| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Department of Molecular Genetics, University of Texas M. D. Anderson Cancer Center, Houston, Texas
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The CCAAT motif is present in promoters of many mammalian genes including genes expressed in specific cell types as well as genes regulated during the cell cycle, such as topoisomerase II
, cyclin B1, CDC25C, E2F1, CDC2, and thymidine kinase genes (1, 2, 3, 4, 5, 6)
. Even though CBF activity is found to be present in all mammalian tissues, the genes that are regulated by this transcription factor complex in vivo are still unknown. The physiologically relevant target genes, whose transcription is highly dependent on CBF activity, can only be identified using an animal model where endogenous CBF activity can be abrogated in a specific tissue or at a specific developmental stage.
Previously, expression of the dominant negative CBF-B mutant in mouse NIH 3T3 fibroblasts caused the cells to grow slower, with a modest increase in the time required for the cells to complete the S phase of the cell cycle (7) . Because transformed cell lines, such as 3T3 fibroblasts, have aberrant expression of many proteins, the effects of dominant negative CBF-B expression in these cells could be masked or accentuated, which would not allow for a clear understanding of the physiological role of CBF activity.
To establish the role of CBF-mediated transcription in vivo, we generated a conditional allele of the gene for the CBF-B subunit, which could be deleted using the Cre-lox system. Using this mouse model, this study clearly demonstrates that CBF-dependent transcription is essential during early mouse development. Conditional deletion of both Cbf-b alleles in primary cultures of MEF1 cells caused a complete block in the progression of the cells into S phase. Subsequently, Cbf-b null cells underwent apoptosis. The results described in this study clearly show that CBF-mediated transcription is required for cell proliferation and viability.
| MATERIALS AND METHODS |
|---|
|
|
|---|
FIXII library comprising SV129 genomic DNA. The unique EcoRV site in the second intron was altered to a BamHI site, and a loxP sequence (I) was cloned at the 3' end of this restriction site by ligating an oligonucleotide cagcctcccgggggatccataacttcgtataatgtatgctatacgaagttatcccgggtgttga (Btargeted allele). The neomycin resistance gene, flanked by loxP sites II and III from pPGKneopAloxP (9)
, was cloned into the unique SphI site in the eighth intron with a BamHI site also introduced at the 3' of the third loxP site. The human thymidine kinase gene was cloned 5' region to the SpeI site, as shown in Fig. 1A
|
Genomic DNA from mouse tails, cells, or embryonic tissue was isolated by digestion in a buffer containing 0.5 µg/ml proteinase K, NaCl, EDTA, and SDS at 55°C overnight. PCR primer 1 (gtaagtcaggctccaggg), in intron 2 and 5' of the EcoRV site of the CBF-B gene, and primer 2 (aggcaaggcagatttaggaaggtc), which is in intron 2 and 3' of the EcoRV site, were used to distinguish between the 200-bp Bwt allele and the 250-bp Bflox allele. Primer 1 and primer 3 (gggttgtcaggatgttcgcag), in intron 8 and 3' of the SphI site, were used to amplify the 400-bp product to genotype a Bdel allele.
MEF Cultures.
We used 13.5 d.p.c. Bflox/del and Bwt/wt embryos to isolate MEFs using previously published procedures (10)
. MEFs were used at passage 4 and 5 for the experiments.
AdCre Infection of MEFs and Detection of ß-Gal Activity in ROSA MEFs.
AdCre was a kind gift from Dr. Frank Graham (McMaster University, Ontario, Canada), and the adenovirus was amplified by the Adenovirus Core facility at our institute. MEFs (4 x 105), plated on 10-cm dishes, were rinsed with PBS containing Mg2+ and Ca2+. The appropriate amount of AdCre for a MOI of 10, in 1 ml of PBS, was added to the cells and placed at 37°C for 70 min with rocking every 15 min, after which PBS was removed and replaced with 10 ml of fresh MEF medium.
Forty-eight h after infection, mock-infected and AdCre-infected ROSA MEFs were stained for ß-gal activity using previously published procedures (9) .
Cell Synchronization, BrdUrd Labeling, Immunofluorocytochemistry, and Confocal Microscopy.
Aphidicolin was added at 2 µg/ml to MEFs plated at 4 x 105 cells/10-cm dish in regular MEF medium containing 15% FCS for 40 h. Cells were labeled with 10 µM BrdUrd for 1 h, fixed with paraformaldehyde, and processed for immunofluorescent detection with anti-BrdUrd antibody using a FLUOS kit following the suggested protocol (Roche Molecular Biochemicals).
MEFs grown on gelatin-coated coverslips were fixed for 10 min with 1% paraformaldehyde, permeabilized in 0.5% Triton X-100 for 30 min, and blocked in 80 mM PIPES (pH 6.8), 5 mM EGTA, 2 mM MgCl2 (PEM buffer) containing 1.5% nonfat dry milk. A polyclonal antibody directed against the COOH-terminal region of CBF-B was used at 1:200. Mouse anti-phosphorylated serine 10 histone-3 (5-598; Upstate Biotechnology, Lake Placid, NY) and anti-MPM-2 antibody (Upstate Biotechnology) were used at the recommended dilution. Secondary antibodies conjugated to fluorescein (Santa Cruz Biotechnology, Santa Cruz, CA) were used at a 1:200 dilution. Nuclear DNA was stained with propidium iodide at 0.1 µg/ml in PBS.
Apoptosis Assays.
TUNEL staining to determine apoptotic cells was done with cells grown on coverslips, and cells were analyzed at 96, 120, and 144 h after infection using the Apodirect kit (Serologicals Co.) according to the recommended protocol.
cDNA Arrays.
Total RNA was isolated from cells in culture using the RNeasy kit (Qiagen) using the manufacturers recommended protocol from uninfected and infected MEFs at 112 and 120 h after infection. Individual apoptosis gene array 1 and 2 filters and mouse cell cycle array filters (Superarray, Inc.) were hybridized to 32P-labeled reverse-transcribed total RNA (5 µg) from uninfected and infected Bwt/wt and Bflox/del MEFs, respectively, according to the manufacturers protocol. Radioactive signal intensities were analyzed on a PhosphorImager (Molecular Dynamics). For each filter, the background signal (puc18) was subtracted, the intensity of the positive control (GAPDH) signal was taken as 100%, and the signal intensity of all other genes was calculated as a percentage of the GAPDH signal. Relative expression levels of 135 genes were calculated, and the names of the genes are listed online2
in Mouse Apoptosis gene array 1 and 2 and Mouse Cell cycle, Q series (Superarray, Inc.).
Real-Time PCR Analysis.
Five µg of total RNA were reverse transcribed using random hexamers and Superscript II enzyme (Invitrogen) following the manufacturers suggested protocol. Relative levels of Cbf-b mRNA, eukaryotic elongation factor 1G mRNA, and caspase-2 mRNA were determined in the four samples of RNA isolated at 112 h from uninfected and infected Bwt/wt and Bflox/del MEFs, respectively. The Roche Light Cycler instrument and the LightCycler Fast Start DNA Master SYBR Green I kit were used according to the manufacturers protocol (Roche Molecular Biochemicals). The 5' and 3' primers used for mouse EEF IG that amplify a 183-bp product are tccaatgaggacaccctctc and agcaaaggcattcttcctca, respectively. The 5' and 3' primers for CBF-B that amplify a 210-bp product are tggtgcaagtcagtggaggccagctta and atgatctgctgggtttgacc, respectively. These primers are within the region of the Cbf-b gene targeted for deletion. The 5' and 3' primers for caspase-2, which amplify a 178-bp product, are tgacaatgctaactgtccaa and gtctcatcttcatcaactcc, respectively.
| RESULTS |
|---|
|
|
|---|
To identify the different alleles, Southern analysis of BamHI-digested genomic DNA was performed with two probes (Fig. 1C)
. The 5' probe identified the 9-kb Bwt (Lanes 14) and the 7-kb Btargeted alleles, respectively (Lanes 13). In addition, an internal probe, which lies within the sequences targeted for deletion, identified the Bwt, Bflox, and the Bflox+neo alleles. Indeed, addition of the neo cassette in the targeted locus introduced a BamHI site at the 3' end of the neo gene, which persists even after the neo sequence is deleted. Hence, BamHI restriction fragments of 5.5, 4.5, and 3.5 kb identified Bflox+neo (Lane 3), Bwt (Lanes 14), and Bflox (Lane 2), respectively. Because this probe lies within Cbf-b sequences targeted for deletion, the absence of a band corresponding to a "targeted allele, as detected by the 5' probe, indicated a Bdel allele (Lane 1).
Two sets of PCR amplification from mouse tail DNA were also used for genotyping, as shown in Fig. 1, D and E
. PCR primers 1 and 2 amplified a 200-bp Bwt band or a 250-bp Bflox band (Fig. 1
D, Lanes 13). Primers 1 and 3 amplify a 400-bp band of the Bdel allele (Fig. 1
E, Lanes 2 and 3).
Heterozygous animals, with one allele of Cbf-b deleted, were normal and fertile. In crosses between heterozygous mutants, no homozygous Bdel/del mutants were obtained, as early as the 8.5 d.p.c. stage of embryonic development. The distribution of the three genotypes, detected at the specific developmental stages, is shown in Table 1
. These results indicate that CBF activity is essential for early mouse embryo development.
|
|
Decrease in Growth Rate of the Bdel/del-Null Cells in Culture.
At 72, 96, 120, and 144 h postinfection, cells were counted to estimate growth rate in the presence or absence of CBF-B. As shown in Fig. 2
C, Bwt/wt cells continue to increase in number and undergo
3 rounds of doubling in the span of a 144-h culture period. Infection of the Bwt/wt cells with AdCre did not cause much difference in their growth rates when compared with that of uninfected cells. However, uninfected Bflox/del cells grew slower than uninfected Bwt/wt cells. In addition, at 72 h after infection of Bflox/del cells, there was no increase in the number of cells in culture. This absence of cell proliferation in the population of infected Bflox/del cells (mainly Bdel/del cells) at this time in culture indicated a delay or block in the cell cycle. A similar result was observed in multiple experiments using MEF cultures established from four different Bflox/del embryos. This showed that complete loss of CBF-B protein in MEFs resulted in growth arrest.
Analysis of Cell Cycle Progression of Bwt/wt, Bflox/del, and Bdel/del MEFs.
To identify cells in S phase of the cell cycle, infected or uninfected Bwt/wt and Bflox/del MEFs were BrdUrd-labeled for 1 h and processed for immunohistochemistry (Fig. 3
, top panel; Table 2
). At 96 h after infection with AdCre, 18% of the Bwt/wt nuclei stained positive with the BrdUrd antibody, whereas Bflox/del MEFs infected with AdCre had less than 2% of their nuclei positive for BrdUrd labeling. Thus, in the absence of CBF-B protein, there is a marked decrease in the number of cells in S phase. This could be due to a G1-S block or an inability to replicate DNA. Interestingly, uninfected Bflox/del cells, which proliferate more slowly in culture than wild-type cells, had 12% of cells in S phase compared with 25% of BrdUrd-labeled nuclei in uninfected cells with wild-type levels of CBF-B protein. Thus, heterozygous level of CBF-B protein causes a 50% decrease in S phase-positive MEFs, and B-null cells had an almost complete block in DNA synthesis.
|
|
The slower growth of uninfected Bflox/del cells and the lower proportion of these cells in S phase compared with Bwt/wt cells could be due to CBF-B haploinsufficiency in the primary fibroblasts. To further analyze these differences, aphidicolin was used to arrest the Bflox/del and Bwt/wt cells at the G1-S boundary. After cells were released from the block, entry into S phase was assayed by BrdUrd incorporation. Interestingly, the Bflox/del cells had only 4% of cells in S phase, whereas 40% of Bwt/wt cells were progressing through the S phase at this time (Table 2)
. This discrepancy between the Bflox/del and the Bwt/wt cells demonstrates that the lower level of CBF-B protein compromises the ability of cells to recover after a block in DNA synthesis.
Bflox/del Cells, Infected with AdCre, Undergo Apoptosis.
Nuclei of many B-null cells had a smaller size, showing compaction of their DNA. Other nuclei were large and undergoing abnormal blebbing with formation of micronuclei. These abnormal morphologies suggested that the cells could be undergoing programmed cell death and/or mitotic catastrophe. To further document the hypothesis of apoptosis, at 96, 120, and 144 h after AdCre infection, Bwt/wt MEFs and Bflox/del cells were analyzed by TUNEL assay. At 96 h after infection, when there was already an effect on cell growth in infected Bflox/del cells, there were almost no TUNEL-positive cells in either uninfected or AdCre-infected Bwt/wt and Bflox/del MEFs (data not shown). At 120 and 144 h after infection with AdCre, only 1% of nuclei of Bwt/wt cells were positive by TUNEL (Fig. 4)
. Similarly, only 4% of nuclei of uninfected Bflox/del cells were positive for apoptosis. In contrast, at 120 and 144 h after AdCre infection, about 75% of Bflox/del nuclei are positive for TUNEL staining (Fig. 4
, bottom three rows). The bottom row in Fig. 4
shows a higher magnification view of two nuclei that are TUNEL positive; one is a condensed nucleus, and the other has a normal size. Taken together, these results demonstrate that in the absence of CBF-B, progression through the cell cycle is inhibited, and apoptosis is initiated.
|
Expression level of the proapoptotic gene, initiator caspase-2, was increased 2-fold in CBF-B-null cells but unchanged in Bwt/wt cells either infected or uninfected with AdCre (Fig. 5)
in two separate experiments. In contrast, expression of all other genes present in the apoptosis-related cDNA array was not significantly changed in all four sets of RNA samples. The increase in caspase-2 mRNA was further substantiated as a 3-fold change using real-time PCR analysis (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
We have consistently observed that the growth rate of heterozygous Bflox/del fibroblast cells is significantly lower than that of Bwt/wt cells in culture. This is further supported by the observation that the proportion of these cells in S phase is clearly lower than that of the Bwt/wt cells. Hence, in primary cultures of fibroblast cells, loss of half the amount of CBF-B decreases the number of cells in S phase. Furthermore, Bflox/del fibroblast cells are sensitive to cell cycle arrest by aphidicolin. On removal of aphidicolin treatment, Bwt/wt cells reentered S phase, but Bflox/del cells were unable to synthesize DNA, as ascertained by BrdUrd incorporation. Aphidicolin inhibits DNA polymerase
,
, and
and causes stalled replication forks, and removal of aphidicolin allows cells to restart DNA synthesis. Prolonged stalling of replication in the presence of aphidicolin causes the loss of specific MCM proteins from chromatin in Xenopus cells. These proteins are required for reinitiation of replication and are regulated stringently to avoid multiple replications of DNA within a single cell cycle (14)
. We hypothesize that loss of half the amount of CBF-B protein, in a specific cell type such as fibroblasts, might be responsible for the expression of lower amounts of proteins required to reinitiate replication.
Analysis of MEFs by TUNEL assay showed that loss of CBF-B induces apoptotic cell death. The time of cell death occurred after the arrest of the cell cycle because almost no cells were TUNEL positive at 96 h after AdCre infection, when entry into or progression through S phase was already inhibited. However at 144 h after AdCre infection, the majority of MEFs lacking CBF-B were positive for TUNEL staining. Thus CBF is a survival factor for mammalian cells and is required for cell cycle progression. By analyzing the expression of genes identified previously that lead to or prevent apoptosis, we found that expression of caspase-2 mRNA was increased in the absence of CBF-B but that the expression of other genes present in the array was unchanged in the time interval between the S-phase inhibition and the detection of TUNEL-positive cells. Examination of the proximal promoter region of both the mouse and human caspase-2 gene shows the presence of two CCAAT motifs within 250 bp of the transcription start site. Conservation of the putative CBF binding sites indicates that transcription of caspase-2 might be directly regulated by CBF. The increase in caspase-2 mRNA in CBF-null cells suggests that the transcription of this gene could be negatively regulated by CBF, which would require further experimental analysis. Recently, an increase in the expression of caspase-2 mRNA, specifically in response to DNA damage, was reported in a human cell line (15) . Caspase-2, which is one of the initiator caspases, triggers the processing of downstream effector caspases, is localized mainly in the nucleus, is autoactivated by oligomerization and binding to its adapter protein RAIDD, and has been shown to be transcriptionally up-regulated in response to certain hormonal conditions or stress (15, 16, 17) . Expression levels of other initiator caspases, which are localized in other specific nonnuclear compartments such as the endoplasmic reticulum, Golgi, and mitochondria, were not increased. We hypothesize that inhibition of the S phase or premature entry into the mitotic phase in B-null cells could cause DNA damage and result in the induction of caspase-2 mRNA.
In summary, our study establishes that an important in vivo function of CBF is to control cell proliferation, particularly entry in and progression through the S phase of the cell cycle. Although the mechanism by which CBF regulates cell cycle progression remains to be clarified, recent preliminary RNA expression analysis (data not shown) indicates the decreased expression of the Cullin family of genes as well as cyclin A2 in Cbf-b-null cells; these genes are important for progression from G1to S phase of the cell cycle (18 , 19) . This analysis suggests that inactivation of CBF results in changes in the expression of multiple genes. Future experiments will identify CBF-dependent genes that are important for cell proliferation and early embryogenesis.
Our mouse model will be useful in determining whether other sites of in vivo proliferation, such as skin, hair, and regenerating livers, are dependent on CBF-mediated transcription. In addition, by using an inducible Cre recombinase and a mouse model for tumorigenesis, we should be able to test whether tumor cells require functional CBF for survival.
| FOOTNOTES |
|---|
Requests for reprints: Sankar N. Maity, Department of Molecular Genetics, Box 11, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030. Phone: (713) 792-8943; Fax: (713) 794-4295; E-mail: smaity{at}mdanderson.org
1 The abbreviations used are: MEF, mouse embryonic fibroblast; ES, embryonic stem cells; d.p.c., days post conception; MOI, multiplicity of infection; ß-gal, ß-galactosidase; BrdUrd, bromodeoxyuridine; TUNEL, terminal deoxynucleotidyltransferase-mediated nick end labeling; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EEF IG, Mus musculus elongation factor like protein mRNA. ![]()
Received 6/26/03. Revised 9/11/03. Accepted 9/18/03.
| REFERENCES |
|---|
|
|
|---|
: conventional CBF activation domains are not required. J. Biol. Chem., 277: 37191-37200, 2002.This article has been cited by other articles:
![]() |
S. Chen, J. Gluhak-Heinrich, M. Martinez, T. Li, Y. Wu, H.-H. Chuang, L. Chen, J. Dong, I. Gay, and M. MacDougall Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling J. Biol. Chem., July 11, 2008; 283(28): 19359 - 19370. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Combier, F. de Billy, P. Gamas, A. Niebel, and S. Rivas Trans-regulation of the expression of the transcription factor MtHAP2-1 by a uORF controls root nodule development Genes & Dev., June 1, 2008; 22(11): 1549 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Benatti, V. Basile, D. Merico, L. I. Fantoni, E. Tagliafico, and C. Imbriano A balance between NF-Y and p53 governs the pro- and anti-apoptotic transcriptional response Nucleic Acids Res., March 1, 2008; 36(5): 1415 - 1428. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshioka, O. Suyari, and M. Yamaguchi Transcription factor NF-Y is involved in regulation of the JNK pathway during Drosophila thorax development. Genes Cells, February 1, 2008; 13(2): 117 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Lin, S. Weis, G. Yang, Y.-H. Weng, R. Helston, K. Rish, A. Smith, J. Bordner, T. Polte, F. Gaunitz, et al. Heme Oxygenase-1 Protein Localizes to the Nucleus and Activates Transcription Factors Important in Oxidative Stress J. Biol. Chem., July 13, 2007; 282(28): 20621 - 20633. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Hu, J.-F. Lu, R. Luo, S. Sen, and S. N. Maity Inhibition of CBF/NF-Y mediated transcription activation arrests cells at G2/M phase and suppresses expression of genes activated at G2/M phase of the cell cycle Nucleic Acids Res., December 4, 2006; 34(21): 6272 - 6285. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tao, J. Lan, G. L. Lukacs, R. J. G. Hache, and F. Kaplan Importin 13 Regulates Nuclear Import of the Glucocorticoid Receptor in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., December 1, 2006; 35(6): 668 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Combier, F. Frugier, F. de Billy, A. Boualem, F. El-Yahyaoui, S. Moreau, T. Vernie, T. Ott, P. Gamas, M. Crespi, et al. MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula. Genes & Dev., November 15, 2006; 20(22): 3084 - 3088. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Borghini, M. Vargiolu, M. Di Duca, R. Ravazzolo, and I. Ceccherini Nuclear Factor Y Drives Basal Transcription of the Human TLX3, a Gene Overexpressed in T-Cell Acute Lymphocytic Leukemia Mol. Cancer Res., September 1, 2006; 4(9): 635 - 643. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kahle, M. Baake, D. Doenecke, and W. Albig Subunits of the Heterotrimeric Transcription Factor NF-Y Are Imported into the Nucleus by Distinct Pathways Involving Importin {beta} and Importin 13 Mol. Cell. Biol., July 1, 2005; 25(13): 5339 - 5354. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Testa, G. Donati, P. Yan, F. Romani, T. H.-M. Huang, M. A. Vigano, and R. Mantovani Chromatin Immunoprecipitation (ChIP) on Chip Experiments Uncover a Widespread Distribution of NF-Y Binding CCAAT Sites Outside of Core Promoters J. Biol. Chem., April 8, 2005; 280(14): 13606 - 13615. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tanaka, T. T. Antoniv, K. Liu, L. Wang, D. J. Wells, F. Ramirez, and G. Bou-Gharios Cooperativity between Far Upstream Enhancer and Proximal Promoter Elements of the Human {alpha}2(I) Collagen (COL1A2) Gene Instructs Tissue Specificity in Transgenic Mice J. Biol. Chem., December 31, 2004; 279(53): 56024 - 56031. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |