
[Cancer Research 63, 8145-8152, December 1, 2003]
© 2003 American Association for Cancer Research
Identification of the Interleukin 4 Receptor
Gene as a Direct Target for p73
Yasushi Sasaki12,
Hiroaki Mita12,
Minoru Toyota12,
Setsuko Ishida1,
Ichiro Morimoto12,
Toshiharu Yamashita1,
Toshihiro Tanaka3,
Kohzoh Imai2,
Yusuke Nakamura3 and
Takashi Tokino1
1 Department of Molecular Biology, Cancer Research Institute, and
2 First Department of Internal Medicine, Sapporo Medical University School of Medicine, Sapporo, and
3 Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, Tokyo, Japan
 |
ABSTRACT
|
|---|
p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor
(IL-4R
) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4R
transcription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4R
gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4R
gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73ß promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4R
through the unique p73-binding site. We also found that p73ß-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4R
could mediate, in part, certain immune responses and p73-dependent cell death.
 |
INTRODUCTION
|
|---|
p53 plays an important role in suppressing tumorigenic growth by transactivating target genes that facilitate cell survival or death of damaged cells (1, 2, 3, 4)
. p73 and p63, two p53 family proteins, share a high degree of structural homology with p53, especially in their DNA-binding domains (5, 6, 7, 8)
. When overexpressed in cultured cells, both proteins can bind to p53 response elements and transactivate some p53 target genes. Despite these structural and functional similarities, the p53 family members exhibit markedly divergent physiological functions (for review, see Refs. 9, 10, 11, 12
). The majority of p53 mutations found in human cancers are clustered in the DNA-binding domain, which leads to loss of sequence-specific DNA binding and transactivation, and ultimately inactivation of p53 function (13)
. Unlike p53, p73 and p63 are rarely mutated in human cancers, suggesting that these two genes are not classical tumor suppressor genes (12)
. p53-deficient mice develop normally but undergo spontaneous tumor formation (14)
. In contrast, p73-deficient mice have neurological, pheromonal, and inflammatory defects but show no increased susceptibility to spontaneous tumorigenesis (15)
. Despite these revelations, little is known about target genes specifically regulated by p73 (16, 17, 18)
. Identifying the specific targets of p73 that mediate neurogenesis and potentially regulate immune system responsiveness and homeostatic control is an important step to better understand the physiological roles of the p73 gene.
Here, we report the identification of IL-4R
4
as a novel p73-inducible gene using cDNA microarray analysis. Moreover, we identified a functional p73-binding site in the first intron of the IL-4R
gene. The p73-directed regulation of this cytokine receptor provides a potential mechanism by which p73 could participate in the inflammatory response.
 |
MATERIALS AND METHODS
|
|---|
Cell Lines and Recombinant Ad.
The human cancer cell lines used in this study were purchased from American Type Culture Collection (Manassas, VA) or Japanese Collection of Research Bioresources (Osaka, Japan). The status of the endogenous p53 gene in these lines is wild type for A172 (glioma), RKO, HCT116, and LoVo (colorectal cancers); mutant for DLD1, SW480, and BM314 (colorectal cancers) and MKN74 and MKN28 (stomach cancers); and p53 null for Saos2 (osteosarcoma) and H1299 (lung cancer). The generation, purification, and infection procedures of replication-deficient recombinant Ads containing p53 (Ad-p53), p73
(Ad-p73
), p73ß (Ad-p73ß), and p63
(Ad-p63
) genes or the bacterial lacZ (Ad-lacZ) gene were described previously (19
, 20)
. The relative efficiency of Ad infection was determined by X-gal staining of cells infected with a control Ad-lacZ. Ninety to 100% of the cells could be infected at a MOI of 50 or 100 (data not shown).
Immunoblot and Northern Blot Analysis.
The primary antibodies used for immunoblotting in this study were: mouse antihuman p53 mAb (DO-7; Santa Cruz Biotechnology, Santa Cruz, CA); mouse antihuman p73 mAb (GC-15 and ER-15; Oncogene Research, Cambridge, MA); mouse antihuman p63 mAb (4A4; Oncogene Research); rabbit antihuman IL-4R
polyclonal antibody (Santa Cruz Biotechnology); and mouse antihuman PARP mAb (PharMingen, San Diego, CA). For Northern blot analysis, total RNA (10 µg) was electrophorectically separated on a 1% agarose gel containing 2.2 M formaldehyde and blotted onto a nitrocellulose membrane (Schleicher & Schuell, Dassel, Germany). RNA was visualized with ethidium bromide to ensure that it was intact and loaded in similar amounts and to confirm proper transfer. Hybridization was performed as described previously (19)
. cDNA probes for IL-4R
(nt 35314531) and p21 (nt 11429) were amplified by RT-PCR and were sequenced to verify their identity.
cDNA Microarray.
Poly(A)+ RNA was isolated from Ad-infected DLD1 human colorectal cancer cells with the FastTrack 2.0 mRNA isolation system (Invitrogen, Carlsbad, CA) and used as a template for synthesis of Cy3- or Cy5-labeled cDNA probes. The probes were hybridized to cDNA microarrays spotted in duplicate. Approximately 9200 genes were chosen as target cDNAs, and their sequences were retrived from the UniGene database (National Center for Biotechnology Information). cDNA segments of 200-1100 bp without repetitive or polyadenylated sequences were amplified by PCR. The PCR products were purified and spotted in duplicate on type VII glass slides (Amersham) by use of a Microarray Spotter Generation III (Amersham). Microarray construction, hybridization procedures, and data analysis were described previously (21, 22, 23)
.
Flow Cytometric Analysis of IL-4R
Expression.
The 5 x 105 A172 or DLD1 cells were incubated with purified recombinant Ad at a MOI of 50. After 16 h, the cells were washed three times and incubated with rabbit antihuman IL-4R
polyclonal antibody (5 µg/ml; Santa Cruz Biotechnology) in a final volume of 200 µl of PBS with 1% BSA for 45 min at 4°C. After three washes, the cells were incubated further with a 1:50 dilution of FITC-conjugated goat antirabbit immunoglobulins (DAKO, Glostrup, Denmark) for 30 min. The cells were washed three times, followed by resuspension in 200 µl of PBS immediately before measurement. The stained cells were analyzed for antibody binding by flow cytometry using a FACSCalibur (Becton-Dickinson, Mountain View, CA). The specific fluorescence intensity was quantified as median fluorescence intensity and calculated by subtracting the background fluorescence signal.
ChIP Assay.
The ChIP assay was performed as described (24
, 25)
using the ChIP Assay kit (Upstate Biotechnology, Inc., Lake Placid, NY) and antibodies against p53 (DO-7), p73 (GC-15), acetyl-histone H4 and H3 (Upstate Biotechnology, Inc.), and p300 (Upstate Biotechnology, Inc.). The 2 x 106 cells were cross-linked with a 1% formaldehyde solution for 15 min at 37°C. The cells were then lysed in 200 µl of SDS lysis buffer and sonicated to generate 300- to 800-bp DNA fragments. After centrifugation, the cleared supernatant was diluted 10-fold with the ChIP dilution buffer and split into three equal portions; one was incubated with the specific antibody (5 µg) at 4°C for 16 h, and the other two portions were used as controls (anti-FLAG antibody and no antibody). The 1/50 volume of total extract was used for PCR amplification as the input control. Immune complexes were precipitated, washed, and eluted as recommended. DNA protein cross-links were reversed by heating at 65°C for 4 h, and the DNA fragments were purified and dissolved in 40 µl of Tris-EDTA. Two microliters of each sample were used as a template for PCR amplification. Oligonucleotide sequences for PCR primers were: 5'-TTGCCTCAGGTCCACATCTGA-3' and 5'-GATGCACCCGGTCTGACAGT-3' for +3432 (renamed the RE-IL4R) in the first intron of the IL-4R
gene; 5'-GTTCAGTGGGCAGGTTGACT-3' and 5'-GCTACAAGCAAGTCGGTGCT-3' for the MDM2 promoter containing a p53-binding sequence; 5'-AAAAGCGGGGAGAAAGTAGG-3' and 5'-CTAGCCTCCCGGGTTTCTCT-3' for the GAPDH promoter; 5'-GCAACCACTCTCACTTGGAAG-3' and 5'-GGAGAACTCTGCAGTGGATC-3' for the IL-4R
promoter. To ensure that PCR amplification was performed in the linear range, template DNA was amplified for a maximum of 30 cycles. PCR products generated from the ChIP template were sequenced to verify the identity of the amplified DNA.
Luciferase Assay.
A 104-bp fragment of the p73 response element, RE-IL4R (5'-TGGCTGGCACAGTGGAGACATGCCCAGCCACGTTTAGCTAGACTTACCATGGCTGGGCTAGAAGAGAGGCCAGGAGCTTGTCTGGAGGTTGCACAGACCTGCCC-3') and its spacer-deleted mutant form RE-IL4R/S (5'-TGGCTGGCACAGACATGCCCTAGCTAGACTTACCATGGCTGGGCTAGAAGGAGCTTGTCTGAGGTTGCACAGACCTGCCC-3') were synthesized and inserted upstream of a minimal promoter in the pGL3-promoter vector (Promega, Madison, WI), and the resulting constructs were designated pGL3-RE-IL4R and pGL3-RE-IL4R/S, respectively. pGL3-p53CBSX3 containing three copies of the synthetic consensus p53-binding sequence was used as a positive control (19
, 24
, 25)
. A nonresponsive control reporter plasmid, pGL3-p53CBSX3mut, was generated by altering the potential response sites of p53CBS (19
, 24
, 25)
. The 1 x 106 cells were cotransfected in 6-cm dishes with 1.5 µg of one of the reporter plasmids, together with 1.5 µg of a pcDNA3.1 control vector (Invitrogen) or a vector that expresses p53 or p73ß, followed by measurement of luciferase activity using the Luciferase Assay System (Promega). The ability to stimulate transcription was defined as the ratio of luciferase activity in the cells transfected with the pGL3-RE-IL4R relative to the activity in the cells transfected with the nonresponsive reporter plasmid pGL3-p53CBSX3mut. All experiments were performed in triplicate and repeated at least three times.
RNA Interference.
Human p73 siRNA (5'-CGGAUUCCAGCAUGGACGUdTdT-3') and scrambled control siRNA (5'-UAGCCACCACUGACGACCUdTdT-3') were designed as described previously (26)
. These oligonucleotides were synthesized and annealed according to the manufacturers instructions (Dhamacon Research, Lafayette, CO). The 1 x 105 cells were plated per well in 6-well plates with 2 ml of medium in each well. The following day, siRNAs were transfected using Oligofectamine (Invitrogen) to a final RNA concentration of 100 nM per well. Transfection was repeated 24 h later, and DNA-damaging agent was added to the cells 6 h after the last transfection. For semiquantitative RT-PCR analysis, cDNAs were synthesized from 5 µg of total RNA with SuperScript Preamplification System (Life Technologies, Inc.). The RT-PCR exponential phase was determined in the 20- to 30-cycle range to allow semiquantitative comparisons among cDNAs from identical reactions. The PCR conditions involved an initial denaturation step at 94°C for 2 min, followed by 30 cycles (for IL-4R
) or 25 cycles (for GAPDH) at 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min. Oligonucleotide primer sequences were: IL-4R
sense 5'-AATGCTCAGAGCTCAAGCCAG-3', IL-4R
antisense 5'-ATACAAAACTCCACCCCTTCTGT-3', GAPDH sense 5'-ACCACAGTCCATGCCATCAC-3', and GAPDH antisense 5'-TCCACCACCCTGTTGCTGTA-3'. The PCR products were visualized by electrophoresis on 1.5% agarose gels.
Detection of Apoptosis.
Apoptosis was examined by flow cytometry, PARP cleavage, and TUNEL analyses. For flow cytometry, 5 x 105 cells were incubated with purified recombinant adenovirus at a MOI of 50 (A172) or 100 (MKN74) in medium with 1% FCS. After 24 h, the cells were washed and treated with recombinant human IL-4 (Genzyme, Cambridge, MA) in serum-free medium for 2 days. A proportion of the cells was incubated with an IL-4R-neutralizing antibody (300 ng/ml; Sigma Chemical Co., St. Louis, MO) 2 h before IL-4 treatment. Both adherent and detached cells were combined, fixed in 90% cold ethanol, treated with RNase A (500 units/ml), and stained with propidium iodide (50 mg/ml). Samples were analyzed on a FACSCalibur as described previously (20)
. Experiments were repeated three times, and 50,000 events were analyzed for each sample. Data were analyzed using the ModFIT model program (Becton-Dickinson). For TUNEL assay, cells were plated at 5 x 104 cells/well in a 4-well chamber slide (Nalge Nunc, Naperville, IL). After a 24-h incubation, cells were treated as described above, except for the incubation for 36 h with recombinant human IL-4. TUNEL reactions were performed using the DeadEnd Fluorometric TUNEL system (Promega) according to the manufacturers instructions. Nuclei were counterstained with 4',6-diamidino-2-phenylindole (Sigma Chemical Co.), and coverslips were mounted in glycerol-gelatin for viewing by fluorescence microscopy.
 |
RESULTS
|
|---|
p73 Induces Expression of IL-4R
mRNA and Protein.
In an effort to identify targets specifically regulated by p73, we performed cDNA microarray analysis and compared expression patterns in a human colorectal cell line, DLD1, transfected separately with Ad-p53, Ad-p73ß, and Ad-p63
. We mainly used p73ß and p63
isoforms in this study, because it has been reported that transcription of p53 target genes was up-regulated more strongly by p73ß and p63
than by p73
and p63
, respectively (6
, 19
, 27)
. Infection with Ad-p53, Ad-p73
, Ad-p73ß, and Ad-p63
resulted in expression of exogenous p53, p73
, p73ß, and p63
proteins, respectively (Fig. 1)
. Approximately 9,200 genes were examined for specific up-regulation by p73 by calculating the ratio of expression intensity in p73-transfected cells to that in lacZ-transfected cells. Data from two independent hybridizations were averaged. We compiled a list of p73-response genes, defined as having a >3-fold up-regulation in the presence of p73 (p73-transfected DLD1:lacZ-transfected DLD1 ratio). Additionally, only those hybridization signals with an intensity of
100,000 arbitrary units were selected, because of potentially large experimental variations that were observed for lower hybridization values. We found that 61 genes were up-regulated by >3-fold in the p73-transfected cells.5
Of these 61 genes, 27 also had a >2-fold expression ratio in p73-transfected cells relative to p53-transfected cells. Therefore, 0.3% of the genes on the microarray were specifically up-regulated by p73 but not significantly by p53. In this initial screening, the IL-4R
gene was reproducibly up-regulated at least 6-fold in p73-transfected cells compared with p53-transfected cells. Northern blot analysis demonstrated that expression of the IL-4R
gene was considerably increased in DLD1 cells infected with Ad-p73ß in a time-dependent manner but was not significantly induced by infection with Ad-p53 or Ad-p63
(Fig. 2A)
. The IL-4R
induction was observed as early as 12 h after Ad-p73ß infection. In contrast, the p21 gene was induced by p53 as well as by its family members (Fig. 2A)
.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 2. Induction of IL-4R by p73 A, time course of IL-4R mRNA induction after Ad-mediated transfer of genes of the p53 family in DLD1 cells. DLD1 cells were infected with adenoviruses at a MOI of 50, and the cells were harvested at the indicated times after infection. Total RNA was extracted and subjected to Northern blot analysis. Total RNA (10 µg) was loaded in each lane, and the same filter was rehybridized with human IL-4R and p21 cDNAs. Ethidium bromide staining of 28S rRNA (28S) in the bottom row shows that equal amounts of RNA were loaded in each lane. B and C, Northern blot analysis shows IL-4R induction in human cancer cell lines. Ten human cancer cell lines were infected with Ads at a MOI of 50 or 100. Ten micrograms of total RNA isolated 24 h after infection were used for Northern blot analysis. D, up-regulation of IL-4R on the cell surface after Ad-mediated transfer of p73ß. DLD1 and A172 cells were infected with Ad-lacZ, Ad-p53, or Ad-p73ß for 24 h. IL-4R on the cell surface was analyzed by flow cytometry with an IL-4R -specific antibody. Profiles from a single experiment are shown that are representative of the three experiments. The specific fluorescence intensity was calculated as median fluorescence intensity (MFI) of anti-IL-4R -stained sample minus MFI of unstained control. Results were reported as the mean ± SD of MFI. E, immunoblot analysis was performed on cell lysates (15 µg) from human cancer cells 24 h after infection with Ad-lacZ, Ad-p53, Ad-p73 , Ad-p73ß, or Ad-p63 . Cell extracts were separated by electrophoresis on a 7.5% SDS/acrylamide gel and analyzed by immunoblotting using the rabbit antihuman IL-4R polyclonal antibody.
|
|
To determine whether IL-4R
induction by p73 is confined to DLD1 cells, we examined the effect of transduction of p73 in 10 human cancer cell lines. As a result, IL-4R
mRNA was relatively highly induced in response to expression of exogenous p73ß in all 10 cell lines examined (Fig. 2, B and C)
. Although a similar induction was seen in Ad-p53- or Ad-p63
-infected Saos2 cells, IL-4R
induction by p53 or p63
was considerably less in the other nine cell lines. In contrast, p21 was activated by p53 and p63
in each of these cell lines (Fig. 2, B and C)
. Moreover, IL-4R
mRNA was up-regulated by p73
, which has been reported to be less potent in transcriptional activity than p73ß (Fig. 2C)
. To determine whether the increase in IL-4R
mRNA was accompanied by an increase in protein expression, we then examined the level of IL-4R
protein on the cell surface by flow cytometry using an antibody against human IL-4R
. Fig. 2D
shows up-regulation of the IL-4R
protein on the surface of DLD1 and A172 cells after Ad-p73ß infection but not significantly after infection with the p53 gene. These data were further confirmed by immunoblot analysis for IL-4R
that demonstrated increased total cellular IL-4R
protein in p73
- and p73ß-transfected cells (Fig. 2E)
, consistent with the Northern blot analysis (Fig. 2, AC)
. Taken together, the results presented here suggest that IL-4R
is a relatively specific target of p73.
Identification of a Specific Binding Sequence for p73 in the IL-4R
Gene.
To determine whether IL-4R
is a direct target of transcriptional activation by p73, we searched for p53 consensus binding sequences in the genomic locus encoding human IL-4R
(GenBank accession no. AC004525), because the p73 protein can potentially bind to p53-binding sequences (5, 6, 7, 8
, 28)
. We found 10 candidate p53-binding sites at the positions -3738, -1230, -366, +681, +1068, +3099, +3432, +4922, +7637, and +13211, where +1 represents the transcription start site. To determine whether the p73 protein can selectively bind to any of these candidate sequences in vivo, we performed a ChIP assay using A172 cells infected with either Ad-p53 or Ad-p73ß. Immunoprecipitation of DNA-protein complexes using antibodies against p53 and p73 was performed on formaldehyde-cross-linked extract from Ad-p53- and Ad-p73ß-infected cells, respectively. We then measured the abundance of candidate sequences within the immunoprecipitated complexes by PCR amplification. The ChIP assay revealed that the p73ß protein reproducibly resided at a DNA fragment containing the candidate +3432 in A172 cells (Fig. 3B
, Lane 8). We designated this p73-binding sequence RE-IL4R. The RE-IL4R consists of eight copies of the consensus 10-bp motif (Fig. 3A)
. In contrast, p53 protein binding to RE-IL4R was not detectable in Ad-p53-infected cells, as assessed by the ChIP assay with an anti-p53 antibody and subsequent PCR amplification (Fig. 3B
, Lane 5). The other nine candidate sequences were amplified in the input chromatin-positive control for PCR but not in the immunoprecipitates with anti-p53 or anti-p73 antibodies (e.g., +4922 in Fig. 3B
). As a positive control for the ChIP assay, we analyzed the interaction of p53 and p73 proteins with the MDM2 promoter that contains a p53 response element. As expected, both p53 and p73 proteins resided at the MDM2 promoter in vivo (Fig. 3B
, first row, Lanes 5 and 8). These ChIP assay results from A172 cells are consistent with those from DLD1 cells (Fig. 3B
, fourth row). Although we cannot exclude a low level of p53 binding to RE-IL4R, our data indicate that p73 is selectively associated with this site in vivo.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3. p73 response element in the human IL-4R gene. A, the position and sequence of a p73 response element, RE-IL4R, are shown. RE-IL4R is located in the first intron of the IL-4R gene and consists of eight copies of the consensus 10-bp motif of the p53-binding sequence. The consensus sequences are indicated by uppercase letters, and the spacer sequences between the 10-bp motifs are underlined. R, purine; Y, pyrimidine; W, adenine or thymidine; RE-IL4R/S, an artificial site lacking the spacer sequence. B, p73ß protein binds to the RE-IL4R site in vivo. ChIP assay of a genomic fragment (nt position +3315 to +3618, where +1 represents the transcription initiation site) containing the RE-IL4R site in Ad-p53-infected (Lanes 57) or Ad-p73ß-infected A172 cells (Lanes 810) is shown (second row). Immunoprecipitation was performed using a gene-specific antibody against p53 (Lane 5) and p73 (Lane 8), followed by PCR amplification. Input chromatin (input), which represents a portion of the sonicated chromatin before immunoprecipitation, and genomic DNA were used as positive controls (Lanes 24). Immunoprecipitates with an anti-FLAG antibody (Lanes 6 and 9) or in the absence of antibody (no antibody; Lanes 7 and 10) served as negative controls. DW, no template control (Lane 1). PCR amplification revealed that a similar amount of MDM2 promoter sequence is present in p53 and p73 complexes extracted from each immunoprecipitate (first row). The DNA fragment containing the RE-IL4R sequence was amplified in the samples immunoprecipitated with an antibody against p73 (second and fourth rows for A172 and DLD1 cells, respectively; Lane 8). The other candidate sequences were amplified in the chromatin input control but not in the samples immunoprecipitated with an antibody against p53 or p73 (e.g., third row, +4922). C, the RE-IL4R sequence is responsive to p73ß. Plasmid constructs containing RE-IL4R or its deletion mutant lacking the four spacers (RE-IL4R/S; see Fig. 4A
) were cloned into a luciferase reporter containing a minimal promoter. DLD1 and Saos2 cells were cotransfected with a control pcDNA3.1 vector or a vector that expresses p53 or p73ß, together with each reporter plasmid. Luciferase activity was measured 48 h after transfection. pGL3-p53CBSX3 containing three copies of the p53-consensus binding sequence was used as a positive control. Relative luciferase activity is indicated relative to the activity of the nonresponsive pGL3-p53CBSX3mut vector (see "Materials and Methods"). All experiments were performed in triplicate, and the mean and SD are indicated by the bars and brackets, respectively.
|
|
To determine whether the RE-IL4R sequence confers p73-dependent transcriptional activity, we performed a heterologous promoter-reporter assay using a luciferase vector prepared by cloning the oligonucleotide corresponding to RE-IL4R upstream of a minimal promoter (see "Materials and Methods"). DLD1 and Saos2 cells were transiently cotransfected with pGL3-RE-IL4R, together with a p53- or p73ß-expressing plasmid. Fig. 3C
shows that luciferase activity from pGL3-RE-IL4R is higher in cells cotransfected with p73ß than with p53. These results are consistent with the strong induction of endogenous IL-4R
by p73ß in several cancer cell lines (Fig. 2)
. As a control, we demonstrated that luciferase activity from a reporter, pGL3-p53CBSX3 (containing three copies of a p53 consensus binding sequence), was higher in cells cotransfected with p53 than those transfected with p73 (Fig. 3C)
. Together, these results also support the idea that the RE-IL4R can mediate p73-dependent transcriptional activation, leading to the conclusion that IL-4R
is a direct target of p73.
The RE-IL4R consists of eight copies of the consensus 10-bp motif separated by 5-, 9-, 0-, 0-, 9-, 1-, and 0-bp nucleotides (Fig. 3A)
, whereas, in general, the p53 response sequences that confer both p53 binding and transactivation contain fewer bp between the 10-bp motifs (28
, 29)
. Therefore, the spacer sequence may be important for determining the binding specificity of the p53 family member proteins. To test the significance of the RE-IL4R spacer sequences for transactivation of the IL-4R
gene, we constructed an artificial DNA element lacking the spacer sequences (RE-IL4R/S; Fig. 3A
). Deletion of the four spacers in RE-IL4R resulted in a significant decrease of luciferase activity after Ad-p73ß infection in both DLD1 and Saos2 cells (Fig. 3C)
. In contrast, this mutation had a less significant effect on p53 responsiveness (Fig. 3C)
. These results indicate that the spacer sequence in RE-IL4R is important for specific binding to the p73 protein.
Induction of IL-4R
in Human Cancer Cells Treated with Cisplatin.
Previous studies revealed that p73
protein isoform is increased in cells exposed to chemotherapetic agents through transcription and protein stabilization (26
, 30, 31, 32)
. In contrast, it has been reported that the p73 gene is inactivated in several human cancer cells because of DNA methylation in its promoter region (33, 34, 35, 36)
. We found that BM314 colorectal cancer cells and MKN28 stomach cancer cells showed loss of p73 expression (Fig. 4A)
as a result of promoter-specific DNA methylation (data not shown). To assess transcriptional induction of IL-4R
at more physiological levels of p73, we used cisplatin, a DNA-damaging agent known to activate endogenous p73
in human cancer cells (26
, 30, 31, 32)
. As shown in Fig. 4A
, endogenous p73
protein increased in DLD1 and SW480 cells after exposure to 10 µM cisplatin for 24 h. In striking contrast, p73 protein was not detectable even after cisplatin treatment in BM314 and MKN28 cells in which the p73 gene is methylated. We then examined whether IL-4R
expression could be induced after cisplatin treatment of these four cell lines. Northern blot analysis showed a parallel elevation of IL-4R
mRNA in DLD1 and SW480 cells after cisplatin treatment but not in BM314 and MKN28 cells (Fig. 4B)
. To further confirm increased IL-4R
after cisplatin treatment and to verify that the response was dependent on p73, we down-regulated endogenous p73 specifically using siRNA corresponding to part of the p73 cDNA sequence, as described previously (26)
. Transfection of p73 siRNA (p73), but not untreated (mock) or scramble siRNA (p73-sc), resulted in decreased p73
protein in DLD1 cells without affecting the levels of ß-actin [Fig. 4C
, CDDP(-)]. Furthermore, p73 siRNA strongly inhibited the accumulation of p73
after cisplatin treatment [Fig. 4C
, CDDP(+)]. Importantly, p73 siRNA, but not scramble siRNA (p73-sc), inhibited basal expression as well as induction of IL-4R
mRNA after cisplatin treatment in a similar manner (Fig. 4D)
. Finally, we demonstrated by ChIP assay that endogenous p73 protein interacts with the chromatin region containing its specific binding site RE-IL4R in DLD1 cells treated with cisplatin (Fig. 4E
, Lane 7). These results indicate that activation of endogenous p73 by cisplatin mediates induction of the IL-4R
gene.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4. Regulation of IL-4R expression by endogenous p73. A, endogenous p73 is accumulated in response to cisplatin treatment in human cancer cells. Anti-p73 immunoblots are shown containing whole extracts (15 µg) from cells untreated (0) or treated with 10 µM cisplatin (CDDP) for 24 h. p73 is induced in DLD1 and SW480 cells but not in BM314 and MKN28 cells in which the p73 gene is methylated. To confirm equal loading, the blots were also probed with an antibody against control protein ß-actin. B, Northern blot analysis shows an elevation of IL-4R mRNA levels in DLD1 and SW480 cells exposed to cisplatin for 24 h. IL-4R induction after cisplatin treatment is defective in BM314 and MKN28 cells in which p73 is inactivated. Ethidium bromide staining of 28S rRNA (28S) in the bottom row shows that equal amounts of RNA were loaded in each lane. C, p73 siRNA inhibits p73 induction after cisplatin treatment. DLD1 cells were transfected twice with p73 siRNA (p73), scramble siRNA (p73-sc), or were mock transfected. Twenty-four hours after transfection, cells were either left untreated (-) or exposed to cisplatin (+; 10 µM). After 24 h, cell lysates were prepared and analyzed for p73 and ß-actin by immunoblot. D, p73 siRNA antagonizes the activity of cisplatin on IL-4R mRNA expression. DLD1 cells were transfected with siRNA and were treated with cisplatin as described above. Semiquantitative RT-PCR was performed to assess IL-4R mRNA levels. Expression of the GAPDH gene was examined as a quality control. E, a ChIP assay for the presence of p73 protein at RE-IL4R was performed on untreated (control; Lanes 5 and 6), cisplatin-treated (CDDP; Lanes 7 and 8), or Ad-p73ß-infected (Lanes 9 and 10) DLD1 cells.
|
|
Histone Acetylation and Recruitment of p300 to the p73 Response Element and the IL-4R
Promoter by p73ß Overexpression.
Gene regulation by p53 occurs in discrete stages: interaction with its binding sites in target genes and then transactivation of the transcriptional machinery. Recently, it has been reported that p53 selectively regulates its target genes through recruitment of specific cofactors of histone acetyltransferase to form structurally distinct p53-binding sites (37
, 38)
. Although a wealth of information exists concerning p73, little is known about the actual mechanism by which the p73 protein regulates expression of its target genes as a consequence of direct interaction with the response elements. Thus, we examined the status of histone acetylation at the specific p73-binding site, RE-IL4R by ChIP assays using antibodies against acetylated histones H4 and H3. The levels of histone acetylation were increased by p73ß but not significantly by p53 (Fig. 5A)
, indicating that histone acetylation at RE-IL4R correlated with expression of the IL-4R
gene. We then examined the status of histone acetylation at the promoter region of the IL-4R
gene. Histones H4 and H3, which were bound to the IL-4R
promoter, were acetylated on p73ß expression but not significantly by p53 (Fig. 5A)
. In contrast, the level of histone acetylation at the MDM2 promoter was considerably enhanced in response to both p73ß and p53 (Fig. 5A)
. Treatment of cells with depsipeptide, a HDAC inhibitor, caused an increase in histone acetylation levels (Fig. 5A
, HDACI). We further tested whether p73ß influenced the localization of acetylated histones by temporal recruitment of the histone acetyltransferase p300 in vivo. Strikingly, p300 was recruited to RE-IL4R as well as the IL-4R
promoter region within 6 h after Ad-p73ß infection (Fig. 5B)
. Our data suggest that the histone acetyltransferase complex, including p300, may activate p73-dependent transcription by targeted nucleosomal acetylation of the promoter region when recruited by the p73 protein bound to the p73 response element, RE-IL4R, located 3.4 kb downstream of the promoter.
IL-4 Induces Apoptosis in p73-transfected Cells.
We reported previously that overexpression of p73 causes apoptosis in a number of cancer cell lines, whereas other cell lines are resistant to p73- or p53-mediated apoptosis (20)
. IL-4 is a pleiotropic cytokine produced by mast cells and T lymphocytes and acts via the IL-4R. Recent studies have shown that IL-4 induces growth inhibition and apoptosis in cells from several solid tumors in vitro (39, 40, 41, 42, 43)
. Thus, we tested whether IL-4R
induction mediated by p73 could enhance the sensitivity of tumor cells to IL-4-mediated apoptosis, as measured by the appearance of hypodiploid cells detected by propidium iodide staining and flow cytometry. We used A172 and MKN74 cells, which are relatively resistant to apoptosis when treated with p53 family gene transfer alone. In the absence of IL-4, transduction of Ad-p53 or Ad-p73ß did not induce apoptosis in either of the cell lines (Fig, 6A)
. Cells infected with Ad-lacZ or Ad-p53 were not sensitive to the apoptotic effect of IL-4. However, when cells were infected with Ad-p73ß, sensitivity to IL-4 was increased in a dose-dependent manner. The specificity for the response to IL-4 was then confirmed using a neutralizing anti-IL-4R antibody. When A172 and MKN74 cells were preincubated with this neutralizing antibody before IL-4 treatment, IL-4-mediated apoptosis was inhibited in the p73-transfected cells (Fig. 6A)
. The inhibition was likely mediated by blocking of the ligand-receptor interaction. These results were confirmed further by TUNEL and PARP cleavage analyses. TUNEL analysis showed that 28% of the p73-transfected A172 cells underwent apoptosis 36 h after IL-4 treatment (Fig. 6B)
, whereas TUNEL-positive cells were significantly fewer in p73-transfected A172 cells without IL-4 treatment (3%) or in lacZ-transfected A172 cells with IL-4 treatment (0.5%). Additionally, IL-4-mediated apoptosis in p73-transfected A172 cells was clearly inhibited by neutralizing anti-IL-4R antibody (4.5% of TUNEL-positive cells). PARP protein cleavage is mediated by activated caspases, an event commonly used as an apoptotic hallmark. Fig. 6C
shows that PARP cleavage was detected in p73-transfected A172 cells 48 h after IL-4 treatment (Lane 6), whereas the addition of anti-IL-4R antibody blocked the effect on cleavage (Lane 7). These results suggest that p73 can potentially enhance the sensitivity of solid tumor cells to IL-4-mediated apoptosis.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 6. IL-4 induces apoptosis in Ad-p73ß-infected cancer cells. A, A172 and MKN74 cells (2 x 105) were infected with Ads for 24 h, treated with 5 or 10 ng/ml of recombinant human IL-4 in serum-free medium, and then analyzed by flow cytometry after 48 h. A proportion of the cells were incubated with an IL-4R-neutralizing antibody 2 h before IL-4 treatment. Bars, mean ± SE of triplicate samples. B, TUNEL assay. A172 cells were infected with Ad-lacZ or Ad-p73ß for 24 h, treated with 10 ng/ml recombinant human IL-4 in serum-free medium, and grown on a chamber slide. After 36 h, the slides were incubated and TUNEL stained. Nuclear DNA was stained with 4',6-diamidino-2-phenylindole. C, immunoblotting detection of PARP protein cleavage. A172 cells were treated as described above, and 20 µg of total protein were separated by SDS-PAGE. Immunoblot of caspase-cleaved PARP (p85) and control actin protein are shown.
|
|
 |
DISCUSSION
|
|---|
Previous studies demonstrated that many p53 target genes are regulated by each of the p53 family members, whereas there are also considerable differences of gene inducibility among p53 family members. This suggests that some signaling pathways are shared by all members of the p53 family, whereas each member also has its unique signaling pathway responsible for their diverging biological activities. In the present study, we have identified the gene encoding the IL-4R
chain as a direct target for p73. Thus, our result is the first to implicate a link between the p73 gene and cytokine signaling. Both IL-4R
mRNA and protein were induced in response to p73 in several human cancer cells, regardless of the status of the p53 gene. A recent study reported that IL-4R
mRNA can be induced by p73
overexpression (44)
, which is consistent with our findings. We also showed that cisplatin treatment coincided with induction of IL-4R
mRNA in a p73-dependent manner. By specifically knocking down p73 with siRNA, we add another result showing that p73 greatly contributes to IL-4R
induction. Our results indicate that p73 is likely an indispensable mediator of IL-4R
induction after cisplatin treatment. Additionally, we have identified a specific binding site, RE-IL4R, for the p73 protein in the first intron of the IL-4R
gene. Direct binding of the p73 protein to RE-IL4R in vivo was confirmed by a ChIP assay.
Nearly all p53 response elements reported previously contain two adjacent copies of the 10-bp p53-binding motif (1
, 45)
, whereas studies in our laboratory and in others of response elements for p73 and p63 within the Jagged 1 (24)
and AQP3 (16)
genes and the p73 gene itself (46)
show that these elements consist of three or four copies of the 10-bp consensus p53-binding motif separated by spacer sequences. We demonstrated here that the spacer sequences in RE-IL4R enhance p73-specifc transactivation of the IL-4R
gene (Fig. 4)
, suggesting that spacing between at least three of the copies of the 10-bp motif may be important for p73-specific transcriptional activation. Taken together, our results clearly indicate that the IL-4R
gene is a direct and relatively specific target for p73. The results of the ChIP assay in our study suggest that p73ß recruits the p300 complex and directs histone acetylation at its response element and that p300 mediates p73-dependent transcription by acetylation of p73-bound nucleosomes. Thus, p73 may be a chromatin-binding protein that selectively regulates its target genes through recruitment of histone acetyltransferase complex to the distinct binding sites. Because the RE-IL4R is located 3.4 kb downstream from the IL-4R
promoter, it remains unclear how p300 is recruited to IL-4R
promoter. It will be important to determine how other transcriptional factors interact with the p73 protein and RNA polymerase II machinery as well as how they establish a constitutively active chromatin structure around the promoter.
Although our data suggest that IL-4R
activation results from an activity of p73 not shared by p53, a critical question is whether physiological roles of p73 are functionally dependent on the induction of the IL-4R
gene. IL-4 is a multifunctional cytokine that plays several critical roles in the regulation of immune responses (47)
. IL-4 initiates its actions by binding to and signaling through two types of receptors (48)
. The type I heterodimer is composed of the IL-4R
and the common
chains, whereas the type II receptor is composed of IL-4R
and IL-13R
1 chains (49, 50, 51)
. We found that neither the common
chain nor the IL-13R
1 chain was significantly induced by p73, p63, or p53 in A172 or DLD1 cells (data not shown). Previous studies demonstrated that ligand-dependent IL-4R internalization could occur through the IL-4R
chain alone or through both IL-4R
and IL-13R
1 chains, suggesting that the IL-4R
chain is a major binding component in the IL-4R system (52
, 53)
. The fact that IL-4R
is a direct target of p73, therefore, provides an attractive hypothesis concerning a role of p73 in the immune response. Additionally, an abnormal regulation of IL-4 signaling is associated with allergic diseases, autoimmune diseases, and parasitic infections (54, 55, 56, 57, 58)
. It seems possible that the inflammatory defects seen in p73-deficient mice may reflect, in part, the loss of normal regulation of IL-4R.
IL-4 has been considered for anticancer therapy because of its ability to increase the host cell immune response (59, 60, 61)
. This strategy relies on the up-regulation of major histocompatibility complex antigens by IL-4. It has also been reported that IL-4 can cause growth inhibitory effects on various cancer cells (39, 40, 41, 42, 43
, 62)
. However, its cytotoxicity is limited in cancer cell types that express little or no IL-4R (43
, 62)
. Another important aspect of this work is that p73 overexpression enhanced the sensitivity of tumor cells to the cytotoxic effect of IL-4 in vitro. Therapeutic replacement of the wild-type p53 gene has been pursued as a potential gene therapy strategy in a variety of cancer types. Similar to p53, p73 can cause some cancer cells to undergo apoptosis, whereas others simply undergo prolonged cell-cycle arrest. Here, we performed p73 overexpression in combination with IL-4 treatment and noted the induction of apoptosis. Recently, a recombinant IL-4 cytotoxin that is composed of IL-4 and a mutated form of Pseudomonas exotoxin has been shown to be highly cytotoxic to IL-4R-positive cancer cells in vitro and in vivo (52
, 63
, 64)
. Our findings, therefore, justify the investigation of p73 overexpression as a single agent or in combination with IL-4 or IL-4 cytotoxin for the treatment of human cancers.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Joseph F. Costello for critical comments about this manuscript.
 |
FOOTNOTES
|
|---|
Grant support: Grants-in-Aid for Cancer Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Takashi Tokino, Department of Molecular Biology, Cancer Research Institute, Sapporo Medical University School of Medicine, S-1, W-17, Chuo-ku, Sapporo 060-8556, Japan. Phone: 81-11-611-2111, extension 2410; Fax: 81-11-618-3313; E-mail: tokino{at}sapmed.ac.jp
4 The abbreviations used are: IL-4R, interleukin 4 receptor; Ad, adenovirus; MOI, multiplicity of infection; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PARP, poly(ADP-ribose) polymerase; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling; mAb, monoclonal antibody; ChIP, chromatin immunoprecipitation; nt, nucleotide; RE-IL4R, response element in IL-4R
; siRNA, double-stranded RNA oligonucleotide; HDAC, histone deacetylase. 
5 Unpublished observations. 
Received 2/20/03.
Revised 8/26/03.
Accepted 9/18/03.
 |
REFERENCES
|
|---|
- El-Deiry W. S. Regulation of p53 downstream genes. Semin. Cancer Biol., 8: 345-357, 1998.[Medline]
- Tokino T., Nakamura Y. The role of p53-target genes in human cancer. Crit. Rev. Oncol. Hematol., 33: 1-6, 2000.[Medline]
- Vogelstein B., Lane D., Levine A. J. Surfing the p53 network. Nature (Lond.), 408: 307-310, 2000.[Medline]
- Sharpless N. E., DePinho R. A. p53: good cop/bad cop. Cell, 110: 9-12, 2002.[Medline]
- Kaghad M., Bonnet H., Yang A., Creancier L., Biscan J. C., Valent A., Minty A., Chalon P., Lelias J. M., Dumont X., Ferrara P., McKeon F., Caput D. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell, 90: 809-819, 1997.[Medline]
- Yang A., Kaghad M., Wang Y., Gillett E., Fleming M. D., Dotsch V., Andrews N. C., Caput D., McKeon F. p63, a p53 homolog at 3q2729, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol. Cell, 2: 305-316, 1998.[Medline]
- Osada M., Ohba M., Kawahara C., Ishioka C., Kanamaru R., Katoh I., Ikawa Y., Nimura Y., Nakagawara A., Obinata M., Ikawa S. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat. Med., 4: 839-843, 1998.[Medline]
- Jost C. A., Marin M. C., Kaelin W. G., Jr. p73 is a human p53-related protein that can induce apoptosis. Nature (Lond.), 389: 191-194, 1997.[Medline]
- Yang A., Kaghad M., Caput D., McKeon F. On the shoulders of giants: p63, p73 and the rise of p53. Trends Genet., 18: 90-95, 2002.[Medline]
- Irwin M. S., Kaelin W. G. p53 family update: p73 and p63 develop their own identities. Cell Growth Differ., 12: 337-349, 2001.[Free Full Text]
- Yang A., McKeon F. P63 and P73: P53 mimics, menaces and more. Nat. Rev. Mol. Cell. Biol., 1: 199-207, 2000.[Medline]
- Melino G., De Laurenzi V., Vousden K. H. p73: friend or foe in tumorigenesis. Nat. Rev. Cancer, 2: 605-615, 2002.[Medline]
- Hollstein M., Hergenhahn M., Yang Q., Bartsch H., Wang Z. Q., Hainaut P. New approaches to understanding p53 gene tumor mutation spectra. Mutat. Res., 431: 199-209, 1999.[Medline]
- Donehower L. A., Harvey M., Slagle B. L., McArthur M. J., Montgomery C. A., Jr., Butel J. S., Bradley A. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature (Lond.), 356: 215-221, 1992.[Medline]
- Yang A., Walker N., Bronson R., Kaghad M., Oosterwegel M., Bonnin J., Vagner C., Bonnet H., Dikkes P., Sharpe A., McKeon F., Caput D. p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature (Lond.), 404: 99-103, 2000.[Medline]
- Zheng X., Chen X. Aquaporin 3, a glycerol and water transporter, is regulated by p73 of the p53 family. FEBS Lett., 489: 4-7, 2001.[Medline]
- Blint E., Phillips A. C., Kozlov S., Stewart C. L., Vousden K. H. Induction of p57(KIP2) expression by p73ß. Proc. Natl. Acad. Sci. USA, 99: 3529-3534, 2002.[Abstract/Free Full Text]
- Shinbo J., Ozaki T., Nakagawa T., Watanabe K., Nakamura Y., Yamazaki M., Moriya H., Nakagawara A., Sakiyama S. p73-dependent expression of DAN during cisplatin-induced cell death and osteoblast differentiation. Biochem. Biophys. Res. Commun., 295: 501-507, 2002.[Medline]
- Ishida S., Yamashita T., Nakaya U., Tokino T. Adenovirus-mediated transfer of p53-related genes induces apoptosis of human cancer cells. Jpn. J. Cancer Res., 91: 174-180, 2000.[Medline]
- Sasaki Y., Morimoto I., Ishida S., Yamashita T., Imai K., Tokino T. Adenovirus-mediated transfer of the p53 family genes, p73 and p51/p63 induces cell cycle arrest and apoptosis in colorectal cancer cell lines: potential application to gene therapy of colorectal cancer. Gene Ther., 8: 1401-1408, 2001.[Medline]
- Ono K., Tanaka T., Tsunoda T., Kitahara O., Kihara C., Okamoto A., Ochiai K., Takagi T., Nakamura Y. Identification by cDNA microarray of genes involved in ovarian carcinogenesis. Cancer Res., 60: 5007-5011, 2000.[Abstract/Free Full Text]
- Nishimori H., Sasaki Y., Yoshida K., Irifune H., Zembutsu H., Tanaka T., Aoyama T., Hosaka T., Kawaguchi S., Wada T., Hata J., Toguchida J., Nakamura Y., Tokino T. The Id2 gene is a novel target of transcriptional activation by EWS-ETS fusion proteins in Ewing family tumors. Oncogene, 21: 8302-8309, 2002.[Medline]
- Watanabe G., Nishimori H., Irifune H., Sasaki Y., Ishida S., Zembutsu H., Tanaka T., Kawaguchi S., Wada T., Hata J., Kusakabe M., Yoshida K., Nakamura Y., Tokino T. Induction of tenascin-C by tumor-specific EWS-ETS fusion genes. Genes Chromosomes Cancer, 36: 224-232, 2003.[Medline]
- Sasaki Y., Ishida S., Morimoto I., Yamashita T., Kojima T., Kihara C., Tanaka T., Imai K., Nakamura Y., Tokino T. The p53 family member genes are involved in the Notch signal pathway. J. Biol. Chem., 277: 719-724, 2002.[Abstract/Free Full Text]
- Morimoto I., Sasaki Y., Ishida S., Imai K., Tokino T. Identification of the osteopontin gene as a direct target of TP53. Genes Chromosomes Cancer, 33: 270-278, 2002.[Medline]
- Irwin M. S., Kondo K., Marin M. C., Cheng L. S., Hahn W. C., Kaelin W. G. Chemosensitivity linked to p73 function. Cancer Cell, 3: 403-410, 2003.[Medline]
- Prabhu N. S., Somasundaram K., Satyamoorthy K., Herlyn M., El-Deiry W. S. p73ß, unlike p53, suppresses growth and induces apoptosis of human papillomavirus E6-expressing cancer cells. Int. J. Oncol., 13: 5-9, 1998.[Medline]
- El-Deiry W. S., Kern S. E., Pietenpol J. A., Kinzler K. W., Vogelstein B. Definition of a consensus binding site for p53. Nat. Genet., 1: 45-49, 1992.[Medline]
- Tokino T., Thiagalingam S., El-Deiry W. S., Waldman T., Kinzler K. W., Vogelstein B. p53 tagged sites from human genomic DNA. Hum. Mol. Genet., 3: 1537-1542, 1994.[Abstract/Free Full Text]
- Gong J. G., Costanzo A., Yang H. Q., Melino G., Kaelin W. G., Jr., Levrero M., Wang J. Y. The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature (Lond.), 399: 806-809, 1999.[Medline]
- Agami R., Blandino G., Oren M., Shaul Y. Interaction of c-Abl and p73
and their collaboration to induce apoptosis. Nature (Lond.), 399: 809-813, 1999.[Medline]
- Yuan Z. M., Shioya H., Ishiko T., Sun X., Gu J., Huang Y. Y., Lu H., Kharbanda S., Weichselbaum R., Kufe D. p73 is regulated by tyrosine kinase c-Abl in the apoptotic response to DNA damage. Nature (Lond.), 399: 814-817, 1999.[Medline]
- Corn P. G., Kuerbitz S. J., van Noesel M. M., Esteller M., Compitello N., Baylin S. B., Herman J. G. Transcriptional silencing of the p73 gene in acute lymphoblastic leukemia and Burkitts lymphoma is associated with 5' CpG island methylation. Cancer Res., 59: 3352-3356, 1999.[Abstract/Free Full Text]
- Chen C. L., Ip S. M., Cheng D., Wong L. C., Ngan H. Y. P73 gene expression in ovarian cancer tissues and cell lines. Clin. Cancer Res., 6: 3910-3915, 2000.[Abstract/Free Full Text]
- Dong S., Pang J. C., Hu J., Zhou L. F., Ng H. K. Transcriptional inactivation of TP73 expression in oligodendroglial tumors. Int. J. Cancer, 98: 370-375, 2002.[Medline]
- Araki D., Uzawa K., Watanabe T., Shiiba M., Miyakawa A., Yokoe H., Tanzawa H. Frequent allelic losses on the short arm of chromosome 1 and decreased expression of the p73 gene at 1p36.3 in squamous cell carcinoma of the oral cavity. Int. J. Oncol., 20: 355-360, 2002.[Medline]
- Barlev N. A., Liu L., Chehab N. H., Mansfield K., Harris K. G., Halazonetis T. D., Berger S. L. Acetylation of p53 activates transcription through recruitment of coactivators/histone acetyltransferases. Mol. Cell, 8: 1243-1254, 2001.[Medline]
- Espinosa J. M., Emerson B. M. Transcriptional regulation by p53 through intrinsic DNA/chromatin binding and site-directed cofactor recruitment. Mol. Cell, 8: 57-69, 2001.[Medline]
- Toi M., Bicknell R., Harris A. L. Inhibition of colon and breast carcinoma cell growth by interleukin-4. Cancer Res., 52: 275-279, 1992.[Abstract/Free Full Text]
- Obiri N. I., Hillman G. G., Haas G. P., Sud S., Puri R. K. Expression of high affinity interleukin-4 receptors on human renal cell carcinoma cells and inhibition of tumor cell growth in vitro by interleukin-4. J. Clin. Invest., 91: 88-93, 1993.
- Lahm H., Schnyder B., Wyniger J., Borbenyi Z., Yilmaz A., Car B. D., Fischer J. R., Givel J. C., Ryffel B. Growth inhibition of human colorectal-carcinoma cells by interleukin-4 and expression of functional interleukin-4 receptors. Int. J. Cancer, 59: 440-447, 1994.[Medline]
- Topp M. S., Papadimitriou C. A., Eitelbach F., Koenigsmann M., Oelmann E., Koehler B., Oberberg D., Reufi B., Stein H., Thiel E. Recombinant human interleukin 4 has antiproliferative activity on human tumor cell lines derived from epithelial and nonepithelial histologies. Cancer Res., 55: 2173-2176, 1995.[Abstract/Free Full Text]
- Gooch J. L., Lee A. V., Yee D. Interleukin 4 inhibits growth and induces apoptosis in human breast cancer cells. Cancer Res., 58: 4199-4205, 1998.[Abstract/Free Full Text]
- Fontemaggi G., Kela I., Amariglio N., Rechavi G., Krishnamurthy J., Strano S., Sacchi A., Givol D., Blandino G. Identification of direct p73 target genes combining DNA microarray and chromatin immunoprecipitation analyses. J. Biol. Chem., 277: 43359-43368, 2002.[Abstract/Free Full Text]
- Qian H., Wang T., Naumovski L., Lopez C. D., Brachmann R. K. Groups of p53 target genes involved in specific p53 downstream effects cluster into different classes of DNA binding sites. Oncogene, 21: 7901-7911, 2002.[Medline]
- Chen X., Zheng Y., Zhu J., Jiang J., Wang J. p73 is transcriptionally regulated by DNA damage, p53, and p73. Oncogene, 20: 769-774, 2001.[Medline]
- Paul W. E. Interleukin-4: a prototypic immunoregulatory lymphokine. Blood, 77: 1859-1870, 1991.[Free Full Text]
- Idzerda R. L., March C. J., Mosley B., Lyman S. D., Vanden Bos T., Gimpel S. D., Din W. S., Grabstein K. H., Widmer M. B., Park L. S. Human interleukin 4 receptor confers biological responsiveness and defines a novel receptor superfamily. J. Exp. Med., 171: 861-873, 1990.[Abstract/Free Full Text]
- Kondo M., Takeshita T., Ishii N., Nakamura M., Watanabe S., Arai K., Sugamura K. Sharing of the interleukin-2 (IL-2) receptor gamma chain between receptors for IL-2 and IL-4. Science (Wash. DC), 262: 1874-1877, 1993.[Abstract/Free Full Text]
- Russell S. M., Keegan A. D., Harada N., Nakamura Y., Noguchi M., Leland P., Friedmann M. C., Miyajima A., Puri R. K., Paul W. E., Leonard W. J. Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science (Wash. DC), 262: 1880-1883, 1993.[Abstract/Free Full Text]
- Hilton D. J., Zhang J. G., Metcalf D., Alexander W. S., Nicola N. A., Willson T. A. Cloning and characterization of a binding subunit of the interleukin 13 receptor that is also a component of the interleukin 4 receptor. Proc. Natl. Acad. Sci. USA, 93: 497-501, 1996.[Abstract/Free Full Text]
- Kawakami K., Kawakami M., Leland P., Puri R. K. Internalization property of interleukin-4 receptor alpha chain increases cytotoxic effect of interleukin-4 receptor-targeted cytotoxin in cancer cells. Clin. Cancer Res., 8: 258-266, 2002.[Abstract/Free Full Text]
- Murata T., Obiri N. I., Puri R. K. Structure of and signal transduction through interleukin-4 and interleukin-13 receptors. Int. J. Mol. Med., 1: 551-557, 1998.[Medline]
- Robinson D. S., Hamid Q., Ying S., Tsicopoulos A., Barkans J., Bentley A. M., Corrigan C., Durham S. R., Kay A. B. Predominant TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. N. Engl. J. Med., 326: 298-304, 1992.[Abstract]
- Rivas D., Mozo L., Zamorano J., Gayo A., Torre-Alonso J. C., Rodriguez A., Gutierrez C. Upregulated expression of IL-4 receptors and increased levels of IL-4 in rheumatoid arthritis patients. J. Autoimmun., 8: 587-600, 1995.[Medline]
- Morris L., Troutt A. B., Handman E., Kelso A. Changes in the precursor frequencies of IL-4 and IFN-gamma secreting CD4+ cells correlate with resolution of lesions in murine cutaneous leishmaniasis. J. Immunol., 149: 2715-2721, 1992.[Abstract]
- Urban J. F., Jr., Noben-Trauth N., Donaldson D. D., Madden K. B., Morris S. C., Collins M., Finkelman F. D. IL-13, IL-4R
, and Stat6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis. Immunity, 8: 255-264, 1998.[Medline]
- Afanasyeva M., Wang Y., Kaya Z., Park S., Zilliox M. J., Schofield B. H., Hill S. L., Rose N. R. Experimental autoimmune myocarditis in A/J mice is an interleukin-4-dependent disease with a Th2 phenotype. Am. J. Pathol., 159: 193-203, 2001.[Abstract/Free Full Text]
- Crawford R. M., Finbloom D. S., Ohara J., Paul W. E., Meltzer M. S. B cell stimulatory factor-1 (interleukin 4) activates macrophages for increased tumoricidal activity and expression of Ia antigens. J. Immunol., 139: 135-141, 1987.[Abstract]
- Mule J. J., Smith C. A., Rosenberg S. A. Interleukin 4 (B cell stimulatory factor 1) can mediate the induction of lymphokine-activated killer cell activity directed against fresh tumor cells. J. Exp. Med., 166: 792-797, 1987.[Abstract/Free Full Text]
- Okada H., Kuwashima N. Gene therapy and biologic therapy with interleukin-4. Curr. Gene Ther., 2: 437-450, 2002.[Medline]
- Topp M. S., Papadimitriou C. A., Eitelbach F., Oelmann E., Koehler B., Oberberg D., Von Marschall Z., Reufi B., Stein H., Thiel E. Antiproliferative effect of human interleukin-4 in human cancer cell lines: studies on the mechanism. Leuk. Lymphoma, 19: 319-328, 1995.[Medline]
- Kawakami M., Kawakami K., Stepensky V. A., Maki R. A., Robin H., Muller W., Husain S. R., Puri R. K. Interleukin 4 receptor on human lung cancer: a molecular target for cytotoxin therapy. Clin. Cancer Res., 8: 3503-3511, 2002.[Abstract/Free Full Text]
- Strome S. E., Kawakami K., Alejandro D., Voss S., Kasperbauer J. L., Salomao D., Chen L., Maki R. A., Puri R. K. Interleukin 4 receptor-directed cytotoxin therapy for human head and neck squamous cell carcinoma in animal models. Clin. Cancer Res., 8: 281-286, 2002.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Sasaki, H. Negishi, M. Idogawa, H. Suzuki, H. Mita, M. Toyota, Y. Shinomura, K. Imai, and T. Tokino
Histone deacetylase inhibitor FK228 enhances adenovirus-mediated p53 family gene therapy in cancer models
Mol. Cancer Ther.,
April 1, 2008;
7(4):
779 - 787.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sasaki, Y. Oshima, R. Koyama, R. Maruyama, H. Akashi, H. Mita, M. Toyota, Y. Shinomura, K. Imai, and T. Tokino
Identification of Flotillin-2, a Major Protein on Lipid Rafts, as a Novel Target of p53 Family Members
Mol. Cancer Res.,
March 1, 2008;
6(3):
395 - 406.
[Abstract]
|