| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Division of Immunogenetics, University of Göttingen, Göttingen, and
2 Institute of Virology and Immunobiology, University of Würzburg, Würzburg
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
. Hsp70 prevents the association of Apaf-1 with procaspase-9 (2
, 3)
and blocks the assembly of a functional apoptosome. Furthermore, Hsp70 is able to antagonize Aif, the apoptosis-inducing factor (4)
. Overexpression of Hsp70 has been described in various tumors, and associated with enhanced tumorigenicity and resistance to therapy (5, 6, 7)
. Conversely, down-regulation of Hsp70 in tumor cells was found in certain animal models to enhance tumor regression (8
, 9)
. A second remarkable feature of Hsp70, beside its antiapoptotic function, is its role as endogenous adjuvant (10) and immunological danger signal (11 , 12) . Hsp70 preparations from tumor, virus-infected, or allogeneic cells can be used for vaccination against tumor, virus, or minor histocompatibility antigens (10) . Hsp70 chaperones antigenic peptides and channels them in a receptor-mediated manner (13 , 14) efficiently into the MHC class I presentation pathway of professional antigen-presenting cells, which are then able to prime peptide-specific CTL. The ability of Hsp70 to facilitate this cross-priming is related to a putative role of Hsp70 in the processing of endogenous antigens. It has been suggested that endogenous antigenic peptides generated by the proteasome are chaperoned in the cytoplasm by Hsc70, Hsp70, or Hsp90 and protected from additional degradation before being delivered by the transporter associated with antigen processing to the ER for association with MHC class I molecules (15) . Antigenic peptides have indeed been found associated with chaperones including Hsp70 (16 , 17) . Interestingly, in a B16 mouse melanoma model stable transfection of Hsp70 increased MHC class I cell surface expression (18) .
A third remarkable property of Hsps, including Hsp70, is their ability to activate innate immune responses (10 , 19) . Thus, for example Hsp70 that is released from dying tumor cells can contribute to an antitumor immune response in vivo (20) .
To study the role of Hsp70 in resistance of tumor cells to CTL, we transfected the human melanoma cell line Ge with a Hsp70 gene under control of a tetracycline-dependent promoter (21) . Ge cells, like many human tumor cells, express significant amounts of the inducible Hsp70 already constitutively (22) . After induction of the transgene by doxycycline, a 23-fold increase of Hsp70 was observed within 24 h (21) . Contrary to the expected protective effect, this acute overexpression of Hsp70 enhanced the susceptibility of the Ge target cells to CTL without interfering with antigen processing and presentation (21) . We hypothesized that Hsp70, as a molecular chaperone, might improve the function of proteins that are involved in executing CTL-induced apoptosis.
To investigate whether increased lysability of target cells depends on the acuteness of Hsp70 induction we transduced Ge cells retrovirally with the Hsp70 gene to obtain cell clones with strong permanent Hsp70 overexpression. Thus, within the same cell line, effects of permanent Hsp70 overexpression in the retrovirally transduced clones can be compared with acute Hsp70 overexpression in the Tet-on system. Notably, in both systems Hsp70 expression is achieved without applying a cellular stress that would lead to an increased demand of molecular chaperones in the cell and numerous additional cellular changes.
We show here that permanent Hsp70 overexpression, in contrast with acute Hsp70 induction, does not alter lysability of Ge target cells by CTL. Interestingly, permanent in contrast with acute Hsp70 overexpression leads to a reduced expression of the normally constitutively and abundantly expressed Hsc70. Thus, the different effect of acute and permanent Hsp70 overexpression might be explained by the adaptation of a chaperone network due to permanent Hsp70 overexpression. This might also have important implications for the tumor biology of Hsp70.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(S-P Brinny Company, Innishannon, Ireland and Essex Pharma GmbH, München, Germany). For heat shock treatment melanoma cells were harvested in 1 mM EDTA in PBS, transferred to 12-ml polypropylene tubes (Sarstedt), washed in HEPES-buffered DMEM, and resuspended in this medium containing 10% FCS. Cells were exposed for 1 h to 42°C in a water bath or kept at 37°C as controls. After a recovery period of 4 h at 37°C the cells were used for additional experiments.
Retroviral Transduction of Ge Cells.
The rat Hsp701 gene (Genebank accession no. X77207) has been cloned previously into the pUHC103 vector (21)
. This construct was used for recloning of Hsp701 into the retroviral expression vector SFG GFP (S65T; Ref. 23
). The GFP gene was excised from the vector by NcoI and BamHI and replaced by Hsp701. To allow excision of Hsp701 of the pUHC103 vector a NcoI restriction site was introduced in front of the start codon (gac ATG GCC
gc
c ATG GCC) and a NcoI restriction site within the gene was eliminated (TCG TC
C ATG GTG
TCG TCG ATG GTG) by PCR mutagenesis. The construct was sequenced to exclude mutations of the Hsp701 gene. The SFG GFP (S65T) construct and a construct in which GFP was replaced by a rat TCR-ß chain gene were used to obtain cell clones expressing irrelevant control proteins. For that purpose the complete coding sequence of a rat TCR-ß chain gene was cloned directly by reverse transcription-PCR from the rat T-cell hybridoma 35/14
into the vector S65T using 5'primer G CGC GGA TCC GCC ACC ATG GGC TCC AGG TTC CTC TTA GTG and 3'primer ATG CGG ATC CTC AGG AAC TCT TTC TTT TGA CCA TAG C, and digestion with NcoI and BamHI.
Recombinant retroviral vector supernatants were generated by transient transfection of 293T cells with the murine leukemia virus gag/pol expression construct pHIT60 (24) , the vesicular stomatitis virus glycoprotein G expression construct pcVGwt (25) , and the corresponding retroviral vector essentially as described previously (23 , 24) . Viral supernatant was filtered and after addition of 8 µg/ml Polybrene used to infect 1 x 105 adherent Ge cells in a six-well plate for 4 h including 2 h centrifugation at 600 x g (26) .
Northern Blots and Real-Time PCR.
RNA preparation and Northern blot analysis using gene probes for rat Hsp701 and ß-actin were done as described previously (27)
. Before cDNA synthesis RNA was incubated with RNase-free DNase (Promega, Mannheim, Germany) according to the manufacturers instructions to exclude contamination of cDNA with genomic DNA. For subsequent cDNA synthesis 2.5 µg of DNA-free total RNA were reverse transcribed using 100 pmol oligodeoxythymidylic acid [oligo d(T)] primer 5'GACTCGAGTCGACATCGA(T)17, 40 units RNase inhibitor (Promega) and 300 units reverse transcriptase (Promega). Aliquots of this reaction product were subjected to real-time PCR using the SYBR green PCR master mix (Applied Biosystems, Weiterstadt, Germany) and primers for rat Hsp701 (3'GTAGAAGTCGATGCCCTCG, 5'TGGAGGAGTTCAAGAGGAAG), human Hsp702, (3'GTAGAAGTCGATGCCCTCA, 5'GTGGAGGAGTTCAAGAGAAAA), or human Hsc70 (3'ATAGAAGTCGATTCCTTCATAG, 5'GCTGAGTTTAAGCGCA). For normalization of the data GAPDH was amplified with the specific primers included in TaqMan GAPDH control reagent (Applied Biosystems). All of the reactions were done in triplicate in 96-well optical reaction plates (Applied Biosystems) on an ABI PRISM 7700 sequence detection system (Applied Biosystems) and analyzed with GeneAmp7700 SDS software. The PCR profile was 2 min 50°C, 10 min 95°C, followed by 50 cycles of 15 s at 95°C and 60 s at 60°C for human Hsp702, human Hsc70, and GAPDH. For rat Hsp701 50 cycles of 15 s at 95°C and 60 s at 64°C were applied. Subsequently, PCR products were separated in a 0.8% agarose gel and visualized by ethidium bromide to confirm the amplification of specific products of expected length.
Flow Cytometry.
Flow cytometry was done on a FACScan flow cytometer (Becton Dickinson, Heidelberg, Germany) using CellQuest software. GFP expression was analyzed after washing cells twice with PBS and resuspending them in 500 µl PBS containing 2 µg/ml PI. PI-positive dead cells, always below 8%, were excluded from analysis. For determining cell surface expression of MHC class I molecules a mouse anti-MHC class I (A, B, C) mAb (clone W6/32, IgG2a, MCA81; Serotec, Biozol, Eching, Germany) was used as described (21)
. Cell surface expression of Hsp70 was examined by mAb RPN 1197 (Amersham Pharmacia, Freiburg, Germany) that has been reported to detect Hsp70 on the cell surface (28)
. Intracellular Hsp70 expression was tested after cytoplasmic staining with a mouse mAb specific for the inducible form of Hsp70 (clone C92F3A-5, IgG1, SAP-810; StressGen, Biomol, Hamburg, Germany) as described previously (21)
. To determine cytoplasmic Hsc70 expression a specific rat mAb (clone 1B5, IgG2a, SAP-815; StressGen) was used. Secondary reagents were a polyclonal FITC-conjugated goat antimouse IgG Ab (115095-062; The Jackson Laboratory, Dianova, Hamburg, Germany) or goat antirat IgG Ab (112095-062; The Jackson Laboratory), respectively. When GFP-transduced cell lines were analyzed, RPE-Cy5-conjugated F(ab')2 fragments of rabbit antimouse immunoglobulins were chosen as secondary reagent (C 0090; Dako, Hamburg, Germany). Cell surface and cytoplasmic TCR-ß chain expression was tested with a FITC-conjugated mouse mAb (clone R73, IgG1, 22284D; BD PharMingen, Heidelberg, Germany). A FITC-conjugated anti-TNP (trinitophenol) mAb (clone 107.3, IgG1, 03004C; BD PharMingen) and a mAb with unknown specificity (clone MOPC-21, IgG1, 33815X; BD PharMingen) served as isotype controls for cell surface and intracellular staining, respectively. Apoptosis was tested by annexin V-FITC (BD PharMingen) combined with PI staining or determination of cells appearing in the sub-G1 peak of DNA histograms as described previously (27)
.
Western Blot and Metabolic Labeling.
Cells were exposed for 1 h to 42°C in a water bath or kept at 37°C as controls. After a recovery period of 4 h at 37°C 6 x 105 cells were cultured for 1 h at 37°C in 100 µl methionine-free HEPES-buffered DMEM containing 1.5 µCi [35S]methionine plus [35S]cysteine (Amersham Pharmacia). Cells were washed twice with PBS and resuspended in 100 µl sample buffer [0.0625 M Tris-HCl (pH 6.75), containing 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, and 0.001% bromphenol blue] per 1 x 106 cells and incubated at 100°C for 5 min. The supernatant obtained after a centrifugation (10,000 x g for 5 min at 4°C) was separated by SDS-PAGE using equivalents of 2 x 105 cells per lane. For separation of cytosolic and noncytosolic proteins a pellet of 3 x 106 cells was resuspended in 150 µl lysis buffer [25 mM Tris-HCl (pH 7.4), 140 mM NaCl, 5 mM KCl, 3 mM MgCl2, and 0.5% w/v NP40] and incubated for 40 min on ice followed by a centrifugation (10,000 x g for 5 min at 4°C). The supernatant representing the cytosolic protein fraction was transferred into a new tube, and 150 µl sample buffer were added. The pellet including the nuclear fraction was resuspended in 300 µl sample buffer. Samples were incubated at 100°C for 5 min, and 15 µl were loaded then onto a SDS gel. Proteins were transferred to nitrocellulose (Schleicher and Schüll, Dassel, Germany) before Ab staining. The following mAbs were used at dilutions of 1:2,000 in PBS/0.05% Tween 20: anti-Hsp70 (clone C92F3A-5), anti-Hsc70 (clone 1B5), anti-Hsp70/Hsc70 (clone N27F33, mouse IgG1, SAP-820; StressGen, Biomol), and anti-ß-actin (clone AC-15, mouse IgG1, A-5441; Sigma). Subsequently, blots were incubated with goat antimouse IgG Ab (115005-003; The Jackson Laboratory, Dianova) or goat antirat IgG + IgM Ab (112005-068; The Jackson Laboratory, Dianova) and peroxidase-conjugated rabbit antigoat IgG Ab (305035-045; The Jackson Laboratory, Dianova) at a dilution of 1:10,000. The substrate reaction was carried out with 0.05% 3,3'-diaminobenzidine/0.003% H2O2 in PBS/0.05% Tween 20. For autoradiography, filters were exposed to Hyperfilm MP (Amersham Pharmacia) for usually 3 days. Densitometric analysis of autoradiograms was performed with an Epson GT-8000 scanner and ScanPack software (Biometra, Göttingen, Germany). For quantification of Hsp70 induction Hsp70:ß-actin ratios were determined.
Immunoprecipitation.
For coimmunoprecipitation of Hsp70-bound proteins, pellets of 10 x 106 cells were lysed in NP40 lysis buffer containing protease inhibitors leupeptin, aprotinin, pepstatin, and phenylmethylsulfonyl fluoride. The cytosolic fraction was precleared by incubation with 0.1 volumes of protein G Sepharose slurry (Protein G Sepharose 4 Fast Flow; Amersham Pharmacia) for 30 min on ice. The lysate was then incubated for 1.5 h at 4°C with 5 µg anti-Hsp70 mAb C92 followed by addition of 0.2 volumes of protein G Sepharose slurry for another 1.5 h incubation. Unbound protein was removed by centrifugation (10,000 x g for 1 min at 4°C) and three washing steps with 500 µl NP40 lysis buffer. Finally the Sepharose pellet was resuspended in 60 µl sample buffer and incubated at 100°C for 5 min. The supernatant was loaded onto SDS gels that were Coomassie stained.
MALDI-TOF Mass Spectrometry.
For the identification of coprecipitated proteins Coomassie-stained protein bands were in-gel digested with trypsin (29)
, desalted on C18 ZipTip, and analyzed by MALDI-TOF mass spectrometry (Reflex III; Bruker) using dihydrobenzoic acid as matrix and two autolytic peptides from trypsin as internal standards. The peptide mass fingerprint data were used by Mascot search algorithm for protein identification in the NCBInr protein database.
Cytotoxic Cells and Cytotoxicity Assay.
Generation of alloreactive CTL and the 51Cr release assay including blocking studies with anti-MHC class I-specific mAb W6/32 and EGTA were described in detail elsewhere (21)
. Briefly, alloreactive CTLs obtained from peripheral blood mononuclear cells of blood donors in a mixed lymphocyte culture of 5 days were cocultured with 51Cr-labeled melanoma target cells at 80:1 to 2.5:1 ratios in round-bottomed microtiter plates for 4 h at 37°C. Radioactivity released into the supernatant and radioactivity retained in the cells was determined with a Wallac MicroBeta Trilux counter (Perkin-Elmer Life Sciences, Köln, Germany) to calculate specific lysis.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
(5000 units/ml for 72 h) that is known to enhance MHC class I gene transcription (31
, 32)
. An increase of MHC class I cell surface expression could be demonstrated in Ge cells (Fig. 2)
(data not shown). Therefore, MHC class I cell surface expression cannot be restricted by a general shortage of peptides in Ge cells. Importantly, the magnitude of MHC class I cell surface augmentation by IFN-
was not different between Ge cells overexpressing Hsp70 or TCR-ß (Fig. 2)
Permanent Hsp70 Overexpression in Target Cells Does Not Alter Their Lysability by CTL.
Acute overexpression of Hsp70 increased lysability of Ge cells by CTL despite unchanged MHC class I expression (21)
. To test whether the same effect occurs after strong and permanent Hsp70 overexpression the various transductants were used as target cells for alloreactive CTL in a standard 51Cr release assay. Permanent (Fig. 3A)
in contrast with acute Hsp70 overexpression (Fig. 3B)
did not alter lysabilty compared with GFP or TCR-ß transductants or parental Ge cells. The same result was obtained with each of the four cell clones of each line (data not shown). The cytotoxic cells used were identified as CTL by effective blocking with anti-MHC class I-specific mAb W6/32 (data not shown). The CTL used the granule-exocytosis killing pathway because lysis was calcium-dependent (data not shown; see Ref. 21
).
|
Effect of Heat Shock on Lysability of Target Cells by CTL.
In contrast with the stress-free Hsp70 induction by doxycycline in the Ge-tet system heat shock does not only induce Hsp70 expression but increases dramatically the demand for additional chaperones in the cells. Therefore, the effect of acute Hsp70 induction by heat shock (1 h 42°C and 6 h recovery at 37°C) on lysability of Ge cells was tested. The heat shock protocol applied here strongly induced Hsp70, but did not lead to apoptosis as determined by annexin V staining and analysis of cells appearing in the sub-G1 peak of DNA histograms (data not shown). An enhancement of lysability after heat shock was observed in five of eight independent experiments (Fig. 4)
. Heat shock-induced resistance to CTL was never found. Thus, acute Hsp70 overexpression by heat shock can increase lysability of Ge cells by CTL but apparently less predictably and reproducibly than induction by doxycycline in the Tet-on system.
|
|
Heat Shock-Induced Hsp70 Expression and Increased Lysability by CTL Is Not Impaired by Permanent Hsp70 Overexpression.
Interestingly, despite the strong overexpression of Hsp70 heat shock inducibility of Hsp70 was in the normal range in permanently Hsp70 overexpressing transductants as demonstrated by metabolic labeling that allows to assess the synthesis of new proteins after heat shock (Fig. 6A)
. Thus, the demand for additional Hsp70 chaperones after stress exists also in Hsp70-overexpressing cells. The same result was obtained with each clone of each cell type as summarized in Fig. 6B
. Importantly, heat shock was able to increase the CTL-mediated lysis also of permanently Hsp70-overexpressing cells (Fig. 6C)
. Thus, acute Hsp70 induction appears to be able to augment the susceptibility of target cells to CTL irrespectively of constitutive Hsp70 expression levels.
|
To analyze whether Hsc70 is down-regulated at the transcriptional level, expression of the endogenous human Hsc70 and Hsp702 mRNA, as well as the transgenic rat Hsp701 mRNA was determined with specific primers in Ge-Hsp70 cells by real-time PCR and evaluated as ct, i.e., the PCR cycle in which the amplification products become detectable against the background. Rat Hsp701 and human Hsp702 are orthologous genes encoded in the MHC (36)
. As expected, transcripts of the rat Hsp701 gene were found only in the Ge-Hsp70 (mean ct value 19.1) but not in the Ge-TCR cell clones (mean ct value 48.6; ct values >40 are usually interpreted to indicate that a gene is not expressed). The expression of the endogenous human Hsp702 and Hsc70 mRNA was not different between Ge-Hsp70 and Ge-TCR clones (Fig. 7C)
. Thus, the decrease of Hsc70 expression shown above at the protein level is not seen at the RNA level and, thus, appears to be due to post-transcriptional regulation.
Long-Term But Not Short-Term Hsp70 Induction in the Tet-On System Leads to a Down-Regulation of Hsc70.
We then tested whether also in Ge-tet cells Hsp70 overexpression would affect the Hsc70 level. No effect of Hsp70 overexpression on Hsc70 expression was observed after short-term induction (24 h) of the transgene (Fig. 8)
. However, long-term induction of Hsp70 for 8 days in doxycycline-containing medium resulted in a significant reduction (P < 0.05, paired t test) of Hsc70 expression also in the Ge-tet cells compared with control cells (Fig. 8)
. A slight reduction of Hsc70 expression after long-term culture with doxycycline was also observed in the control cell lines Ge and Ge-tra. However, this nonsignificant effect of doxycycline alone was weak compared with the effect observed in Ge-tet cells after Hsp70 overexpression by doxycycline (Fig. 8)
.
Hsp70 Binds to Clathrin in Cells Overexpressing Hsp70 Permanently.
To elucidate whether Hsp70 could replace Hsc70 in cells that overexpress Hsp70 permanently we immunoprecipitated Hsp70 in Ge-Hsp70 and Ge-TCR cell clones, and analyzed coimmunoprecitated molecules by SDS-PAGE (Fig. 9)
. One prominent band of
180 kDa was reproducibly present in precipitates from Ge-Hsp70 but not Ge-TCR cells. This band was analyzed by MALDI-TOF mass spectrometry and identified as clathrin. Hsc70 is well known to function as clathrin-uncoating ATPase (37)
. Thus, binding of Hsp70 to clathrin suggests that Hsp70 is able to replace Hsc70 in cells that are forced to overexpress Hsp70 permanently.
|
| DISCUSSION |
|---|
|
|
|---|
Induction of Hsp70 in Ge-tet cells had been shown by us to enhance susceptibility to CTL-mediated lysis independent of antigen processing and without affecting MHC class I cell surface expression (21) . These findings were at variance with a report that permanent Hsp70 overexpression augments MHC class I cell surface expression (18 , 38) , and thereby increased lysability by CTL (18) .
Thus, two questions were raised in this study. Firstly, does permanent unlike acute Hsp70 overexpression increase MHC class I expression at the cell surface in Ge cells? Secondly, does permanent like acute Hsp70 overexpression increase susceptibility of Ge cells to lysis by CTL?
The concept that Hsp70 is involved in antigen presentation was proposed in 1994 by Srivastava et al. (15)
, who suggested that antigenic peptides generated at the proteasome are chaperoned in the cytoplasm by Hsc70, Hsp70, or Hsp90 and protected from additional degradation before being delivered to the ER by the transporter associated with antigen processing for association with MHC class I molecules. An augmentation of MHC class I expression due to Hsp70 overexpression as described by Wells et al. (18)
would support this concept (39)
. However, as shown here, MHC class I cell surface expression was not increased in permanently Hsp70 overexpressing Ge melanoma cell clones compared with parental Ge cells, or clones overexpressing a TCR-ß chain or GFP as a control. Thus, neither acute (21)
nor permanent Hsp70 overexpression affects MHC class I expression in Ge cells. In view of the report by Wells et al. (18)
and our results, increased MHC class I cell surface expression due to Hsp70 overexpression cannot be a general phenomenon, even when overexpression of Hsp70 is permanent, but might depend on the cell line that is analyzed. A relative lack of peptides necessary for class I expression on the cell surface could be excluded as reason for our finding by the stimulating effect of IFN-
on class I expression.
In contrast with our results about acute overexpression of Hsp70 using the Tet-on system (21) permanent overexpression of Hsp70 did not increase lysability of Ge cells by CTL. Importantly, also no resistance against lysis was observed. Both findings are remarkable, because the antiapoptotic functions of Hsp70 are well established (1, 2, 3, 4, 5, 6) . Our results obtained with transfectants derived from the same parental cell line Ge indicate that the outcome of acute versus permanent Hsp70 overexpression is remarkably different and might be biologically highly relevant. It is important to note that Hsp70 overexpression in both systems is not achieved by treatments such as heat shock that lead to protein denaturation and subsequent activation of the cellular stress response system (40) . Nevertheless, we also analyzed the effect of heat shock on lysability of Ge cells by CTL. Lysability was increased in most experiments, whereas resistance to CTL was never observed. Also in Ge-Hsp70 cells that overexpress Hsp70 permanently heat shock could augment CTL-mediated lysis. Thus, acute Hsp70 overexpression either due to stress-mediated induction by heat shock or to stress-free induction in the artificial Tet-on system can increase the susceptibility of target cells to CTL. Variations in the magnitude of Hsp70 induction due to stress in relation to the actual demand of the cell for additional chaperones could be associated with differences in the susceptibility of cells to CTL-mediated cytotoxicity and explain the more variable results of the heat shock experiments compared with the induction of Hsp70 in the Tet-on system.
The magnitude of Hsp70 induction due to heat shock is not diminished in the permanently Hsp70 overexpressing Ge cells compared with control Ge cells. Thus, the endogenous Hsp70 becomes strongly induced after heat shock when the demand of chaperones is increasing independent of constitutive Hsp70 expression levels. The Hsp70 that is permanently overexpressed in Ge-Hsp70 cells is obviously integrated functionally in the chaperone system at steady state conditions and, therefore, not available to meet the requirements for Hsp70 after stress. We reasoned that the permanent strong overexpression of Hsp70 in the retrovirally transduced Ge cells might affect the expression levels of other chaperones in the cell. The most likely candidate to be affected appeared to be the constitutively expressed cytosolic Hsp70 family member Hsc70. When we compared Hsp70 and Hsc70 protein levels in Ge-Hsp70 and Ge-TCR cells, we found that permanent Hsp70 overexpression had indeed resulted in reduced Hsc70 expression levels. The same observation was made in K562 cells that were transduced to overexpress Hsp70 permanently,5 indicating that the Hsc70 counter-regulation is not a particularity of Ge cells. We speculate that in the transductants Hsp70 takes over some physiological functions of Hsc70, because it might be more difficult for the cell to control the forced expression of the Hsp70 transgene than the expression of the endogenous Hsc70. This hypothesis is supported by our finding that Hsp70 is bound to clathrin in Ge-Hsp70 cells but not in control cells and might, therefore, partly replace Hsc70 as clathrin-uncoating ATPase.
We also tested whether the differential effects of acute versus permanent Hsp70 overexpression on Hsc70 levels can be reproduced in the Ge-tet system. Indeed after 8 days of stimulating Hsp70 expression by doxycycline Hsc70 expression was reduced in Ge-tet cells. In contrast no effect was observed after 24 h indicating that the adaptation of the cells to higher Hsp70 levels takes some time and can be followed in vitro. Notably, this regulation occurs at the protein and not at the mRNA level.
A similar feedback regulation of chaperone expression levels has been described recently for the ER chaperone Grp78 (BiP; Ref. 41 ). Using a tetracycline-dependent system to overexpress mouse BiP in human HeLa cells these authors reported a replacement of human BiP by mouse BiP on activation of mouse BiP expression without increase of the total amount of BiP. This control of BiP expression level was found to occur at the post-transcriptional level (41) . Our results obtained with Hsp70/Hsc70 are in accord with these data. In addition we show a compensatory replacement between different chaperones.
The Hsp70/Hsc70 self-regulation has functional consequences. Enhanced lysability by CTL due to Hsp70 overexpression in the Ge-tet system was only observed after acute Hsp70 induction that does not reduce Hsc70 expression. This would indicate that it depends on the balance between Hsp70 induction and the Hsp70/Hsc70 demand in an individual cell whether Hsp70 chaperones are available for an interaction with proteins that in turn would lead to enhanced CTL-mediated apoptosis. We speculate that the lysis-promoting effect after acute Hsp70 overexpression in the Ge-tet system is mediated by "free" Hsp70 that has not yet bound proteins or peptides and becomes available to interact with proteins that are involved in the execution of CTL-mediated apoptosis in the granzyme pathway (42) . Granzyme A itself has been shown to bind to Hsp27 and Hsp70 (43) , and is, therefore, an obvious candidate. Furthermore, Hsp70 has been shown recently to stabilize the function of the caspase-activated DNase (44) .
Our results have several implications for the interpretation and understanding of Hsp70 in stress response and tumor biology. Firstly, an interdependence of Hsp70 and Hsc70 expression exists at the post-transcriptional level that points to a self-regulating chaperone network. Therefore, Hsp70 overexpression has to be interpreted carefully, because, as in our example, secondary effects on other chaperones, such as Hsc70, could occur. Secondly, many human tumor cells express the otherwise inducible Hsp70 permanently in the course of malignant transformation. In addition, acute overexpression of Hsp70 may occur in tumors due to hypoxia, starvation, or oxidative stress. The functional consequences of these two Hsp70 expression modes, acute versus permanent, might be different also in vivo. According to our in vitro model acute Hsp70 overexpression is able to augment susceptibility to CTL whereas permanent overexpression of Hsp70 has no such effect. Thirdly, acute Hsp70 induction is possible irrespective of the constitutive Hsp70 expression level as shown here by the Ge and Ge-Hsp70 cells. Furthermore, tumor cells that, due to Hsp70 overexpression, are protected against apoptosis mediated by tumor necrosis factor
(45
, 46)
or chemotherapeutic drugs (47)
might, according to our results, nevertheless be rendered more susceptible to CTL-mediated cytotoxicity by acute Hsp70 induction. Thus, immunotherapeutic approaches to elicit a CTL response against tumors might benefit from acute induction of Hsp70, e.g., by hyperthermia (48)
.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Present address: Dirk Lindemann, Institute of Virology, University of Dresden, Fetcherstr. 74, 01307 Dresden, Germany.
Requests for reprints: Ralf Dressel, University of Göttingen, Division of Immunogenetics, Heinrich-Düker-Weg 12, D-37073 Göttingen, Germany. Phone: 49-551-395884; Fax: 49-551-395882; E-mail: rdresse{at}gwdg.de
3 The abbreviations used are: Hsp, heat shock protein; CTL, cytotoxic T lymphocyte; Ab, antibody; ER, endoplasmic reticulum; GFP, green fluorescent protein; TCR, T-cell receptor; mAb, monoclonal antibody; PI, propidium iodide; MALDI-TOF, matrix-assisted laser desorption/ionization-time of flight; ct, cycle threshold; BiP, immunoglobulin heavy chain binding protein; MFI, mean fluorescence intensity; IFN
, interferon
-2b; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. ![]()
4 A. Asmuß and T. Herrmann, unpublished observations. ![]()
Received 7/30/03. Accepted 9/23/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. Elsner, V. Muppala, M. Gehrmann, J. Lozano, D. Malzahn, H. Bickeboller, E. Brunner, M. Zientkowska, T. Herrmann, L. Walter, et al. The Heat Shock Protein HSP70 Promotes Mouse NK Cell Activity against Tumors That Express Inducible NKG2D Ligands J. Immunol., October 15, 2007; 179(8): 5523 - 5533. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. P. Sashchenko, E. A. Dukhanina, Y. V. Shatalov, D. V. Yashin, T. I. Lukyanova, O. D. Kabanova, E. A. Romanova, S. V. Khaidukov, A. V. Galkin, N. V. Gnuchev, et al. Cytotoxic T lymphocytes carrying a pattern recognition protein Tag7 can detect evasive, HLA-negative but Hsp70-exposing tumor cells, thereby ensuring FasL/Fas-mediated contact killing Blood, September 15, 2007; 110(6): 1997 - 2004. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roos, R. Dressel, B. Schmidt, E. Gunther, and L. Walter The Rat Expresses Two Complement Factor C4 Proteins, but Only One Isotype Is Expressed in the Liver J. Immunol., January 15, 2005; 174(2): 970 - 975. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |