches to investigate this possibility: the standard inoculation into mice of tumor cells transfected with the chemokine of interest or direct injection into the tumor of DNA coding for chemokine fused to immunoglobulin, an approach pioneered by Biragyn et al. (22 , 23) . Here, we show that CX3CL1 recruits activated NK cells into the tumor and leads to in vivo reduction of tumor growth.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-deficient (IFN
-/-) mice came from The Jackson Laboratory (Bar Harbor, ME). The CX3CR1-/- mice have been described previously (24)
. All mice were housed at the Nouvelle Animalerie Commune of Pitié-Salpêtrière under specific pathogen-free conditions and used for experiments at 610 weeks of age. All animal experimental protocols were approved by the local animal experimentation ethics committee at the animal facility of Pitié-Salpêtrière.
Cell Lines.
The dimethylbenzanthracene-induced lymphoma EL4 and its chicken ovalbumin-expressing derivative EG7 were purchased from the American Type Culture Collection (Manassas, VA). HEK cells and CX3CR1-transfected HEK cells have been described previously (19)
. Transfast (Promega, Charbonnières, France) was used in accordance with the manufacturers instructions to transfect EL4 and EG7 cells with pBlast-CX3CL1 plasmid (Invivogen, San Diego, CA). Transfectants were selected by adding 10 µg/ml blasticidin (Invivogen) and then maintained with 5 µg/ml blasticidin. Cells were tested for CX3CL1 expression by flow cytometric analysis and ELISA before the in vivo experiments. Parental cell lines transfected with the empty plasmid pBlast were used as controls.
ELISA.
CX3CL1 concentrations in the culture supernatants were measured with a specific ELISA using capture and detection CX3CL1 antibodies from R&D Systems (Minneapolis, MN).
In Vitro Chemotaxis Assay.
Chemotaxis was assayed in a 96-well chemotaxis chamber (NeuroProbe, Cabin John, MD). NK cells were purified from spleens with an NK purification kit (Miltenyi Biotec, Paris, France) according to the manufacturers instruction. Flow cytometric analysis confirmed that the enriched cell populations were 95% pure. Cells were labeled for 30 min at 37°C with 5-chloromethylfluorescein diacetate (Molecular Probes, Leiden, the Netherlands) in RPMI 1640 (Life Technologies, Inc., Cergy-Pontoise, France) and resuspended in HBSS supplemented with 0.1% BSA at 1 x 106 per milliliter. Dilutions of tumor cell culture supernatant and human recombinant CX3CL1 (Prepotech, Rocky Hill, NJ) were placed in the lower chamber, and 5 x 104 spleen-purified NK cells were seeded on the membrane. The 96-well plate was then incubated for 1 h at 37°C, 100% humidity, and 5% CO2. The filter top surface was rinsed with PBS, and the plate centrifuged for 2 min at 1500 rpm. Fluorescence was measured with a Packard Fusion microplate analyzer (Perkin-Elmer Life Sciences Inc., Boston, MA).
Animal Models.
Five to 10 mice per group received s.c. injections in the right flank with 2 x 105 tumor cells in 100 µl of PBS. Tumor size was measured three times a week with a caliper, and tumor volume was estimated from the following formula: width x length x (width + length)/2. Mice were sacrificed when the tumor volume reached
15,000 mm3. When tested, 10 µg of immunoglobulin-CX3CL1 DNA plasmid or control DNA mixed with in vivo JetPei transfecting reagent (Qbiogen, Illkirch, France) were injected at the tumor site, on day 5 after tumor inoculation.
Flow Cytometry.
Cell surface antigens were characterized with a standard staining method with the following mAbs, except the PE-conjugated antihuman chemokine domain of CX3CL1 (clone 51637.11; R&D Systems, Abingdon, United Kingdom), and were from BD Biosciences PharMingen (Le Pont de Claix, France): FITC-conjugated antimouse CD3 (clone 145-2C11), PE-conjugated antimouse CD49/pan NK (DX5), peridinin chlorophyll-a protein cyanine 5.5-conjugated antimouse CD8 (clone Ly-2), biotin-conjugated antimouse CD4 (clone L3T4) plus allophycocyanin-streptavidin, PE-conjugated anti-H-2Kb (clone AF6-88.5), antimouse CD70 (FR70), and antimouse CD80 (B7-1). Cell suspensions were incubated with appropriate fluorochrome-conjugated mAbs and run for four-color fluorescence staining on a cytofluorometer (FACSCalibur, Becton Dickinson) and analyzed with Cell Quest software.
CX3CL1 Binding Assay.
Binding assays were performed with 125I-CX3CL1 (Amersham Pharmacia Biotech, Piscataway, NJ) in duplicate with 5 x 104 CX3CR1-expressing HEK cells, as described previously (25)
. Briefly, cells were incubated in a total volume of 200 µl of PBS containing 1 mg/ml BSA and 0.01% azide (pH 7.4) with 50 pM 125I-CX3CL1 and increasing concentrations of unlabeled human CX3CL1 (PeproTech). After 2 h at 37°C, unbound chemokines were separated from cells by centrifugation in 1 ml of PBS with 10% sucrose. Gamma emissions were then counted in the cell pellet (1272 CLINIGAMMA; LKB Wallac, Saint Quentin en Yvelines, France).
Chimeric Immunoglobulin-CX3CL1 Construct.
PstI-tailed forward primer AAAACTGCAGATGGCTCCGATATCTCTGTCG and NotI-tailed reverse primer ATATGCGGCCGCGCCATTTCGAGTTAGGGC were used to amplify the signal sequence and chemokine domain of CX3CL1 corresponding to amino acids 1100. The modified mouse IgG2a Fc domain, corresponding to amino acids 97329 and derived from pVRC mIL-2/immunoglobulin (26)
, a generous gift from Dr. D. Barouch (Division of Viral Pathogenesis, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA), was amplified with NotI-tailed primer ATAAGCGGCCGCACATCCCAGAGGGCCCACAATC and BglII-tailed primer GGAAGATCTTCATTTACCCGGAGGCCGGGAGAA. Amplification reactions were performed in standard conditions with 1 unit of Pfu DNA polymerase (Stratagene, La Jolla, CA). The PCR cycling began at 95°C for 5 min, followed by 20 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min, and ended with 10 min at 72°C. A 0.3-kb PstI-NotI CX3CL1 fragment and a 0.7-kb NotI-BglII immunoglobulin fragment were directly subcloned into a cloning site of pVRC plasmid, as described previously (26)
. Low endotoxin plasmid was prepared on a large scale (ANANSA, Le Perray en Yvelines, France). Flow cytometric analysis, ELISA, and immunoblotting with the cell lysate and supernatant of Chinese hamster ovary cells transfected with this construct confirmed the expression of the chimeric protein, also produced and purified by ANANSA.
Statistical Analysis.
We handled, analyzed, and graphically represented the data with Prism 2.01 (GraphPad Software, San Diego, CA). Statistical comparisons used paired two-sample t tests for means and the nonparametric Mann-Whitney U test. Statistical significance was set at P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
7 nM on day 4 after passage (Fig. 1B)
Cell chemotaxis assays assessed and compared the functional potencies of the supernatants collected from control EL4 and CX3CL1-EL4 cell culture and of recombinant CX3CL1 (Fig. 1C)
. We chose to study NK cell chemotaxis in response to CX3CL1-EL4 supernatant because NK cells express CX3CR1 more highly than any other murine lymphocytes. The chemotaxis results in Fig. 1C
showed that supernatants from CX3CL1-EL4, diluted by half, repeatedly induced NK cell recruitment, as did 10 nM recombinant CX3CL1. NK chemotaxis was not affected by dilution of control supernatant. In similar experiments performed with NK cells from CX3CR1-/- mice, no migration in response to supernatants from CX3CL1-EL4 was detected, indicating that NK cells specifically migrated in response to CX3CL1 (data not shown). In conclusion, tumor cells transfected with a plasmid encoding the hCX3CL1 produced and secreted a chemokine that is biologically active for murine NK cells.
CX3CL1 Inhibited Tumor Development.
We next evaluated the ability of CX3CL1-transfected tumor cell lines to form solid tumors in mice. Tumors grew progressively and dose-dependently under the skin of C57BL/6 mice (data not shown). Reliable tumor establishment, however, required injection of at least 2 x 105 EL4 cells. In these conditions, all of the mice developed a solid tumor that was measurable on day 7 and grew over a period of 3 weeks (Fig. 2A)
. Growth of CX3CL1-EL4 tumors was, however, significantly slower than that of the control tumors. On day 20, the mean volume of the CX3CL1-EL4 tumors was half that of the controls. In a second model, we used EG7 cells, a more immunogenic cell line that expresses chicken ovalbumin. The EG7 tumors grew more slowly than the EL4 cells in C57BL/6 mice. After injection of 2 x 105 EG7 control cells, 90% of the mice developed a solid tumor by day 15 whereas only 25% of the CX3CL1-EG7 cell-injected mice had a tumor on day 30 (Fig. 2B)
. Constitutive expression of CX3CL1, therefore, inhibited solid tumor growth.
|
|
|
Tumor-secreted CX3CL1 Induced NK Cell Recruitment.
We investigated the leukocyte infiltration into tumors that did and did not express CX3CL1, as well as the ipsilateral draining lymph nodes. Organs and tumors were harvested between days 10 and 14, and flow cytometry using mAbs directed against CD3, CD4, CD8, and NK cells analyzed the cell contents. Typically, lymph nodes from EL4-injected mice contained 2.0 ± 0.2% Ly49+CD3- cells, 15.1 ± 1.6% CD4+CD3+ cells, and 13.6 ± 1.5% CD8+CD3+ T cells (Fig. 5A)
. The T-cell and NK cell content in lymph nodes did not differ between the mice receiving injections of control EL4 cells and those receiving CX3CL1-EL4 cells (Fig. 5B)
. Lymphocyte-associated tumor cell contents were composed of 5.9 ± 1.6% Ly49+CD3- cells, 5.7 ± 1.2% CD4+CD3+ cells, and 3.6 ± 0.5% CD8+CD3+ T cells (Fig. 5C)
. Surprisingly, the CX3CL1-producing tumors contained twice as many NK cells (10.6 ± 1.8%; P = 0.04). CX3CL1 may, therefore, affect NK cell trafficking directly. The percentages of CD4+CD3+ and CD8+CD3+ T cells did not differ, being 5.5 ± 1.1% and 1.9 ± 0.4%, respectively. The chemotactic effect of CX3CL1, thus, appeared to be restricted to NK cell attraction.
|
and Perforin Dependent.
and perforin. The CX3CL1 antitumor effect vanished completely in IFN
-/- mice (Fig. 6A)
is a direct activator of NK cells.
|
2a domain of immunoglobulin (26)
. The chimeric protein immunoglobulin-CX3CL1 was tested in a conventional binding assay with CX3CR1-transfected HEK cells (Fig. 7A)
|
| DISCUSSION |
|---|
|
|
|---|
The role of chemokines in tumor development is ambiguous, because some appear to favor tumor growth (9, 10, 11, 12, 13) , but others promote antitumor responses (7 , 8 , 27) . The model for the latter activity proposes that chemokines first recruit effector cells in the tumor vicinity, then activate and exacerbate antitumor responses and may finally lead to antitumor immunity. Inhibition of tumor development has been mediated through different pathways that depend on the chemokine targets and tumor types (8 , 27) .
Here, we provide evidence that the CX3CL1 chemokine, the only member of the CX3C chemokine family, mediates antitumor activity. This effect seems to rely solely on NK cells because Rag-/- mice, devoid of B cells, T cells, and NK T cells, were protected by CX3CL1 whereas tumor cell growth in NIH III mice deficient in NK cells was unaffected. Furthermore, increased NK cell infiltration was observed at 1014 days after tumor inoculation. Surprisingly, other cell types found in the tumors did not change (in particular, lymphocyte and monocyte content remained constant), although they have been reported to be responsive to human and murine CX3CL1 (14 , 16) . Tumor infiltration by monocytes and DC was assessed with mAbs directed against monocyte/macrophage marker F4/80 and DC marker CD11c, but cell recruitment did not seem to differ between control and CX3CL1-producing tumors. In humans, CX3CR1 is expressed on CD8 effector cells, as we (28) and others (20) have shown. Therapeutic tools based on CX3CL1 may recruit a wider range of cell types in humans.
In our model, CX3CL1 did not fully contain the growth of EL4 cells but blocked tumor formation induced by the less aggressive EG7 cell line. Several hypotheses may explain the failure to eradicate this poorly immunogenic tumor cell line. First, it is now clear that NK cells are ineffective in containing large tumors. Second, the CX3CL1 concentration may limit this. Third, CX3CL1 may recruit NK cells that are ineffective against MHC class I tumor cells; even when more NK cells were recruited, NK activity did not increase in the presence of CX3CL1 (data not shown). CX3CL1-EL4 cells on day 20 after injection expressed one-tenth the amount of CX3CL1 that they did in culture. The antibiotic pressure that maintains high CX3CL1 production in culture is absent in vivo, and the tumor cells ultimately may produce substantially less CX3CL1 in vivo. Thus, the CX3CL1 antitumor effect was greatly improved by using viral constructs to mediate chemokine production and maintaining high levels of in vivo transgene expression.
Unlike other chemokine-transfected EL4 cell lines that primarily secrete their product, the CX3CL1-transfected cell line also expresses the chemokine at the cell surface. Although soluble CX3CL1 is a potent murine NK cell chemoattractant, the potential role of membrane-anchored CX3CL1 is far from obvious. The potency of membrane CX3CL1 in capturing cells in flow conditions is not relevant here because the tumor is encapsulated. CX3CL1-mediated adherence enhances NK cell cytolytic activity against endothelial cells. This chemokine may, therefore, play a role in vascular damage (29) . It may also mediate angiogenesis in rheumatoid arthritis (30) . We did not, however, observe any neovascularization, that would, in any case, have favored tumor growth.
The CX3CL1 antitumor effect required IFN
production, probably because IFN
is a potent priming agent for NK cell responses. The capacity to secrete IFN
remains the most critical antitumor effector mechanism in vivo, because it directly inhibits tumor growth (31
, 32)
and enhances antigen presentation through up-regulation of MHC class I on tumor cells (33, 34, 35)
. Effector T cells (Tc1) from IFN
-/- mice are less effective than control T cells in controlling tumor growth (36
, 37)
. The redistribution of T cells and macrophages to spleen of tumor-bearing mice is markedly lower from IFN
-/- mice than from control animals. This suggests that IFN
has a key role in deploying effector cells (37)
. It is also a potent inducer of inflammatory chemokines, including CXCL10 (38)
, CXCL9, and CX3CL1 (39
, 40)
, that may participate in leukocyte deployment. Finally, CX3CL1 may amplify the Th1 polarizing loop, as described previously (41)
.
We also demonstrated that the antitumor effect of CX3CL1 is dependent of CX3CR1 expression, because the EL4 tumors expressing, or not, CX3CL1 grew similarly in CX3CR1-/- mice. This finding also indicates that CX3CL1 antitumor activity relies on host responses and not on intrinsic modifications of tumor cell lines. Surprisingly, the growth of the untransfected EL4 tumors was also similar in CX3CR1-/- and control mice. Accordingly, either the physiopathological response against this type of tumor does not involve CX3CR1 or chemokine functional redundancy makes CX3CR1 dispensable. We also showed that therapeutic intervention pushes the host to exploiting new effector pathways to resolve disorders and that CX3CL1 may be able to mobilize NK cells in immuno-compromised environments to mount antitumor responses critical for immuno-compromised patients.
In conclusion, this study provides evidence that local production of CX3CL1 promotes antitumor activity by improving NK recruitment. The CX3CL1 was produced by transfecting tumor cell lines with appropriate plasmids or by directly injecting DNA coding for chimeric immunoglobulin-chemokines into the tumor. This strategy of using chemokines fused to immunoglobulin previously elicited strong humoral antitumor immunity (22 , 23) . Here, we chose to fuse CX3CL1 to the Fc domain of the immunoglobulin, a process that extends the period of cytokine efficacy by the half-life of the immunoglobulin (42) . This approach generated strong antitumor activity, mainly through recruitment of cytolytic NK cells. The large panel of chemokines with potent antitumor activity, together with recent advances in protein engineering, may lead to therapeutic tools that induce both humoral and cellular immune responses and may be very efficacious in the treatment of cancer.
| FOOTNOTES |
|---|
1 Supported by grants from the Association pour la Recherche sur le Cancer, the Ligue Nationale contre le Cancer, the French Ministry of Research (Action Concertée Incitative "Jeunes chercheurs"), and association "Objectifs Recherche Vaccin SIDA" (ORVACS). E. L. and A. B. were supported by fellowships from the French Ministry of Research and Technology. M. I. received support from ORVACS. ![]()
2 These authors contributed equally to this work. ![]()
3 To whom requests for reprints should be addressed, at Institut National de la Santé et de la Recerche Médicale U543, Hôpital Pitié-Salpêtrière, 91 Boulevard de lHôpital, Assistance Publique-Hôpitaux de Paris, 75634 Paris cedex 13, France. Phone: 33-1407-79892; Fax: 33-1407-79734; E-mail: combad{at}ccr.jussieu.fr ![]()
4 The abbreviations used are: NK, natural killer; HEK, human embryonic kidney; PE, phycoerythrin; mAb, monoclonal antibody. ![]()
Received 1/27/03. Revised 7/17/03. Accepted 8/13/03.
| REFERENCES |
|---|
|
|
|---|
and MIP-1ß in the metastatic behavior of murine T cell lymphoma. J. Leukocyte Biol., 72: 780-789, 2002.
proteins. Int. J. Cancer, 73: 94-103, 1997.[Medline]
in establishing and maintaining the tumor-dormant state. J. Immunol., 162: 2842-2849, 1999.
. Annu. Rev. Immunol., 15: 749-795, 1997.[Medline]
priming up-regulates IFN-stimulated gene factor 3 (ISGF3) components, augmenting responsiveness of IFN-resistant melanoma cells to type I IFNs. J. Immunol., 160: 5475-5484, 1998.
in early and late stages of type 1 CD8 effector cell-mediated tumor rejection. Clin. Immunol., 98: 70-84, 2001.[Medline]
-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature (Lond.), 315: 672-676, 1985.[Medline]
stimulates fractalkine expression in human bronchial epithelial cells and regulates mononuclear cell adherence. Am. J. Respir. Cell Mol. Biol., 25: 233-238, 2001.
and TNF-
and is modulated by metalloproteinase activity. J. Immunol., 168: 604-612, 2002.This article has been cited by other articles:
![]() |
A. Saudemont, F. Garcon, H. Yadi, M. Roche-Molina, N. Kim, A. Segonds-Pichon, A. Martin-Fontecha, K. Okkenhaug, and F. Colucci p110{gamma} and p110{delta} isoforms of phosphoinositide 3-kinase differentially regulate natural killer cell migration in health and disease PNAS, April 7, 2009; 106(14): 5795 - 5800. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Sobolev, P. Stern, A. Lacy-Hulbert, and R. O. Hynes Natural Killer Cells Require Selectins for Suppression of Subcutaneous Tumors Cancer Res., March 15, 2009; 69(6): 2531 - 2539. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Engelmann, D Koczan, P Ricken, U Rimpler, J Pahnke, Z Li, and B M Putzer Transcriptome analysis in mouse tumors induced by Ret-MEN2/FMTC mutations reveals subtype-specific role in survival and interference with immune surveillance Endocr. Relat. Cancer, March 1, 2009; 16(1): 211 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rodero, Y. Marie, M. Coudert, E. Blondet, K. Mokhtari, A. Rousseau, W. Raoul, C. Carpentier, F. Sennlaub, P. Deterre, et al. Polymorphism in the Microglial Cell-Mobilizing CX3CR1 Gene Is Associated With Survival in Patients With Glioblastoma J. Clin. Oncol., December 20, 2008; 26(36): 5957 - 5964. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hermand, F. Pincet, S. Carvalho, H. Ansanay, E. Trinquet, M. Daoudi, C. Combadiere, and P. Deterre Functional Adhesiveness of the CX3CL1 Chemokine Requires Its Aggregation: ROLE OF THE TRANSMEMBRANE DOMAIN J. Biol. Chem., October 31, 2008; 283(44): 30225 - 30234. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wendel, I. E. Galani, E. Suri-Payer, and A. Cerwenka Natural Killer Cell Accumulation in Tumors Is Dependent on IFN-{gamma} and CXCR3 Ligands Cancer Res., October 15, 2008; 68(20): 8437 - 8445. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hyakudomi, T. Matsubara, R. Hyakudomi, T. Yamamoto, S. Kinugasa, A. Yamanoi, R. Maruyama, and T. Tanaka Increased Expression of Fractalkine is Correlated with a Better Prognosis and an Increased Number of Both CD8+ T Cells and Natural Killer Cells in Gastric Adenocarcinoma Ann. Surg. Oncol., June 1, 2008; 15(6): 1775 - 1782. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jia, N. V. Serbina, K. Brandl, M. X. Zhong, I. M. Leiner, I. F. Charo, and E. G. Pamer Additive Roles for MCP-1 and MCP-3 in CCR2-Mediated Recruitment of Inflammatory Monocytes during Listeria monocytogenes Infection J. Immunol., May 15, 2008; 180(10): 6846 - 6853. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cittera, M. Leidi, C. Buracchi, F. Pasqualini, S. Sozzani, A. Vecchi, J. D. Waterfield, M. Introna, and J. Golay The CCL3 Family of Chemokines and Innate Immunity Cooperate In Vivo in the Eradication of an Established Lymphoma Xenograft by Rituximab J. Immunol., May 15, 2007; 178(10): 6616 - 6623. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, T. C. George, J. Hagman, and L. Gapin Temporal Dissection of T-bet Functions J. Immunol., March 15, 2007; 178(6): 3457 - 3465. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Vitale, B Cambien, B F Karimdjee, R Barthel, P Staccini, C Luci, V Breittmayer, F Anjuere, A Schmid-Alliana, and H Schmid-Antomarchi Tissue-specific differential antitumour effect of molecular forms of fractalkine in a mouse model of metastatic colon cancer Gut, March 1, 2007; 56(3): 365 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Wald, I. D. Weiss, H. Wald, H. Shoham, Y. Bar-Shavit, K. Beider, E. Galun, L. Weiss, L. Flaishon, I. Shachar, et al. IFN-{gamma} Acts on T Cells to Induce NK Cell Mobilization and Accumulation in Target Organs. J. Immunol., April 15, 2006; 176(8): 4716 - 4729. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, S. R. Green, F. Almazan, and O. Quehenberger The Amino Terminus and the Third Extracellular Loop of CX3CR1 Contain Determinants Critical for Distinct Receptor Functions Mol. Pharmacol., March 1, 2006; 69(3): 857 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Barlic, D. H. McDermott, M. N. Merrell, J. Gonzales, L. E. Via, and P. M. Murphy Interleukin (IL)-15 and IL-2 Reciprocally Regulate Expression of the Chemokine Receptor CX3CR1 through Selective NFAT1- and NFAT2-dependent Mechanisms J. Biol. Chem., November 19, 2004; 279(47): 48520 - 48534. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lavergne, C. Combadiere, M. Iga, A. Boissonnas, O. Bonduelle, M. Maho, P. Debre, and B. Combadiere Intratumoral CC Chemokine Ligand 5 Overexpression Delays Tumor Growth and Increases Tumor Cell Infiltration J. Immunol., September 15, 2004; 173(6): 3755 - 3762. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |