Cancer Research Donn Young  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teramoto, K.
Right arrow Articles by Ogasawara, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Teramoto, K.
Right arrow Articles by Ogasawara, K.
[Cancer Research 63, 7920-7925, November 15, 2003]
© 2003 American Association for Cancer Research


Regular Articles

Deoxyribonucleic Acid (DNA) Encoding a Pan-Major Histocompatibility Complex Class II Peptide Analogue Augmented Antigen-specific Cellular Immunity and Suppressive Effects on Tumor Growth Elicited by DNA Vaccine Immunotherapy

Koji Teramoto1, Keiichi Kontani1, Yoshitomo Ozaki1, Satoru Sawai1, Noriaki Tezuka1, Toshi Nagata4, Shozo Fujino1, Yasushi Itoh2, Osamu Taguchi5, Yukio Koide4, Tohru Asai1, Iwao Ohkubo3 and Kazumasa Ogasawara2

Departments of
1 Surgery,
2 Pathology,
3 Medical Biochemistry, Shiga University of Medical Science, Otsu;
4 Department of Microbiology Immunology, Hamamatsu University School of Medicine, Hamamatsu;
5 Division of Molecular Pathology, Aichi Cancer Center Research Institute, Nagoya, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vaccine immunotherapy must induce helper and cytotoxic cell-mediated immunity to generate the powerful antitumor immune responses needed to suppress cancer progression. We reported previously that a 16-amino acid peptide analogue derived from pigeon cytochrome c can bind broad ranges of MHC class II types and activate helper T cells in mice. To determine whether DNA encoding the Pan-MHC class II IA peptide (Pan-IA) can increase the efficacy of tumor suppression by DNA vaccine immunotherapy targeting tumor antigens, Pan-IA DNA was administered with ovalbumin (OVA) DNA to C57BL/6 mice bearing the OVA-expressing tumor cell line E.G7. Specific proliferative responses to and cytotoxic activities against OVA-expressing targets were induced in mice vaccinated with both OVA and Pan-IA DNA but not in those vaccinated with OVA DNA alone or control DNA plus Pan-IA DNA. Growth of E.G7 cells was suppressed only by combined vaccination with OVA and Pan-IA DNA, and tumors in five of the nine mice that received this combined vaccination were eradicated completely. In those mice, the frequency of CD8-positive T cells reactive with OVA257–264 peptides in the context of H-2Kb was significantly increased in the tumor site. Furthermore, immunofluorescent study of the inoculated tumors revealed increased accumulation of both CD4- and CD8-positive T cells producing IFN-{gamma} in the tumor only by this vaccine protocol. The data suggest that Pan-IA DNA can augment suppressive effects of DNA vaccines on tumor growth by increasing numbers of antigen-specific CTLs and helper T cells. This is the first study in which established tumors have been eradicated successfully by vaccination with DNA corresponding to CTL epitopes and helper T cell epitopes. Our animal model may contribute to the development of therapeutic DNA vaccines against cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To obtain sufficiently powerful antitumor immunity to suppress cancer progression by vaccine immunotherapy, not only cytotoxic but also helper T cell function must be activated (1, 2, 3, 4) . Some helper epitopes have been identified in the same or different molecules in which CTL epitopes are located, and they increase the efficacy of cytotoxic activity against tumor cells (5, 6, 7, 8, 9) . Vaccine immunotherapy for cancer would be ideal if a single helper epitope could enhance any antigen-specific cytotoxic activity of CTLs. We reported previously that a peptide analogue, AEGFSYTVANKAKGIT, which was prepared from the pigeon cytochrome c (p43–58) with a two-residue substitution (D to V at 50 and N to A at 54), efficiently stimulated T lymphocytes and that it could be presented by various types of mouse MHC class II molecules (IAb,d,q,s; Refs. 8 and 9 ). This peptide analogue should be useful in vaccine immunotherapy for cancer as an adjuvant or a helper T cell activator to efficiently elicit antitumor immunity.

Vaccination with DNA encoding tumor antigens enables maintenance of a high level of tumor antigen expression at the vaccination site and results in the elicitation of both humoral immunity and cellular immunity specific for DNA-encoding antigens (10, 11, 12) . Furthermore, DNA vaccines are inexpensive and simple to use once a DNA vector is constructed, and they do not require adjuvants. Thus, DNA vaccines should be more applicable to clinical cancer immunotherapy than peptide or cancer cell vaccines or adoptive effector cell transfer immunotherapy. We reported previously that DNA vaccines targeting MUC1 tumor antigen could not eradicate MUC1-positive tumors in mice although the vaccine elicited strong anti-MUC1 immunity (13) . This finding suggested that cytotoxic cell-mediated immune responses induced by the vaccine should be enhanced.

The aim of the present study was to determine whether antitumor immunity induced by DNA vaccines targeting tumor antigens can be sufficiently augmented to suppress tumor growth in vivo by covaccination with DNA encoding a Pan-IA peptide analogue. Here, we describe a new DNA vaccine protocol that considerably enhances anticancer immunity in a murine model.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Mice.
Female C57BL/6 mice, 6–8 weeks of age, were purchased from CLEA Japan Inc. (Tokyo, Japan) and maintained under specific pathogen-free conditions.

Murine lymphoma cell lines EL4 and E.G7, generated by transducing the chicken OVA6 gene into EL4 cells, were purchased from American Type Culture Collection (Manassas, VA). These cells were maintained in RPMI 1640 supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine, 100 units/ml penicillin G, and 0.1 mg/ml streptomycin (all from Life Technologies, Inc., Tokyo, Japan) in a humidified atmosphere of 5% CO2 at 37°C.

Antibodies.
Anti-OVA polyclonal antibody was provided by Cortex Biochem, Inc. (San Leandro, CA). Horseradish peroxidase-conjugated antirabbit and antimouse immunoglobulin antibodies were purchased from ICN Pharmaceutical Inc. (Aurora, OH). Antimouse CD4 (L3T4) and CD8 (Lyt-2.2) monoclonal antibodies were purified by protein A-Sepharose column chromatography (Zymed Laboratories, Inc., San Francisco, CA) from the ascites of female severe combined immunodeficient mice (Charles River Inc., Hino, Japan) that had received i.p. inoculations of the hybridoma cell lines GK1.5 and 2.43 (American Type Culture Collection), respectively. Mouse IgG was purchased from DAKO (Kyoto, Japan). FITC-conjugated antimouse CD8 monoclonal antibody, PE-conjugated antimouse CD4 and CD8 monoclonal antibodies, and FITC-conjugated anti-IFN-{gamma} monoclonal antibodies were purchased from PharMingen (Tokyo, Japan).

Immunofluorescent Staining.
Tumor tissues resected from the vaccinated mice were frozen, sliced, and fixed with ethanol. The sections were incubated with PE-conjugated anti-CD4 or -CD8 or FITC-conjugated anti-IFN-{gamma} monoclonal antibodies at 37°C for 60 min, washed in PBS, and then examined using a fluorescence microscope.

Synthetic Peptides and Plasmid DNA.
Pan-IA peptides (AEGFSYTVANKAKGIT) that were derived from pigeon cytochrome c (p43–58) with two-residue substitution (D to V at 50 and N to A at 54) and the H-2Kb-restricted CTL epitope in OVA, SIINFEKL (257–264), were synthesized commercially by Kurabo Industries Ltd. (Osaka, Japan).

An expression plasmid vector, pcDNA/OVA, was prepared by cloning the full-length OVA cDNA obtained by digestion with EcoRI (Toyobo Inc., Osaka, Japan) from pAc-neo-OVA (a gift from Dr. Michael J. Bevan, Department of Immunology, University of Washington, Seattle, WA) into pcDNA3.1 (Invitrogen, Carlsbad, CA). To prepare a plasmid vector containing Pan-IA DNA (pcDNA/IA), the following 70-mer oligonucleotide was commercially synthesized by Sigma Genosys Japan (Ishikari, Japan): ATAGGATCCACCATGGCTGAAGGATTCTCTTACACAGTTGCCAACAAGGCTAAAGGCATCACCGAATTCG. The nucleotide sequence of the fragment consists of a cap at the 5' end, a BamHI restriction site, a Kozac sequence, a methionine start codon, a Pan-IA-coding sequence, an EcoRI restriction site, and a cap at the 3' end. The oligonucleotide (200 µmol) was transferred to a 500-µl microtube in 10 µl of reaction mixture containing 10x DNA polymerase buffer and allowed to hybridize at room temperature for 60 min. Double-stranded DNA oligomers were generated by mixing 5 units of Klenow fragment of Escherichia coli DNA polymerase I and 20 nmol of dNTP mix (all from Takara Shuzo Co. Ltd., Otsu, Japan) at 23°C for 3 h. The resulting dimers were digested with BamHI and EcoRI (Takara Shuzo Co. Ltd.), resolved by gel electrophoresis, and purified from agarose using a Gene Clean Kit II (BIO 101 Inc., Vista, CA). The selected fragment was cloned into pcDNA3.1.

Vaccination.
Female C57BL/6 mice were given an injection of 100 µg of pcDNA/OVA or pcDNA3.1 dissolved in 50 µl of PBS into the hind leg quadriceps muscle. Two weeks after vaccination, the mice were boosted using the same protocol. For covaccination studies, pcDNA/IA (100 µg) dissolved in 50 µl of PBS was simultaneously injected into the vaccination site.

ELISA.
Mice received vaccinations of 100 µg of plasmid DNA twice at a 2-week interval. Two weeks after the last immunization, the mice were bled and serum antibody levels were tested. Ninety-six-well ELISA plates (Nalgene Nunc International, Roskilde, Denmark) were coated with 50 µl/well of 20 µg/ml OVA (Sigma, St. Louis, MO), and then 50 µl of serum diluted 1:40 were added to the wells. The plates were incubated at 37°C for 60 min, washed with PBS, and incubated with horseradish peroxidase-conjugated antimouse immunoglobulin diluted at 1:1000 for 60 min at 37°C. After three washes with PBS, color was developed by an incubation with a substrate solution consisting of 50 µl of 0.05 M o-phenylenediamine and H2O2 (Nacalai Tesque, Kyoto, Japan). The reaction was stopped by adding 50 µl of 4 N HCl, and absorbance at 492 nm was measured using a microplate reader.

Cellular Staining with MHC Tetramers.
Mice that had received DNA vaccination were implanted with 0.5 ml of Matrigel (BD Biosciences, Bedford, MA) mixed with 5 x 105 E.G7 or EL4 cells s.c. in the right flank. Seven days after implantation, the Matrigel plugs were resected and transferred to a tube containing 2000 units/ml dispase (Godo Shusei Co. Ltd., Tokyo, Japan) in RPMI and incubated at 37°C for 3 h. Cells infiltrating Matrigel were collected by centrifugation and cultured in RPMI containing 10% FCS and 5 µg/ml OVA257–264 peptides for 3 days. The cells were then incubated with FITC-conjugated anti-CD8 monoclonal antibody and PE-conjugated H-2Kb/OVA257–264 complex (MBL Co., Ltd., Nagoya, Japan) at room temperature for 30 min. After two washes with PBS, cells were examined to quantify OVA-specific CTLs by flow cytometry.

Lymphocyte Proliferation Assay.
Spleen cells (2 x 105 cells/well) from the immunized mice were incubated in 96-well culture plates (Nalgene Nunc International) with irradiated (50 Gy) syngeneic spleen cells (1 x 105/well) that had been pulsed with various concentrations of OVA-Kb peptides in 200 µl of RPMI 1640 containing 10% FCS and 50 µM 2-mercaptoethanol (Life Technologies, Inc.) for 96 h. Sixteen hours before termination of the culture, 1 µCi of [3H]TdR (Perkin-Elmer Life Science, Boston, MA) was added to each well. Cells were harvested from the wells, and [3H] thymidine uptake was measured using a scintillation counter.

Cytotoxicity Assay.
Spleen cells from immunized mice were cultured in RPMI 1640 containing 10% FCS, 50 µM 2-mercaptoethanol, 2 µg/ml OVA-Kb peptides, and 1 ng/ml recombinant mouse IL-2 (Wako Pure Chemical Industries, Ltd., Osaka, Japan) for 7 days. After in vitro stimulation, the spleen cells were cocultured with 1 x 104 EL4 or E.G7 cells that were labeled with Na251CrO4 (Perkin-Elmer Life Science) at various E:T ratios in 96-well culture plates for 6 h. The amount of 51Cr released from lysed target cells in the cell supernatants was estimated using an Auto Gamma Counting Systems (Packard Instrument Company, Meriden, CT). The ratio (percentage) of chromium release was calculated using the following formula: percentage-specific lysis = {(experimental release - spontaneous release)/(maximal release - spontaneous release)} x 100. To deplete CD4- or CD8-positive cells, spleen cells from the immunized mice were incubated with anti-CD4 or CD8 antibody, respectively, on ice for 30 min. After washes with PBS, the cells were incubated with rabbit complement (Wako Pure Chemical Industries, Inc.) in PBS diluted at 1:20 at 37°C for 45 min. Flow cytometry showed that over 90% of CD4- or CD8-positive cells were depleted from the treated spleen cells (data not shown).

Tumor Challenge Experiment.
Female C57BL/6 mice received s.c. inoculations, in the right flank, of 2 x 105 EL4 or E.G7 cells. The mice received injections of 100 µg of OVA DNA or control DNA with or without 100 µg of Pan-IA DNA on day 7, when tumors 5–6 mm in diameter were detected initially. The vaccination was repeated every other week. The sizes of tumors were monitored twice a week, and the volume of the tumor was calculated using the following formula: (length) x (width)2/2.

Statistical Analysis.
Reactivities of mouse sera to antigens in ELISA, proliferative and cytotoxic responses of mouse spleen cells to targets, and the sizes of inoculated tumors in tumor challenge tests were compared by Student’s t test. P < 0.05 was considered statistically significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
OVA-specific Antibody Induced in Mice by DNA Vaccines.
Reactivity to OVA protein in sera from the immunized mice was examined by ELISA. Levels of antibody specific for OVA were high in mice that received OVA DNA vaccination with or without Pan-IA DNA (Fig. 1A)Citation . However, combined Pan-IA DNA vaccination did not have an additive effect on antibody production. OVA-specific antibody was not detected in mice that received control DNA with or without Pan-IA DNA vaccination. These findings suggest that covaccination with Pan-IA DNA cannot augment the antigen-specific humoral immunity elicited by OVA DNA vaccines.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Antigen-specific humoral and cellular immunity induced by DNA vaccines in mice. C57BL/6 mice received i.m. injections, twice at an interval of 2 weeks, of 100 µg of pcDNA3.1 or pcDNA/OVA in 50 µl of PBS with or without 100 µg of pcDNA/Pan-IA. Two weeks after the second vaccination, mice were bled and sacrificed. A, OVA reactivity in sera diluted 1:40 examined by ELISA. Each group contained five mice, and experiments were repeated four times. *, P = 0.0024; **, P < 0.0001. n.s., not significant. B, spleen cells from mice cocultured with syngeneic spleen cells pulsed with various concentrations of OVA-Kb peptides for 96 h. Sixteen hours before termination of culture, 1 µCi of [3H]TdR was added to each well. Cells were harvested, and [3H]uptake was measured. Each group contained five mice. Experiments were repeated four times. *, P < 0.05. C, spleen cells from mice that received DNA vaccination were incubated with 51Cr-labeled EL4 cells that were pulsed with 20 µg/ml OVA-Kb peptides at the indicated E:T ratios for 6 h after in vitro stimulation. After incubation, the supernatant was collected and the amount of 51Cr released from lysed cells was measured. Each group contained five mice. Results are representative of experiments that were repeated four times. *, P < 0.0001.

 
Cellular Immune Responses to OVA Antigens Elicited by DNA Vaccines in Mice.
We tested the proliferative responses and cytotoxic activities of spleen cells from immunized mice. In a proliferation assay, spleen cells from the immunized mice were cocultured with syngeneic spleen cells pulsed with OVA-Kb peptides, OVA257–264. The proliferative responses of spleen cells from mice that received both OVA and Pan-IA DNA vaccination to OVA-Kb peptides were dose dependent (Fig. 1B)Citation . In contrast, we did not find any specific responses to OVA-Kb peptides in mice that had been vaccinated with OVA DNA alone or mice that had received vaccinations of control DNA with or without Pan-IA DNA.

Mice that had received vaccinations of both OVA and Pan-IA DNA exhibited specific cytotoxic activity against peptide-pulsed EL4, whereas mice that had received vaccinations of OVA DNA alone or control DNA with or without Pan-IA DNA did not acquire killing activity (Fig. 1C)Citation .

Suppressive Effects of Combined Vaccination with OVA and Pan-IA DNA on Tumor Growth in Tumor-bearing Mice.
Mice that previously received inoculations of E.G7 or EL4 cells received injections of OVA or control DNA with or without Pan-IA DNA. The growth of E.G7 cells was suppressed in mice that received vaccinations of both OVA and Pan-IA DNA (Fig. 2)Citation , and tumors were eventually eradicated in five of the nine mice (data not shown). The growth of EL4 cells was not suppressed by the combined vaccine. The inoculated E.G7 cells proliferated in all of the mice in other groups, and none of the mice were tumor-free 32 days after tumor challenge (Fig. 2)Citation . Only vaccination with OVA and Pan-IA DNA significantly prolonged the survival of mice (mean survival: 75.6 ± 5.7 days in mice that received vaccinations of OVA plus Pan-IA DNA versus 49.4 ± 5.4 days in mice that received vaccinations of OVA DNA alone; P < 0.001). Kaplan-Meier curves generated using the log rank test for the mice that received vaccinations of OVA and Pan-IA DNA and other groups of mice showed that the mice given the combined vaccination survived significantly longer (P < 0.001; data not shown). The five mice in which tumors were eradicated continued to be tumor free at least for 4 months during the observation period (data not shown).



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Suppressive effects of combined vaccination on tumor growth of E.G7 cells. Mice that received s.c. inoculations of 2 x 105 EL4 or E.G7 cells received vaccinations of OVA or control DNA with or without Pan-IA DNA 7 days after tumor challenge. The same vaccination protocol was repeated after 2 weeks. Tumor size was monitored twice each week. Results are representative of experiments that were repeated three times. *, P = 0.0001.

 
Populations in Spleen Cells from Vaccinated Mice Responsible for Killing OVA-expressing Tumor Cells.
We examined which population of T cells is responsible for suppressing tumor growth in a tumor challenge test. Spleen cells from mice in which E.G7 tumors had been eradicated by vaccination with OVA and Pan-IA DNA were incubated with cells expressing OVA after either a blockade of the molecular interaction or depletion of CD4- or CD8-positive T cells using an anti-CD4 or -CD8 monoclonal antibody. The results of a proliferation assay showed that the cellular responses of spleen cells to E.G7 cells were maximally reduced to one-third of the original level (13,000 to 3,900 dpm) by the anti-CD8 monoclonal antibody (Fig. 3A)Citation . The anti-CD4 monoclonal antibody did not affect the response. The results of cytotoxic assay demonstrated that depletion of CD8-positive T cells in the spleen cells led to a loss of killing activity against E.G7 cells, whereas CD4-positive T cells were not involved in tumor cell lysis (Fig. 3B)Citation . MHC tetramer staining of T cells from Matrigel implanted in the immunized mice showed the frequency of CD8-positive T cells reactive with the OVA257–264/H-2Kb complex was increased only by the combined vaccination (Fig. 3C)Citation . These data suggest that CTL activity against OVA-expressing targets was enhanced by vaccination with both OVA and Pan-IA DNA because of the increased frequency of antigen-specific CTLs and that CD4-positive T cells were not involved in killing target cells in the effector phase.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Populations of spleen cells responsible for killing tumor cells. A, spleen cells from mice in which E.G7 tumors had been eradicated after vaccination with OVA and Pan-IA DNA were cocultured with irradiated E.G7 cells in 200 µl of medium supplemented with supernatant from hybridomas GK1.5 or 2.43 at the indicated dilutions or control IgG (#, 0.05, 0.5, or 5 µg/ml) for 96 h. Sixteen hours before termination of culture, 1 µCi of [3H]TdR was added to each well. Cells were harvested, and the amount of [3H]uptake was measured. B, spleen cells from mice in which E.G7 tumors had been eradicated after vaccination with OVA and Pan-IA DNA were incubated in the presence of supernatant from hybridomas GK1.5 or 2.43 or 5 µg/ml control IgG on ice for 30 min, washed with PBS, and then incubated with rabbit complement diluted at 1:20 for 45 min at 37°C. The resulting CD4- or CD8-depleted spleen cells were incubated for 6 h with E.G7 cells that were labeled with 51Cr at an E:T ratio of 80:1. After incubation, the supernatant was collected from each well and the amount of 51Cr released from lysed cells was measured. The same experiments were repeated three times. C, mice that received DNA vaccination were implanted with Matrigel mixed with E.G7 or EL4 cells. Seven days after implantation, the Matrigel plug was resected and digested with dispase. Cells from Matrigel were stained with FITC-conjugated anti-CD8 monoclonal antibody and PE-conjugated H-2Kb/OVA257–264 complex and examined by flow cytometry. The same experiments were repeated twice. *, P = 0.02.

 
Immunofluorescent Study of Tumor-infiltrating Cells in Vaccinated Mice.
Mice bearing E.G7 tumors were vaccinated with OVA or control DNA with or without Pan-IA DNA. Ten days later, the tumors were resected, stained with anti-CD4 or -CD8 monoclonal antibody or anti-IFN-{gamma} monoclonal antibody, and examined using a fluorescent microscope. Some CD8-positive T cells had accumulated in the tumors from all of the mice that had received vaccinations of any DNA (Fig. 4)Citation . There was no significant difference in numbers of CD8-positive T cells infiltrating the tumors of the vaccinated mice. The number of CD4-positive T cells was significantly increased in the tumors by vaccination with both OVA and Pan-IA DNA compared with that in other groups of mice. Interestingly, most of the CD4- and CD8-positive T cells were found to produce IFN-{gamma} in the tumors of mice that received the combined vaccination (Fig. 4A)Citation . In contrast, there were few T cells producing IFN-{gamma} in the tumors of mice in other groups.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. T cells producing IFN-{gamma} in E.G7 tumors. Mice that received s.c. inoculations of E.G7 cells received vaccinations of OVA or control DNA with or without Pan-IA DNA 7 days later. Ten days after vaccination, the tumors were resected and stained with PE-conjugated anti-CD4 or -CD8 and FITC-conjugated anti-IFN-{gamma} monoclonal antibodies. Tumors from mice that had received vaccinations of OVA DNA plus Pan-IA DNA (A), control DNA plus Pan-IA DNA (B), OVA DNA alone (C), and control DNA alone (D).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Various types of immunotherapy for cancer, including peptide, tumor cell, tumor lysate, dendritic cell, and DNA vaccines, have been developed (14, 15, 16, 17, 18, 19, 20) . Some of these therapies have been used clinically for advanced or metastatic cancer. However, clinical outcomes have not been satisfactory, mainly because tumor-specific CTL activity elicited by the vaccines is insufficient to suppress cancer progression. Efficient priming of antigen-specific CTLs by vaccination requires the simultaneous activation of helper T lymphocytes (1, 2, 3, 4) . To achieve this, adjuvants to emulsify the immunogens, cytokines for coadministration, and carrier proteins to conjugate to antigens have been developed (21, 22, 23, 24, 25, 26) . Helper T epitopes that can specifically activate the helper function have recently been identified: some are from the same target proteins and some are from irrelevant proteins (5, 6, 7, 8, 9) . Which helper epitope can augment tumor-specific CTL activity the most efficiently remains to be determined. A single helper epitope that is able to enhance the antigen-specific cytotoxic activity of all CTL types through vaccine immunotherapy would be ideal therapeutically for cancer treatment.

DNA vaccination enables maintenance of a high level of tumor antigen expression at the vaccination site and results in the elicitation of powerful antitumor immunity in hosts (10, 11, 12) . DNA vaccines should, therefore, be useful in cancer immunotherapy. Tumor growth is suppressed when tumor cells are challenged in mice that previously received vaccinations of DNA encoding tumor antigens (27, 28, 29, 30) . To establish a mouse model that is more applicable to clinical cancer immunotherapy, effective DNA vaccines in tumor-bearing mice must to be established. However, established tumors in mice have not been suppressed by DNA vaccines unless manipulations have been added to modulate the immunogenicity or expression of target antigens (31 , 32) . Several strategies that can enhance the potency of antigen-specific immunity are applicable to DNA vaccine immunotherapy: coinjection of DNA encoding costimulatory ligands or cytokines, fusing of cytokine genes to antigens, and coadministration of CpG oligonucleotides (33, 34, 35, 36, 37, 38) . We reported previously that covaccination of naive dendritic cells with DNA encoding tumor antigens into tumor-bearing mice enhanced the suppression of tumor growth and prolonged the survival of mice (13) . However, these vaccination strategies did not induce sufficient antitumor immunity to eradicate the tumors in mice.

A 16-amino acid peptide analogue, AEGFSYTVANKAKGIT, which was derived from pigeon cytochrome c (p43–58) by a two-residue substitution (D to V at 50 and N to A at 54), can be presented by a broad range of IA molecules (IAb,d,q,s) and activate helper T lymphocytes (8 , 9) . Our preliminary experiments showed that lymph node cells from mice that received vaccinations of Pan-IA peptides produced T-helper 1 type cytokines: IFN{gamma} and IL-2 but not IL-4 (data not shown). Because the activation of helper T function is considered essential for elicitation of strong antigen-specific CTL activity, It should be possible to enhance the antitumor effects elicited by vaccine immunotherapy by using this peptide analogue. The use of DNA encoding Pan-IA peptides seems to be more suitable for DNA-based vaccines than the use of Pan-IA peptides in terms of cost and simplicity.

The present study showed that high levels of antigen-specific antibody were elicited by DNA vaccines in mice (Fig. 1A)Citation . However, covaccination with Pan-IA DNA did not affect the induction of humoral immunity to OVA. Humoral immunity elicited by the vaccine protocol, therefore, is unlikely to contribute to the enhanced antitumor immunity. In contrast, specific proliferative and cytotoxic responses to the target antigen were obtained only in mice that received both OVA and Pan-IA DNA vaccination (Fig. 1, B and C)Citation . As shown in Fig. 3BCitation , only CD8-positive T cells could kill the target cells. The finding that CD8-positive CTLs have cytotoxic activity against E.G7 cells in the absence of CD4-positive T cells suggested that CD4-positive T cells are not involved in killing the targets during the effector phase. In mice that had been vaccinated with OVA and Pan-IA DNA, the numbers of CD8-positive T cells reactive with OVA257–264 peptides and CD4-positive T cells were significantly increased in the tumors, and most of the T cells produced IFN-{gamma} (Figs. 3CCitation and 4Citation ). In our preliminary study, T cells from Matrigel implanted in mice that received the combined vaccination showed specific proliferative responses to OVA323–339 helper peptides (data not shown). These findings suggest that most of the CD4-positive T cells infiltrating the tumor are specific for OVA and activated to secret IFN-{gamma} after recognition of the helper epitope that might be cross-presented by antigen-presenting cells in the tumor. The antigen-specific helper T cells are thought to be involved in suppression of growth of MHC class II-deficient E.G7 cells via several ways. They may help antigen-specific CTLs to expand clonally and help IFN-{gamma} produced by the T cells kill the tumor cells directly and suppress tumor angiogenesis, as reported previously (39 , 40) . Taken together, the administration of Pan-IA DNA in combination with OVA DNA vaccine leads to priming of CD4-positive helper T cells reactive with OVA and clonal expansion of OVA-specific CTLs in the vaccinated mice, resulting in the elimination of E.G7 tumors not only by tumor cell lysis by the primed CTLs and cytokines produced by antigen-specific T cells but also by IFN-{gamma}-mediated antiangiogenic effects.

Tumor challenge tests showed that the growth of established tumors was efficiently suppressed by vaccination with OVA and Pan-IA DNA. Tumors were totally eradicated in five (56%) of the nine mice that received the combined vaccine. These mice continued to reject E.G7 cells that were challenged again at least for 4 months (data not shown). Chan et al. (33) reported that bystander T cell help induced by coadministration with ß-galactosidase-encoding DNA generated CTLs recognizing OVA-Kb epitopes. In addition, Casares et al. (41) demonstrated that not only tumor-related but also tumor-unrelated T helper 1 epitopes can induce CTL responses in cancer immunotherapy. In this study, vaccination with OVA DNA alone failed to elicit efficient antitumor immunity despite the fact that the full length of OVA containing its helper T epitope OVA323–339 was used (42) . Pan-IA peptide analogue, one of the molecules that is irrelevant to the target antigen, is also useful for efficient activation of antigen-specific helper T cells. Moreover, this analogue is more applicable to therapeutic vaccines than are other helper epitopes, because Pan-IA can be recognized in the context of many I-A molecules, namely I-Ab,d,k,q,s. This is the first study in which established tumors have been eradicated successfully by vaccination with a mixture containing DNAs corresponding to CTL epitopes and helper T cell epitopes. This animal model may contribute to the development of therapeutic DNA vaccines against cancer.


    FOOTNOTES
 
Grant support: Grants-in-Aid for Scientific Research (10671249, 13671380, 14571262, and 15591340) from the Ministry of Education, Science, Sports and Culture, Japan.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Keiichi Kontani, Department of Surgery, Shiga University of Medical Science, Seta-tsukinowa, Otsu 520-2192, Japan. Phone: 81-077-548-2244; Fax: 81-077-544-2901; E-mail: konbat{at}belle.shiga-med.ac.jp

6 The abbreviations used are: OVA, ovalbumin; CD, cluster of differentiation; IL, interleukin; PE, phycoerythrin. Back

Received 11/15/02. Revised 7/17/03. Accepted 9/ 4/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fayolle C., Deriaud E., Leclerc C. In vivo induction of cytotoxic T cell response by a free synthetic peptide requires CD4+ T cell help. J. Immunol., 147: 4069-4073, 1991.[Abstract]
  2. Hart M. K., Weinhold K. J., Scearce R. M., Washburn E. M., Clark C. A., Palker T. J., Haynes B. F. Priming of anti-human immunodeficiency virus (HIV) CD8+ cytotoxic T cell in vivo by carrier-free HIV synthetic peptides. Proc. Natl. Acad. Sci. USA, 88: 9448-9452, 1991.[Abstract/Free Full Text]
  3. Lasarte J. J., Sarobe P., Gullon A., Prieto J., Borras-Cuesta F. Induction of cytotoxic T lymphocytes in mice against the principal neutralizing domain of HIV-1 by immunization with an engineered T-cytotoxic-T-helper synthetic peptide construct. Cell. Immunol., 141: 211-218, 1992.[Medline]
  4. Shirai M., Pendleton C. D., Ahler J., Takeshita T., Newman M., Berzofsky J. A. Helper-cytotoxic T lymphocyte (CTL) determinant linkage required for priming of anti-HIV CD8+ CTL in vivo with peptide vaccine constructs. J. Immunol., 152: 549-556, 1994.[Abstract]
  5. Manici S., Sturniolo T., Imro M. A., Hammer J., Sinigaglia F., Noppen C., Spagnoli G., Mazzi B., Bellone M., Dellabona P., Protti M. P. Melanoma cells present a MAGE-3 epitope to CD4 (+) cytotoxic T cells in association with histocompatibility leukocyte antigen DR11. J. Exp. Med., 189: 753-756, 1999.[Free Full Text]
  6. Kobayashi H., Wood M., Song Y., Appella E., Celis E. Defining promiscuous MHC class II helper T-cell epitopes for the HER2/neu tumor antigen. Cancer Res., 60: 5228-5236, 2000.[Abstract/Free Full Text]
  7. Zarour H. M., Maillere B., Brusic V., Coval K., Williams E., Pouvelle-Moratille S., Castelli F., Land S., Bennouna J., Logan T., Kirkwood J. M. NY-ESO-1 119–143 is a promiscuous major histocompatibility complex class II T-helper epitope recognized by Th1-and Th2-type tumor-reactive CD4+ T cells. Cancer Res., 62: 213-218, 2002.[Abstract/Free Full Text]
  8. Itoh Y., Ogasawara K., Takami K., Gotohda T., Naruse H., Good R. A., Onoe K. Determination of amino acids on agretopes of pigeon cytochrome c-related peptides specifically bound to I-A allelic products. Eur. J. Immunol., 24: 76-83, 1994.[Medline]
  9. Itoh Y., Kajino K., Ogasawara K., Katoh M., Namba K., Takami K., Iwabuchi K., Braunstein N. S., Onoe K. Determination of the allele-specific antigen-binding site on I-Ak and I-Ab molecules. Eur. J. Immunol., 26: 1314-1321, 1996.[Medline]
  10. Donnelly J. J., Ulmer J. B., Liu M. A. DNA vaccine. Life Sci., 60: 163-172, 1997.[Medline]
  11. Maecker H. T., Umetsu D. T., DeKruyff R. H., Levy S. Cytotoxic T cell responses to DNA vaccination: dependence on antigen presentation via class II MHC. J. Immunol., 161: 6532-6536, 1998.[Abstract/Free Full Text]
  12. Klinman D. M., Sechler J. M. G., Conover J., Gu M., Rosenberg A. S. Contribution of cells at the site of DNA vaccination to the generation of antigen-specific immunity and memory. J. Immunol., 160: 2388-2392, 1998.[Abstract/Free Full Text]
  13. Kontani K., Taguchi O., Ozaki Y., Hanaoka J., Tezuka N., Sawai S., Inoue S., Fujino S., Maeda T., Itoh Y., Ogasawara K., Sato H., Ohkubo I., Kudo T. Novel vaccination protocol consisting of injecting MUC1 DNA and nonprimed dendritic cells at the same region greatly enhanced MUC1-specific antitumor immunity in a murine model. Cancer Gene Ther., 9: 330-337, 2002.[Medline]
  14. Sterry W. Vaccination therapy for malignant disease: the clinical perspective Walden P. Sterry W. Hennekes H. eds. . Therapeutic Vaccination Strategies, 1-6, Springer Berlin 2000.
  15. Dermime S., Armstrong A., Hawkins R. E., Stern P. L. Cancer vaccines and immunotherapy. Br. Med. Bull., 62: 149-162, 2002.[Abstract/Free Full Text]
  16. Rosenberg S. A., Yang J. C., Schwartzentruber D. J., Hwu P., Marincola F. M., Topalian S. L., Restifo N. P., Dudley M. E., Schwartz S. L., Spiess P. J., Wunderlich J. R., Parkhurst M. R., Kawakami Y., Seipp C. A., Einhorn J. H., White D. E. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat. Med., 4: 321-327, 1998.[Medline]
  17. Nestle F. O., Alijagic S., Gilliet M., Sun Y., Grabbe S., Dummer R., Burg G., Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med., 4: 328-332, 1998.[Medline]
  18. Lee K. H., Wang E., Nielsen M. B., Wunderlich J., Migueles S., Connors M., Steinberg S. M., Rosenberg S. A., Marincola F. M. Increased vaccine-specific T cell frequency after peptide based vaccination correlates with increased susceptibility to in vitro stimulation but does not lead to tumor regression. J. Immunol., 163: 6292-6300, 1999.[Abstract/Free Full Text]
  19. Vermorken J. B., Claessen A. M. E., van Tinteren H., Gall H. E., Ezinga R., Meijier S., Scheper R. J., Meijer C. J. L. M., Bloemena E., Ransom J. H., Hanna M. G., Jr., Pinedo H. M. Active specific immunotherapy for stage II and stage III human colon cancer: a randomized trial. Lancet, 353: 345-350, 1999.[Medline]
  20. Chang A. E., Redman B. G., Whitfield J. R., Nickoloff B. J., Braun T. M., Lee P. P., Geiger J. D., Mule J. J. A phase I trial of human lysate-pulsed dendritic cells in the treatment of advanced cancer. Clin. Cancer Res., 8: 1021-1032, 2002.[Abstract/Free Full Text]
  21. Ulmer J. B., DeWitt C. M., Chastain M., Friedman A., Donnelly J. J., McClements W. L., Caulfield M. J., Bohannon K. E., Volkin D. B., Evans R. K. Enhancement of DNA vaccine potency using conventional aluminum adjuvants. Vaccine, 18: 18-28, 1999.[Medline]
  22. Ebhardt M. B., Shive C. L., Guardia R., Gapin L., Boehm B. O., Forsthuber T. G. Immunological adjuvants efficiently induce antigen-specific T cell responses in old mice: implication for vaccine adjuvant development in aged individuals. Cell. Immunol., 215: 87-97, 2002.[Medline]
  23. Rosenberg S. A., Yang J. C., Schwartzentruber D. J., Hwu P., Marincola F. M., Topalian S. L., Restifo N. P., Sznol M., Schwartz S. L., Spiess P. J., Wunderlich J. R., Seipp C. A., Einhorn J. H., Rogers-Freezer L., White D. E. Impact of cytokine administration on the generation of antitumor reactivity in patients with metastatic melanoma receiving a peptide vaccine. J. Immunol., 163: 1690-1695, 1995.
  24. Tatsumi T., Takehara T., Kanto T., Miyagi T., Kuzushita N., Sugimoto Y., Jinushi M., Kasahara A., Sasaki Y., Hori M., Hayashi N. Administration of interleukin-12 enhances the therapeutic efficacy of dendritic cell-based tumor vaccines in mouse hepatocellular carcinoma. Cancer Res., 61: 7563-7567, 2001.[Abstract/Free Full Text]
  25. Shimizu K., Thomas E. K., Giedlin M., Mule J. J. Enhancement of tumor lysate- and peptide-pulsed dendritic cell-based vaccines by the addition of foreign helper protein. Cancer Res., 61: 2618-2624, 2001.[Abstract/Free Full Text]
  26. Zaliauskiene L., Kang S., Sparks K., Zinn K. R., Schwiebert L. M., Weaver C. T., Lollawn J. F. Enhancement of MHC class II-restricted responses by receptor-mediated uptake of peptide antigens. J. Immunol., 169: 2337-2345, 2002.[Abstract/Free Full Text]
  27. Iwasaki A., Barber B. H. Induction by DNA immunization of a protective antitumor cytotoxic T lymphocyte response against a minimal-epitope-expressing tumor. Cancer Immunol. Immunother., 45: 273-279, 1998.[Medline]
  28. Chen Y., Hu D., Eling D. J., Robbins J., Kipps T. J. DNA vaccines encoding full-length or truncated Neu induce protective immunity against Neu-expressing mammary tumors. Cancer Res., 58: 1965-1971, 1998.[Abstract/Free Full Text]
  29. Chen C. H., Wang T. L., Hung C. F., Yang Y., Young R. A., Pardoll D. M., Wu T-C. Enhancement of DNA vaccine potency by linkage of antigen gene to an HSP70 gene. Cancer Res., 60: 1035-1042, 2000.[Abstract/Free Full Text]
  30. Graham R. A., Burchell J. M., Beverley P., Taylor-Papadimitriou J. Intramuscular immunization with MUC1 cDNA can protect C57 mice challenged with MUC1-expressing syngeneic mouse tumour cells. Int. J. Cancer, 65: 664-670, 1996.[Medline]
  31. Mendirata S. K., Thai G., Eslahi N. K., Thull N. M., Mater M., Bronte V., Pericle F. Therapeutic tumor immunity induced by polyimmunization with melanoma antigens gp100 and TRP-2. Cancer Res., 61: 859-863, 2001.[Abstract/Free Full Text]
  32. Leitner W. W., Ying H., Driver D. A., Dubensky T. W., Restifo N. P. Enhancement of tumor-specific immune response with plasmid DNA replicon vectors. Cancer Res., 60: 51-55, 2000.[Abstract/Free Full Text]
  33. Chan K., Lee D. J., Schubert A., Tang C. M., Crain B., Schoenberger S. P., Corr M. The roles of MHC class II, CD40, and B7 costimulation in CTL induction by plasmid DNA. J. Immunol., 166: 3061-3066, 2001.[Abstract/Free Full Text]
  34. Weiss W. R., Ishii K. J., Hedstrom R. C., Sedegah M., Ichino M., Barnhart K., Klinman D. M., Hoffman S. L. A plasmid encoding murine granulocytemacrophage colony-stimulating factor increases protection conferred by a malaria DNA vaccine. J. Immunol., 161: 2325-2332, 1998.[Abstract/Free Full Text]
  35. Chow T. H., Chiang B. L., Lee Y. L., Chi W. K., Lin W. C., Chen Y. T., Tao M. H. Development of Th1 and Th2 populations and the nature of immune responses to hepatitis B virus DNA vaccines can be modulated by codelivery of various cytokine genes. J. Immunol., 160: 1320-1329, 1998.[Abstract/Free Full Text]
  36. Maecker H. T., Umetsu D. T., DeKruyff H., Levy S. DNA vaccination with cytokine fusion constructs biases the immune response to ovalbumin. Vaccine, 15: 1687-1696, 1997.[Medline]
  37. Roman M., Martin-Orozco E., Googman J. S., Nguyen M. D., Sato Y., Ronaghy A., Kornbluth R. S., Richman D. D., Carson D. A., Raz E. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med., 3: 849-854, 1997.[Medline]
  38. Hafner M., Zawatzky R., Hirtreiter C., Buurman W. A., Echtenacher B., Hehlgans T., Mannel D. N. Antimetastatic effect of CpG DNA mediated by type I IFN. Cancer Res., 61: 5523-5528, 2001.[Abstract/Free Full Text]
  39. Mumberg D., Monach P. A., Wanderling S., Philip M., Toledano A. Y., Schreiber R. D., Schreiber H. CD4+ T cells eliminate MHC class II-negative cancer cells in vivo by indirect effects of IFN-{gamma}. Proc. Natl. Acad. Sci. USA, 96: 8633-8638, 1999.[Abstract/Free Full Text]
  40. Beatty G. L., Paterson Y. IFN-{gamma}-dependent inhibition of tumor angiogenesis by tumor-infiltrating CD4+ T cells requires tumor responsiveness to IFN-{gamma}. J. Immunol., 166: 2276-2282, 2001.[Abstract/Free Full Text]
  41. Casares N., Lasarte J. J., Lopez-Diaz de Cerio A., Sarobe P., Ruiz M., Melero I., Prieto J., Borras-Cuesta F. Immunization with a tumor-associated CTL epitope plus a tumor-related or unrelated Th1 helper peptide elicits protective CTL immunity. Eur. J. Immunol., 31: 1780-1789, 2001.[Medline]
  42. Robertson J. M., Jensen P. E., Evavold B. D. DO11.10 and OT-II T cells recognize a C-terminal ovalbumin 323–339 epitope. J. Immunol., 164: 4706-4712, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
T. Fujita, K. Teramoto, Y. Ozaki, J. Hanaoka, N. Tezuka, Y. Itoh, T. Asai, S. Fujino, K. Kontani, and K. Ogasawara
Inhibition of Transforming Growth Factor-{beta}-Mediated Immunosuppression in Tumor-Draining Lymph Nodes Augments Antitumor Responses by Various Immunologic Cell Types
Cancer Res., June 15, 2009; 69(12): 5142 - 5150.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teramoto, K.
Right arrow Articles by Ogasawara, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Teramoto, K.
Right arrow Articles by Ogasawara, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online