This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Libutti, S. K. Articles by Spiegel, A. M. Search for Related Content PubMed PubMed Citation Articles by Libutti, S. K. Articles by Spiegel, A. M.

Parathyroid Gland-specific Deletion of the Mouse Men1 Gene Results in Parathyroid Neoplasia and Hypercalcemic Hyperparathyroidism

¹ Surgery Branch
² Laboratory of Pathology, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland;
³ Genome Technology Branch, National Human Genome Research Institute, Bethesda, Maryland;
⁴ Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, Maryland;
⁵ Clinical Pathology, Clinical Center, National Institutes of Health, Bethesda, Maryland;
⁶ Center for Molecular Medicine and Division of Endocrinology and Metabolism, University of Connecticut School of Medicine, Farmington, Connecticut;
⁷ Molecular Pathophysiology Section, National Institute of Deafness and Communication Disorders, Bethesda, Maryland

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The inactivation of the MEN1 tumor suppressor gene in patients leads to a constellation of changes in endocrine tissues, including parathyroid neoplasia, pituitary adenomas, pancreatic neuroendocrine tumors, and carcinoids. To study the pathophysiological consequences of the deletion of the MEN1 gene, we set out to create a mouse model of hyperparathyroidism resulting from the deletion of the Men1 gene in parathyroid tissue. We introduced a Men1 gene flanked by loxP sites into the mouse germ line and then used a parathyroid cell-specific promoter to drive the expression of Cre recombinase, resulting in the deletion of the Men1 gene. Here, we show that loss of Men1 gene function in the parathyroid glands of mice results in histological changes consistent with parathyroid neoplasia as well as systemic hypercalcemia. This model provides a means for dissecting the molecular basis of this familial cancer syndrome and may allow for the development of new strategies to treat related forms of hypercalcemia.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
MEN1¹ [Online Mendelian Inheritance in Man (OMIM) 131100] is an autosomal dominant familial cancer syndrome resulting from the heterozygous inactivation of the MEN1 tumor suppressor gene (1 , 2) . Patients develop tumors affecting all four parathyroid glands, multiple neuroendocrine tumors of the pancreas including gastrinomas and insulinomas, pituitary adenomas, as well as a variety of other manifestations including foregut carcinoids and skin lesions (2 , 3) . Because the MEN1 gene was cloned and its protein product, menin, was identified (4) , there has been a concerted effort to develop models to better understand the function of menin and the role its loss plays in the pathogenesis of MEN1-related tumors. The MEN1 gene seems to function as a classic tumor suppressor; somatic loss of the remaining wild-type allele is a necessary step in tumorigenesis in MEN1 tumors or in sporadic tumors.

Our group has reported previously that a traditional knockout mouse model of the Men1 gene results in embryonic lethality for mice homozygous for the deletion, whereas heterozygous knockout mice develop tumors highly reminiscent of the human MEN1 syndrome after 12 months of age (5) . Although mice with heterozygous Men1 inactivation developed histological evidence of parathyroid neoplasia, hypercalcemia was not observed (5) . Evidence for hyperparathyroidism on pathological examination of parathyroid glands has also been seen in heterozygous Men1 mutant mice by others, although hypercalcemia was not reported (6) . To study more precisely the consequences of homozygous deletion of the Men1 gene in somatic tissues and to determine whether this genetic alteration would result in a model for primary hyperparathyroidism, we developed a strategy for the tissue-specific deletion of the Men1 gene in the parathyroid glands of mice using site-specific DNA deletion (7, 8, 9) .

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
DNA Constructs
PTH-Cre.
The 5' upstream regulatory region of the human PTH gene was cloned into pBluescript SK using the SacI and BglII sites in the multiple cloning region. The Cre recombinase cDNA (with a metallothionein-I polyadenylation signal) was placed downstream of the human PTH promoter by excising Cre from pBS185 (Life Technologies, Inc.) using a XhoI and HindIII digest and using a blunt ligation into the downstream BglII site. Correct orientation of the insert was confirmed with restriction digest and partial sequencing.

Floxed MEN1 (dN/dN).
Mice were generated that contained inserted loxP sites in introns 2 and 8 of the Men1 gene by breeding the existing line, Men1TSM/+ (5) , with EIIa-Cre mice that express Cre ubiquitously from the EIIa promoter (10) . This breeding resulted in conditionally targeted mice for Men1 that were bred to homozygosity and termed Men1dN/dN mice.

Microinjections
The 9.9-kb DNA fragment was isolated from the PTH-Cre vector by restriction digest, and DNA was purified and prepared for microinjection using standard techniques in the National Institute of Diabetes and Digestive and Kidney Diseases transgenic facility.

The generation of mice carrying the floxed Men1 gene has been described previously (5) .

Animal Handling
All animals were treated and maintained in accordance with NIH and Association for Assessment and Accreditation of Laboratory Animal Care guidelines under approved National Institute of Diabetes and Digestive and Kidney Diseases Institutional Animal Care and Use Committee protocols. The mice were housed with a photoperiod of 12 h light/12 h dark. Their standard diet was Ziegler Rodent NIH-31 Open Formula, which contained 1.11% calcium, 0.93% phosphorus, and 4.0 IU/g vitamin D3. The feeding trough was filled biweekly with 400 g of rodent food/cage housing no more than five mice. Blood was collected by tail nicking. Serum was stored at -20°C until assayed for serum calcium concentration.

Screening of Transgenic Mice
Genomic DNA was isolated from the tips of mouse tails by incubation with proteinase K (250 µg/ml) overnight at 50°C with shaking. The DNA was extracted with phenol/chloroform and quantified by spectrophotometry. Approximately 0.1 µg of genomic DNA underwent multiplex PCR (95°C for 1 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min for 35 cycles; 72°C for 10 min; 4°C hold) using three primers for the detection of wild-type and floxed Men1 DNA. Primer A (CCCACATCCAGTCCCTCTTCAGCT) is specific to exon 1 of the Men1 gene, and primer B (CCCTCTGGCTATTCAATGGCAGGG) is specific for the wild-type DNA sequence, which is deleted in cloning the floxed Men1 construct. Primer C (CGGAGAAAGAGGTAATGAAATGGC) is specific for the inserted floxed sequence. The combinations of primers A and B yield a wild-type 300-bp amplicon, and primers A and C yield a 236-bp targeted amplicon. For detecting the presence of Cre recombinase DNA, genomic DNA underwent PCR (95°C for 1 min; 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min for 35 cycles; 72°C 10 min; 4°C hold) with primer CreF (ACCTGAAGATGTTCGCGATTATCT) and primer CreR (ACCGTCAGTACGTGAGATATCCTT). The presence of Cre recombinase results in a 450-bp amplicon. LacZ-positive mice were detected by PCR (95°C for 1 min; 95°C for 30 s, 65°C for 30 s, and 72°C for 1 min for 35 cycles; 72°C for 10 min; 4°C hold) with LacZ F (GATCCGCGCTGGCTACCGGC) and LacZ R (GGATACTGACGAAACGCCTGCC) primers, with the presence of LacZ DNA resulting in a 350-bp amplicon. Southern blotting analyses confirmed the genotype expression of the various transgenic mice lines.

Crosses to Reporter Strains
PTH-Cre-positive mice were crossed with Z/AP reporter mice (11) , and the progeny was screened by tail snip and PCR. PTH-Cre-positive and Z/AP-positive mice were then sacrificed, and tissues were harvested and snap frozen in liquid nitrogen. The frozen tissues stored at -80°C were embedded in OCT (Tissue Tek; Sakura), cryosectioned at 10 µm on charged slides, and fixed in 0.2% glutaraldehyde for 1 h. For alkaline phosphatase and ß-gal staining, sections were processed as described previously (12) . Briefly, for alkaline phosphatase staining, slides were fixed in 0.2% glutaraldehyde for 1 h. Endogenous alkaline phosphatase was inactivated by incubating slides in PBS at 75°C for 30 min., washed, and overlayed with nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate stain (Boehringer) for 12 min in the absence of light.

Crosses between PTH Cre-positive and Floxed Men1 Mice
Mice found to be PTH-Cre positive (Friend Virus B strain) were crossed with homozygous floxed Men1-positive mice (129SvEvTac). Progeny were screened by tail snip as described above, and additional matings were arranged based on genotype.

Determinations of Serum Calcium
Serum total calcium, glucose, and creatinine were measured with a Hitachi 917 chemistry analyzer (Roche Diagnostics, Indianapolis, IN).

Analysis of Tissues
Frozen sections (7 µm) of a resected tracheal block, containing the thyroid, parathyroid glands, trachea, and surrounding muscle and soft tissue, were cut on a cryostat and stained H&E. Tissues were also fixed in formalin and embedded in paraffin. For Men1 immunostaining, tissue was excised and fixed in 4% paraformaldehyde in PBS overnight. Briefly, tissue was processed, embedded in paraffin, sectioned, and pretreated with 10 mM citric acid buffer (pH 6.0) for 7 min with boiling using a microwave. After quenching endogenous peroxidase activity with 3% hydrogen peroxide in distilled water for 10 min and blocking for 15 min with avidin D reagent (Vector Laboratories, Inc.), 15 min with biotin reagent (Vecta), and 10 min in protein blocking agent (Coulter-Immunotech) at room temperature, slides were incubated at 4°C overnight with a 1:500 dilution of purified primary rabbit polyclonal Men1 antibody. Biotinylated goat antirabbit secondary antibody (Vector Laboratories, Inc.) at a1:200 dilution was applied for 30 min, followed by treatment with horseradish peroxidase-conjugated avidin-biotin complex reagent (Vector PK-6100). The signal was developed for up to 10 min with 3,3'-diaminobenzidine (Vector Laboratories, Inc.), and sections were counterstained with hematoxylin for 1 min. Each incubation step was followed by two 5-min PBS washes.

For Calcium Sensing Receptor immunohistochemistry, frozen sections were used. Sections were thawed and fixed in 4% paraformaldehyde in PBS overnight, and a primary rabbit polyclonal antibody (kindly provided by Dr. Dolores Shoback, University of California, San Francisco, CA) was used at a 1:200 dilution. For blocking tissue sections, primary and secondary antibodies were prepared in PBS containing 1% skim milk, 3% goat serum, 0.01% Tween 20, and 3% fish gelatin (Sigma Chemical Co.). Pathologists who were blinded to the genotype of the animals then examined the slides.

Measurement of gland size
Serial frozen cross-sections (7 µm) of the tracheal block of the animals were reviewed by a pathologist (S. M. H.) blinded to the genotype and phenotype of the mice, and every profile containing a whole cross-section of parathyroid gland was catalogued and measured in two dimensions, at right angles with a micrometer. The largest cross-section for each individual parathyroid gland was identified (product of the two dimensions) and used in the final calculations.

PCR determination of deletion of floxed alleles
PCR was used to determine the deletion of floxed Men1 gene occurring in the parathyroid of floxed Men1 homozygous mice that were either Cre+ (group 1) or Cre- (group 4). DNA was purified from laser capture microdissected tissue from either parathyroid gland or adjacent muscle.

The test samples and the control samples were all PCR amplified using a set of three primers consisting of a forward primer, X (5'CCCACATCCAGTCCCTCTTCAGCT3'), and two reverse primers, Y (5'ACCTACAGCCTAGCCCAG3') and Z (5'CGGAGAAAGAGGTAATGAAATGGC3'). A 100-ng aliquot of template DNA was used for each reaction. Primer X is located in exon 2, primer Y is located in intron 8 after the 3' loxP site and is specific for the deleted form of the gene, whereas primer Z is located upstream to the 5' lox site and is specific for the vector fragment inserted when the TSM construct was cloned (5) . Therefore, the combination of primers X and Y yields a 390-bp PCR product specific for the deleted form of the gene. The nondeleted form of the gene is too long to be amplified by this PCR. In contrast, the combination of Y and Z, a 236-bp PCR product specific for the floxed gene, was used as an internal control for the PCR. PCR conditions were 95°C for 10 min; 95°C for 30 s, 60°C for 1 min, and 72°C for 3 min for 45 cycles; 72°C for 10 min. The concentrations of the PCR reagents were standard, except for the primers X, Y, and Z, which were used, respectively, in 1-, 3-, and 0.5-fold. PCR products were then run on a standard DNA gel.

Statistical Analysis
All statistical analyses were performed using a Power Macintosh G4 computer and Instat 2.01 statistical package (GraphPad Software).

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Parathyroid-Specific Cre Expression.
To direct the expression of Cre-recombinase specifically and exclusively to parathyroid tissue, we constructed a vector using the 5' upstream control region of the human PTH gene driving expression of Cre recombinase obtained from a commercially available Cre expression vector. The same human PTH promoter construct we used has been described previously (13) . The PTH-Cre construct that was generated through restriction digest and ligation of the Cre recombinase expression cassette into the human PTH promoter vector is shown (Fig. 1) . After microinjection and implantation of blastocysts, newborn pups were screened by PCR with primers specific for Cre using DNA isolated from tail snips (data not shown). Three PCR-positive putative founders were then screened further by Southern blot analysis (data not shown) using a radiolabeled PTH-Cre-specific sequence as a probe. The results demonstrated that integration of the PTH-Cre transgene occurred in a consistent pattern in the offspring of two of the three mice from the positive founder lines. The third mouse did not have PTH-Cre insertion confirmed by Southern blot.

View larger version (21K): [in this window] [in a new window]   Fig. 1. Transgene construct. A, this diagram illustrates the transgene construct with the human PTH promoter upstream of the Cre recombinase cDNA, followed by an MT1 polyadenylation signal. The entire construct size was 9.9 kb and was excised from the vector using a SacI/KpnI digest. B, PCR analysis of deletion uses three primers: a forward primer, X, and two reverse primers, Y and Z. Primer X is located in exon 2, primer Y is located in intron 8 after the 3' lox site and is specific for the excised Men1 gene, resulting in a 390-bp PCR product. Primer Z is located upstream of the 5' loxP site and is specific for the undeleted allele, resulting in a 236-bp PCR product.

View larger version (105K): [in this window] [in a new window]   Fig. 2. The PTH-Cre transgene is functional and tissue specific. PTH-Cre-positive as well as PTH-Cre-negative mice were crossed to a Z/AP reporter strain. The tracheal block was sectioned and stained by H&E as well as for alkaline phosphatase. PTH-Cre-positive mice had positive alkaline phosphatase staining in some cells of their parathyroid tissue without any evidence of alkaline phosphatase staining in any other adjacent tissues. PTH-Cre-negative mice failed to demonstrate alkaline phosphatase staining in the parathyroid gland.

Crosses of PTH-Cre-positive Mice with Floxed Men1 Mice.
To determine whether the tissue-specific deletion of the Men1 gene resulted in a parathyroid-specific phenotype, crosses were performed between PTH-Cre-positive mice and mice with the Men1 gene flanked by loxP sites. The progeny of these crosses were genotyped, and five groups of animals were identified and matched by age and gender. Table 1 shows the genotype of these five groups of mice with respect to presence or absence of the PTH-Cre transgene and the loxP status of the Men1 gene. These animals were followed prospectively for analysis of serum and histology.

View larger version (15K): [in this window] [in a new window]   Fig. 3. Serial calcium levels. Blood was obtained by tail vein beginning at 1 month of age and continuing through 14 months of age for mice in all 5 study groups. This figure shows the mean (±SE) total serum calcium (mg/dl) value for each group of mice during the study.

View larger version (135K): [in this window] [in a new window]   Fig. 4. Histology of parathyroid glands. A–C show 50x magnification of the thyroid and parathyroid gland in three different group 1 mice demonstrating abnormal size and histological architecture consistent with neoplasia. D shows a normal parathyroid in an age-matched group 4 control. All mice are 9 months of age. Tissues are formalin fixed and have been stained with H&E.

View larger version (10K): [in this window] [in a new window]   Fig. 5. Gland size measurements. Gland sizes were measured in 14-month-old mice, and the average size of glands in group 1 mice were compared with gender-matched controls in group 4. Group 1 mice (n = 5) had significantly larger glands, on average, than group 4 mice (n = 5). Data represent the mean ± SE; P = 0.016, Mann-Whitney U test.

View larger version (116K): [in this window] [in a new window]   Fig. 6. Immunohistochemistry of parathyroid glands. A and C (higher magnification) demonstrate a loss of staining for the protein menin in the parathyroid cells from an enlarged gland in a 12-month-old group 1 mouse compared with the normal staining pattern seen for menin in an age-matched group 4 mouse, as shown in B and D (higher magnification). In E, an adenoma is shown in a 14-month-old group 1 mouse with loss of membrane staining for the calcium receptor. A normal membrane receptor staining pattern is preserved in an age-matched group 4 mouse (F).

View larger version (55K): [in this window] [in a new window]   Fig. 7. Molecular confirmation and quantification of tissue-specific gene deletion. Laser-capture microdissection was performed on parathyroid and adjacent muscle tissue in 9-month-old group 1 and group 4 mice. DNA was extracted and purified from these cells and subjected to a PCR analysis using primers that would either demonstrate presence of a loxP site (to demonstrate that DNA was present) and primers that would demonstrate successful deletion of the Men1 gene. A successful deletion would result in a 390-bp fragment on PCR. Group 1 mice have a deletion of the Men1 gene in parathyroid tissue but not in adjacent muscle. Group 4 mice lacking the PTH-Cre transgene fail to demonstrate a deletion in either parathyroid (P) or muscle (M) tissue.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

We described previously a conventional knockout model for MEN1 that resulted in pathological parathyroid neoplasia, but hypercalcemia was not observed (5) . Here, we describe a new model that allows for the study of mice with a homozygous deletion of the Men1 tumor suppressor gene specifically in the parathyroid glands, thus allowing for live births and the ability to study the consequence of a Men1 gene deletion in the tissue of interest. These mice develop hypercalcemia as early as 7 months of age. These mice also have pathological features consistent with parathyroid neoplasia and are spared MEN1-related neoplasms in any other tissues.

Allelic deletion of Men1 in the parathyroids of Cre-expressing mice homozygous for the floxed Men1 allele was demonstrated using PCR. Adjacent muscle tissue in these mice failed to demonstrate any evidence of deletion. Mice homozygous for floxed Men1 that were not expressing Cre had no evidence of deletion in parathyroid or muscle. These mice also had abnormal parathyroid glands by histological examination, with increased gland size, increased numbers of cells, and loss of the normal organization of the gland. These mice had significantly elevated serum calcium levels. These pathological and clinical findings are similar to those seen in patients with MEN1 hyperparathyroidism. In fact, the pathological appearance of the abnormal glands in the mice is very similar to the appearance of abnormal glands in humans. Although mice have two parathyroid glands (compared with the typical four in humans), both glands were found to be pathologically abnormal in the group 1 mice. This evidence of multigland disease is comparable with the human condition.

Furthermore, immunostaining confirmed lower levels of expression of the menin protein in group 1 mice versus group 4 controls. Immunostaining also showed reduced expression of the calcium-sensing receptor in neoplastic parathyroids from mice in group 1. Reduced calcium-sensing receptor expression has been reported in primary and uremic secondary hyperparathyroidism in humans, but not to our knowledge in MEN1 (16) . Group 1 mice also demonstrated significantly larger parathyroid glands by 14 months of age compared with age- and gender-matched controls. The documented parathyroid specificity of Cre recombinase expression in the PTH/Cre transgenic mice we generated suggests that these mice should prove useful in generating mouse models of parathyroid-specific deletion of other genes of interest, such as the extracellular calcium-sensing receptor and the vitamin D receptor.

The mouse model of primary hyperparathyroidism we created will allow the study of a variety of questions of pathophysiological and therapeutic interest in an in vivo system. These mice should be useful in testing candidates for treatment of hypercalcemia as well as for preventing or reversing parathyroid neoplasia. Identification of promising targets for such treatments will require detailed studies of the mechanistic basis for parathyroid neoplasia subsequent to loss of menin function and elucidation of the linkage between parathyroid neoplasia and abnormal calcium regulation. For example, there are likely other genetic and epigenetic consequences in the parathyroid resulting from the loss of the Men1 tumor suppressor gene. These mice may allow for a better elucidation of the pathways responsible for parathyroid neoplasia by direct molecular genetic studies of the parathyroid tumors arising in these mice and by crosses of these mice with other genetically altered mouse strains. Crosses of these mice with other transgenic models of parathyroid neoplasia and hypercalcemia, such as mice that overexpress cyclin D1 in the parathyroid glands (13) , may allow us to better understand the complex pathways involved in calcium homeostasis.

In conclusion, we have successfully developed a mouse model of primary hyperparathyroidism caused by parathyroid-specific deletion of the Men1 gene. Using a targeted tissue-specific knockout strategy, we have demonstrated that the deletion of Men1 results in histological findings consistent with parathyroid neoplasia and serum hypercalcemia by 7 months of age. It is our hope that this model will serve as a useful tool for the study of hyperparathyroidism and for the molecular basis of neoplasia caused by loss of menin function.

	ACKNOWLEDGMENTS

 
We acknowledge the efforts of Stacey Checco and Maureen Sampson for work on the serum assays and Jennifer Concannon for help with the breeding of the mice. We also thank Gary P. Swain, Ph.D. (University of Pennsylvania, Philadelphia, PA), for assistance with the menin immunostaining.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Steven K. Libutti, Surgery Branch, National Cancer Institute, 10 Center Drive, Room 2B07, Bethesda, MD 20892. E-mail: Steven_Libutti{at}nih.gov

¹ The abbreviations used are: MEN1, multiple endocrine neoplasia type 1; PTH, parathyroid hormone; Z/AP, ß galactosidase—alkaline phosphotase reporter mice.

Received 6/18/03. Revised 8/22/03. Accepted 8/27/03.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Pannett A. A., Thakker R. V. Multiple endocrine neoplasia type 1. Endocr. Relat. Cancer, 6: 449-473, 1999.[Abstract]
2. Skogseid B., Doherty G. M. Multiple endocrine neoplasia type 1: clinical and genetic features. Ital. J. Gastroenterol. Hepatol., 31 (Suppl. 2): S131-S134, 1999.
3. Marx S. J., Agarwal S. K., Kester M. B., Heppner C., Kim Y. S., Skarulis M. C., James L. A., Goldsmith P. K., Saggar S. K., Park S. Y., Spiegel A. M., Burns A. L., Debelenko L. V., Zhuang Z., Lubensky I. A., Liotta L. A., Emmert-Buck M. R., Guru S. C., Manickam P., Crabtree J., Erdos M. R., Collins F. S., Chandrasekharappa S. C. Multiple endocrine neoplasia type 1: clinical and genetic features of the hereditary endocrine neoplasias. Recent Prog. Horm. Res., 54: 397-438, 1999.
4. Chandrasekharappa S. C., Guru S. C., Manickam P., Olufemi S. E., Collins F. S., Emmert-Buck M. R., Debelenko L. V., Zhuang Z., Lubensky I. A., Liotta L. A., Crabtree J. S., Wang Y., Roe B. A., Weisemann J., Boguski M. S., Agarwal S. K., Kester M. B., Kim Y. S., Heppner C., Dong Q., Spiegel A. M., Burns A. L., Marx S. J. Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science (Wash. DC), 276: 404-407, 1997.[Abstract/Free Full Text]
5. Crabtree J. S., Scacheri P. C., Ward J. M., Garrett-Beal L., Emmert-Buck M. R., Edgemon K. A., Lorang D., Libutti S. K., Chandrasekharappa S. C., Marx S. J., Spiegel A. M., Collins F. S. A mouse model of multiple endocrine neoplasia, type 1, develops multiple endocrine tumors. Proc. Natl. Acad. Sci. USA, 98: 1118-1123, 2001.[Abstract/Free Full Text]
6. Bertolino P., Tong W. M., Galendo D., Wang Z. Q., Zhang C. X. Heterozygous Men1 mutant mice develop a range of endocrine tumors mimicking multiple endocrine neoplasia type 1. Mol. Endocrinol., 17: 1880-1892, 2003.[Abstract/Free Full Text]
7. Sauer B. Site-specific recombination: developments and applications. Curr. Opin. Biotechnol., 5: 521-527, 1994.[Medline]
8. Nagy A. Cre recombinase: the universal reagent for genome tailoring. Genesis, 26: 99-109, 2000.[Medline]
9. Metzger D., Feil R. Engineering the mouse genome by site-specific recombination. Curr. Opin. Biotechnol., 10: 470-476, 1999.[Medline]
10. Lakso M., Sauer B., Mosinger B., Jr., Lee E. J., Manning R. W., Yu S. H., Mulder K. L., Westphal H. Targeted oncogene activation by site-specific recombination in transgenic mice. Proc. Natl. Acad. Sci. USA, 89: 6232-6236, 1992.[Abstract/Free Full Text]
11. Lobe C. G., Koop K. E., Kreppner W., Lomeli H., Gertsenstein M., Nagy A. Z/AP, a double reporter for cre-mediated recombination. Dev. Biol., 208: 281-292, 1999.[Medline]
12. Akagi K., Sandig V., Vooijs M., Van der Valk M., Giovannini M., Strauss M., Berns A. Cre-mediated somatic site-specific recombination in mice. Nucleic Acids Res., 25: 1766-1773, 1997.[Abstract/Free Full Text]
13. Imanishi Y., Hosokawa Y., Yoshimoto K., Schipani E., Mallya S., Papanikolaou A., Kifor O., Tokura T., Sablosky M., Ledgard F., Gronowicz G., Wang T. C., Schmidt E. V., Hall C., Brown E. M., Bronson R., Arnold A. Primary hyperparathyroidism caused by parathyroid-targeted overexpression of cyclin D1 in transgenic mice. J. Clin. Invest., 107: 1093-1102, 2001.[Medline]
14. Haddock L., Aguilo F., Jr., Vazquez Quintana E., Vazquez M. C., Rabell V., Allende M. Clinical profile of 128 subjects operated for primary hyperparathyroidism. P. R. Health Sci. J., 17: 309-316, 1998.[Medline]
15. Heppner C., Kester M. B., Agarwal S. K., Debelenko L. V., Emmert-Buck M. R., Guru S. C., Manickam P., Olufemi S. E., Skarulis M. C., Doppman J. L., Alexander R. H., Kim Y. S., Saggar S. K., Lubensky I. A., Zhuang Z., Liotta L. A., Chandrasekharappa S. C., Collins F. S., Spiegel A. M., Burns A. L., Marx S. J. Somatic mutation of the MEN1 gene in parathyroid tumours. Nat. Genet., 16: 375-378, 1997.[Medline]
16. Kifor O., Moore F. D., Jr., Wang P., Goldstein M., Vassilev P., Kifor I., Hebert S. C., Brown E. M. Reduced immunostaining for the extracellular Ca2+-sensing receptor in primary and uremic secondary hyperparathyroidism. J. Clin. Endocrinol. Metab., 81: 1598-1606, 1996.[Abstract]

This article has been cited by other articles:

				W. Chang, C. Tu, T.-H. Chen, D. Bikle, and D. Shoback The Extracellular Calcium-Sensing Receptor (CaSR) Is a Critical Modulator of Skeletal Development Sci. Signal., September 2, 2008; 1(35): ra1 - ra1. [Abstract] [Full Text] [PDF]

				W. Chang, C. Tu, T.-H. Chen, D. Bikle, and D. Shoback The Extracellular Calcium-Sensing Receptor (CaSR) Is a Critical Modulator of Skeletal Development Sci. Signal., September 2, 2008; 1(37): ra1 - ra1. [Abstract] [Full Text]

				H-C J. Shen, J. E Rosen, L. M Yang, S. A Savage, A L. Burns, C. M Mateo, S. K Agarwal, S. C Chandrasekharappa, A. M Spiegel, F. S Collins, et al. Parathyroid tumor development involves deregulation of homeobox genes Endocr. Relat. Cancer, March 1, 2008; 15(1): 267 - 275. [Abstract] [Full Text] [PDF]

				A. Matoso, Z. Zhou, R. Hayama, A. Flesken-Nikitin, and A. Yu. Nikitin Cell lineage-specific interactions between Men1 and Rb in neuroendocrine neoplasia Carcinogenesis, March 1, 2008; 29(3): 620 - 628. [Abstract] [Full Text] [PDF]

				N. Wettschureck, E. Lee, S. K. Libutti, S. Offermanns, P. G. Robey, and A. M. Spiegel Parathyroid-Specific Double Knockout of Gq and G11 {alpha}-Subunits Leads to a Phenotype Resembling Germline Knockout of the Extracellular Ca2+-Sensing Receptor Mol. Endocrinol., January 1, 2007; 21(1): 274 - 280. [Abstract] [Full Text] [PDF]

				S Fontaniere, J Tost, A Wierinckx, J Lachuer, J Lu, N Hussein, F Busato, I Gut, Z-Q Wang, and C-X Zhang Gene expression profiling in insulinomas of Men1 {beta}-cell mutant mice reveals early genetic and epigenetic events involved in pancreatic {beta}-cell tumorigenesis Endocr. Relat. Cancer, December 1, 2006; 13(4): 1223 - 1236. [Abstract] [Full Text] [PDF]

				R. W. Schnepp, Y.-X. Chen, H. Wang, T. Cash, A. Silva, J. A. Diehl, E. Brown, and X. Hua Mutation of Tumor Suppressor Gene Men1 Acutely Enhances Proliferation of Pancreatic Islet Cells Cancer Res., June 1, 2006; 66(11): 5707 - 5715. [Abstract] [Full Text] [PDF]

				S Corbetta, L Vicentini, S Ferrero, A Lania, G Mantovani, D Cordella, P Beck-Peccoz, and A Spada Activity and function of the nuclear factor kappaB pathway in human parathyroid tumors Endocr. Relat. Cancer, December 1, 2005; 12(4): 929 - 937. [Abstract] [Full Text] [PDF]

				R. W. Schnepp, Z. Hou, H. Wang, C. Petersen, A. Silva, H. Masai, and X. Hua Functional Interaction between Tumor Suppressor Menin and Activator of S-Phase Kinase Cancer Res., September 15, 2004; 64(18): 6791 - 6796. [Abstract] [Full Text] [PDF]

				H. Sowa, H. Kaji, R. Kitazawa, S. Kitazawa, T. Tsukamoto, S. Yano, T. Tsukada, L. Canaff, G. N. Hendy, T. Sugimoto, et al. Menin Inactivation Leads to Loss of Transforming Growth Factor {beta} Inhibition of Parathyroid Cell Proliferation and Parathyroid Hormone Secretion Cancer Res., March 15, 2004; 64(6): 2222 - 2228. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Libutti, S. K. Articles by Spiegel, A. M. Search for Related Content PubMed PubMed Citation Articles by Libutti, S. K. Articles by Spiegel, A. M.