Cancer Research Cell Death Mechanisms and Cancer Therapy  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thornburg, N. J.
Right arrow Articles by Raab-Traub, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thornburg, N. J.
Right arrow Articles by Raab-Traub, N.
[Cancer Research 63, 8293-8301, December 1, 2003]
© 2003 American Association for Cancer Research


Regular Articles

Activation of Nuclear Factor-{kappa}B p50 Homodimer/Bcl-3 Complexes in Nasopharyngeal Carcinoma

Natalie J. Thornburg1, Rajadurai Pathmanathan2 and Nancy Raab-Traub13

1 Department of Microbiology-Immunology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina;
2 Subang Jaya Medical Centre, Selangor DE, Malaysia; and
3 Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
EBV latent infection is associated with the development of lymphoid and epithelial malignancies such as nasopharyngeal carcinoma (NPC). The EBV latent membrane protein 1 (LMP1) acts as a constitutively active tumor necrosis factor receptor and activates cellular signaling pathways such as c-Jun-NH2-terminal kinase, cdc42, Akt, and nuclear factor (NF)-{kappa}B. In epithelial cells, two regions of LMP1 induce specific forms of NF-{kappa}B. COOH-terminal activating region 2 only activates p52/p65 dimers, whereas COOH-terminal activating region 1 activates p50/p50, p50/p52, and p52/p65 dimers and also uniquely up-regulates the epidermal growth factor receptor (EGFR) at the mRNA level. Deregulation of specific NF-{kappa}B members is associated with the development of many cancers. In this study, the status of NF-{kappa}B activation was investigated in NPC to determine which NF-{kappa}B dimers may contribute to the development of NPC. Electrophoretic mobility shift assay, immunoblot, ELISA, and immunohistochemistry data demonstrate that in NPC, NF-{kappa}B p50 homodimers are specifically activated, and this activation is not dependent on LMP1 expression. Coimmunoprecipitation assays indicate that homodimers are bound to the transcriptional coactivator Bcl-3, and chromatin immunoprecipitation indicates that this complex is bound to NF-{kappa}B consensus motifs within the egfr promoter in NPC. The discrete yet striking NF-{kappa}B p50 activation in NPC suggests that p50/p50 homodimers may be important factors in the development of NPC and may contribute to oncogenesis through transcriptional up-regulation of target genes through their interaction with Bcl-3.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The EBV is a ubiquitous human herpesvirus that infects over 90% of the world’s population. EBV is transmitted through saliva, initially infects the oral epithelium, and is transmitted to adjacent B cells, where it is able to establish a latent infection. The immune system is unable to completely clear EBV infection, so once infected, a host remains infected for life. Latent infection is associated with the development of lymphoid and epithelial malignancies such as Burkitt’s lymphoma, Hodgkin’s disease, posttransplant lymphoma, gastric carcinoma, and NPC4 (1) .

LMP1 is an EBV protein that is essential for EBV-induced B-lymphocyte transformation (2) . It is expressed in all EBV-associated malignancies, except Burkitt’s lymphoma, and is the EBV oncogene because it can transform rodent fibroblasts and is tumorigenic in nude mice (3, 4, 5, 6, 7, 8, 9) . LMP1 acts as a constitutively active TNF receptor and activates cellular signaling pathways such as c-Jun-NH2-terminal kinase, cdc42, Akt, and NF-{kappa}B (1 , 10 , 11) . Through these signaling pathways, LMP1 expression results in transcriptional up-regulation of cellular genes such as icam-1, cd80, cd23, cd54, bcl-2, traf1, a20, and egfr (12, 13, 14, 15, 16, 17) . In addition, LMP1-mediated NF-{kappa}B activation is necessary for LMP1-induced fibroblast transformation and B-cell transformation (1 , 18) .

NF-{kappa}B is a family of transcription factors that regulates a wide variety of biological processes including inflammation, apoptosis, cell cycle control, and cell migration (19 , 20) . The mammalian NF-{kappa}B family of transcription factors consists of five members, p65 (RelA), c-Rel, RelB, p50, and p52, all of which contain a Rel homology domain. The transcription factors form dimers among themselves and bind DNA at NF-{kappa}B consensus sites. NF-{kappa}B activation is tightly regulated by the I{kappa}B family of proteins (19 , 20) . The mammalian I{kappa}B family of proteins consists of seven members, all of which have a series of ankyrin repeats responsible for protein-protein interactions. The mammalian I{kappa}B proteins include p105 (NF{kappa}B1, the p50 precursor), p100 (NF{kappa}B2, the p52 precursor), I{kappa}B{alpha}, I{kappa}Bß, I{kappa}B{gamma}, I{kappa}B{epsilon}, and Bcl-3. I{kappa}B{alpha} regulates classical NF-{kappa}B, which consists of a p50/p65 heterodimer. Under normal conditions, the p50/p65 heterodimer is sequestered in the cytosol through an interaction with I{kappa}B{alpha}. When a cell receives an extracellular stimulus, such as TNF binding to its receptor, a signaling cascade is activated that results in activation of the IKK complex. IKK phosphorylates I{kappa}B{alpha}, which targets it for ubiquitination and degradation by the proteasome. Degradation of I{kappa}B{alpha} releases the p50/p65 heterodimer, so it is able to translocate to the nucleus, bind its target DNA sequence, and initiate transcription of target genes (19 , 20) . Unlike activation of classical NF-{kappa}B, activation of p52 or p50 also involves their ability to bind their respective precursor proteins, p100 and p105 (21, 22, 23, 24, 25, 26) . Binding to their precursor proteins can sequester p52 and p50 in the cytosol (21 , 23 , 24 , 27) . In a signaling cascade that involves activation of IKK, p100 and p105 can be phosphorylated and partially cleaved to yield the product proteins p52 and p50, respectively (28, 29, 30) . This allows nuclear translocation of p50 and p52 and binding to target DNA sequences. Neither p50 nor p52 has transactivation domains. However, both homodimers can bind the I{kappa}B family member Bcl-3 that can provide a transactivation function (31 , 32) .

Deregulation of specific NF-{kappa}B members is associated with the development of many cancers (33) . Aberrant NF-{kappa}B and I{kappa}B expression is detected in hematopoietic tumors and solid tumors alike in the form of overexpression, chromosomal rearrangements, and mutations. For example, Bcl-3 is overexpressed in B-cell chronic lymphocytic leukemia and B-cell non-Hodgkin’s lymphoma (33) . I{kappa}B{alpha} is often mutated or truncated in EBV-negative Hodgkin’s disease (33) . p105/50 is often overexpressed in non-small cell lung carcinoma and colon, prostate, breast, bone, and brain cancer cell lines, and p100/p52 is frequently overexpressed in breast and colon carcinomas (33) .

The EBV LMP1-activated forms of NF-{kappa}B and their functions are necessary for B-cell transformation (1) . In epithelial cells, two regions of LMP1 induce specific forms of NF-{kappa}B (34) . CTAR2 only activates p52/p65 dimers. CTAR1 activates p50/p50, p50/p52, and p52/p65 dimers and also uniquely up-regulates the EGFR at the mRNA level (17 , 34) . It has been reported previously that p52 homodimers are selectively activated in breast cancers and that p52 activation is coupled with Bcl-3 expression (35) . It has also been reported that p52 homodimers in combination with Bcl-3 expression uniquely up- regulate cyclin D1 expression and that p50 homodimers uniquely up-regulate bcl-2 expression (36 , 37) . These data indicate that dimer specificity may exist with distinct biological functions.

In this study, NF-{kappa}B activation was analyzed in NPC to determine which NF-{kappa}B dimers may play a role in the development of NPC. In NPC, NF-{kappa}B p50 homodimers were specifically activated, and this activation was not necessarily dependent on LMP1 expression. Homodimers were bound to the transcriptional coactivator Bcl-3, and the complex was bound to NF-{kappa}B consensus motifs within the egfr promoter (38) . These data indicate that p50 homodimers may be transcriptionally active in NPC and may play an essential role in tumor development.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor and Normal Tissue.
C15, C17, and C18 were passaged as described previously (39) and snap frozen in liquid nitrogen or embedded in paraffin. A frozen normal human nasopharynx biopsy was obtained from the Southern Division of the Cooperative Human Tissue Network. Normal human tonsils and adenoids were obtained from the Department of Otolaryngology/Head and Neck Surgery at University of North Carolina Hospitals. Whole human tonsils were snap frozen in liquid nitrogen. Adenoid lymphoid tissue was separated from mucosal tissue, and both tissue types were snap frozen.

Cell Extracts and Western Blots.
Tumor and normal tissue were pulverized using a B. Braun Mikro-Dismembrator II. Pulverized tissue was washed once with cold PBS, and cells were lysed with radioimmunoprecipitation assay buffer supplemented with protease and phosphatase inhibitor mixtures (Sigma). Alternatively, cells were separated into nuclear and cytosolic fractions as described below. Equal amounts of protein were used for SDS-PAGE and Western blotting. Primary antibodies used for Western blots include anti-p50, anti-p52, anti-cRel, anti-RelB, anti-{alpha}-actin, anti-Bcl-3 (Santa Cruz Biotechnology), and anti-p65 (Rockland). Secondary antibodies used were horseradish peroxidase-conjugated antimouse and antirabbit (Amersham Pharmacia) and antigoat (DAKO). Blots were developed using Pierce Supersignal West Pico Chemiluminescence system. Bcl-3 antibody was preincubated with a Bcl-3-specific peptide for 2 h at room temperature as directed by the manufacturer (Santa Cruz Biotechnology) before application to the Western blot to confirm the specificity of the antibody.

Nuclear and Cytosolic Separation.
Pulverized tissue was washed once with cold PBS. Tissue cells were lysed by incubation in a hypotonic buffer [20 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and protease and phosphatase inhibitor mixtures (Sigma)] for 15 min on ice followed by addition of NP40 to a final concentration of 1%. Nuclei were pelleted by low-speed centrifugation at 1200 rpm for 10 min at 4°C. The supernatant was collected as the cytosolic fraction. The crude nuclear pellet was further purified using Optiprep (Sigma) reagent as directed by the manufacturer. Briefly, crude nuclei were resuspended in a 25% solution of Optiprep and underlaid with 30% and 35% layers of Optiprep. The gradient was spun for 20 min at 10,000 x g. The band of nuclei was collected from the 30%/35% interface, washed, pelleted, and lysed with nuclear extraction buffer [20 mM Tris (pH 8.0), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, protease inhibitor mixture (Sigma), and phosphatase inhibitor mixture (Sigma)] with the salt concentration adjusted to 400 mM with 5 M NaCl. Insoluble nuclear material was pelleted at high speed for 10 min.

EMSA.
EMSAs were performed as described previously (35) . Briefly, an oligonucleotide (UV21) of the NF-{kappa}B site from the H-2Kb gene (CAGGGCTGGGGATTCCCCATCTCCCACAGTTTCACTTC) was labeled with [{alpha}-32P]dCTP using the Klenow fragment from DNA polymerase I. Two µg of nuclear extract or 20 µg of cytosolic extract were incubated with radiolabeled probe. For competition experiments, a mutant probe (UV21M) was made by mutating the underlined NF-{kappa}B consensus site to CAGGGCTGCCCATTCGGGATCTCCACAGTTTCACTTC. Nuclear extracts and hot UV21 or UV21M were incubated in the presence of a 10-fold molar excess of cold probe or double-stranded NF-{kappa}B or AP1 oligonucleotides (Promega). For supershift assays, antibody (0.5–5 µg) was incubated with extracts, no extracts, or purified human recombinant p50 (Promega) before addition of radiolabeled probe. Antibodies used were the same as those described for Western blots.

ELISA.
Levels of p50 and p65 in nuclear lysates were measured using Clontech Mercury Transfactor ELISA kits as described by the manufacturer.

Immunoprecipitations.
Whole cell lysates for immunoprecipitation were made in Tris NaCl EDTA buffer with 0.5% CHAPS. Whole cell or nuclear lysates (75 µg) were precleared with Gamma-bind plus Sepharose (Amersham Pharmacia) for 2 h at 4°C. Precleared lysates were immunoprecipitated with 5 µl of anti-p50 or anti-Bcl-3 antibody overnight at 4°C. Immunoprecipitations were incubated with Gamma-bind plus Sepharose for 2 h at 4°C. Immunoprecipitations were washed two times, resuspended in SDS-PAGE sample buffer, boiled, and used for SDS-PAGE and Western blots.

Immunohistochemistry.
Paraffin-embedded sections were deparaffinized with Histo-clear (National Diagnostics) and rehydrated with graded alcohol treatments. Antigen retrieval was carried out by microwave treatment for 15 min in citrate buffer (pH 6.0). Sections were permeabilized with methanol and blocked in 5% normal goat serum in TBS (pH 7.0). Sections were incubated with primary antibody or the corresponding isotype control (CS1-4 or mouse IgG1, DAKO; anti-p50 or rabbit IgG, Santa Cruz Biotechnology; and anti-Bcl-3 or mouse IgG2A, Novo Castra) for 3 h at room temperature in a humidified chamber. After washing, sections were incubated with alkaline phosphatase-labeled polymer conjugated to antimouse and antirabbit antibodies (DAKO EnVision Systems). The slides were incubated in the substrate-chromogen 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (DAKO) supplemented with levamisole (DAKO) and counterstained with nuclear fast red (DAKO). Slides were then dehydrated and mounted.

ChIP.
Snap-frozen tissue was pulverized using a B. Braun Mikro-Dismembrator II. Pulverized tissue was resuspended in 50 ml of DMEM and cross-linked in 1% formaldehyde for 15 min at room temperature. The cross-linking reaction was quenched with 120 mM glycine, and the tumor slurry was pelleted and washed with cold PBS. The tumor pellet was lysed in radioimmunoprecipitation assay buffer [10 mM Tris-HCl (pH 8.0), 140 mM NaCl, 1% Triton X-100, 0.1% SDS, and 1% deoxycholic acid] spiked with protease inhibitor mixture (Sigma) for 30 min at 4°C. Lysates were sonicated with a Misonix XL-2020 Sonicator on power setting 3 for six cycles with 6-s pulses and 4-s rests to yield an average DNA size of approximately 500 bp. The lysates were clarified, and they were precleared with 300 µl of Gamma-bind plus Sepharose (Amersham Pharmacia) for 2 h at 4°C. The beads were pelleted, the supernatant was split into equal volumes, and either anti-p50 or anti-Bcl-3 was added (Santa Cruz Biotechnology) and incubated overnight at 4°C. Immunoprecipitates were then incubated with Gamma-bind plus Sepharose and washed four times (5 min each), and DNA/protein was eluted from the beads with 1% SDS, 1x Tris EDTA at 65°C. The beads were pelleted, and the supernatant was saved. The cross-linking was reversed overnight at 65°C. The samples were then treated with proteinase K at 37°C for 2 h, LiCl was added, and DNA was phenol-chloroform purified, precipitated, pelleted, and resuspended in 20 µl. Purified DNA was used for PCR. Primer sequences designed to flank the NF-{kappa}B sites in the egfr promoter were 5'-GGGGACCCGAATAAAGGAGCAGTTT-3' and 5'-CTGAGGAGTTAATTTCCGAGAGGGG-3'. Taq polymerase (Promega) was used to amplify 300 ng of genomic template or 4 µl of ChIP product. PCR products were run on a 10% nondenaturing polyacrylamide gel and transferred to Hybond-N+ nucleic acid membrane (Amersham). An oligonucleotide probe was end-labeled with [{gamma}-32P]ATP using polynucleotide kinase. The probe was hybridized to the membrane in Rapid-hyb buffer (Amersham) as directed by the manufacturer, and developed by autoradiography.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
C15 and C17 Nuclear Extracts Have NF-{kappa}B p50.
The C15, C17, and C18 xenografts are well-characterized NPC tumors that can be passaged indefinitely in nude mice and consist of a homogenous tumor cell population without infiltrating lymphocytes (39) . C15 was isolated from a primary NPC, expresses LMP1, and is considered a prototypical NPC. C17 and C18 were isolated from metastatic NPCs and do not express LMP1. LMP1 expression in C15 was confirmed for all passages of tumors by Western blot analysis (data not shown). To examine NF-{kappa}B activation in NPC, C15, C17, and C18 nuclear extracts were prepared for EMSA. Using a radiolabeled oligonucleotide probe (UV21) with the NF-{kappa}B consensus site from the MHC I promoter, a single complex was consistently detected in C15 and C17 but not C18, with higher levels of activated NF-{kappa}B in C15 (Fig. 1A)Citation . To ensure that the complex was NF-{kappa}B specific, C15 nuclear extracts were incubated with a radiolabeled probe with a mutated NF-{kappa}B consensus site (UV21M) and a panel of cold competitors. Incubation of radiolabeled UV21 and UV21M without lysate did not produce any complexes (Fig. 1BCitation , Lanes 1 and 2). A single complex was detected after incubation of C15 nuclear extract with UV21 (Fig. 1BCitation , Lane 3) but not UV21M (Fig. 1BCitation , Lane 4), indicating that the complex in C15 is specific for authentic NF-{kappa}B probe. The complex was not reduced with a 10-fold excess of cold UV21M (Fig. 1BCitation , Lane 5) but was reduced with a 10-fold excess of cold UV21 (Fig. 1BCitation , Lane 6), again confirming that the complex is NF-{kappa}B specific. As expected, complexes were not detected after incubation of extract with UV21M and cold UV21M (Fig. 1BCitation , Lane 7). The intensity of the complex was reduced after competition with a double-stranded NF-{kappa}B oligonucleotide (Promega; Fig. 1BCitation , Lane 8) but not after competition with a double-stranded AP1 oligonucleotide (Promega; Fig. 1BCitation , Lane 9). These data, taken together, confirm that the complex formed with C15 nuclear extracts is NF-{kappa}B specific.



View larger version (63K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Analysis of NF-{kappa}B and I{kappa}B in NPC tumors. A, C15, C17, and C18 EMSA. Nuclear extracts were incubated with a radiolabeled oligonucleotide with a NF-{kappa}B consensus site (UV21). Activated NF-{kappa}B was absent in C18. One complex was detected in C15 and C17, with a greater amount in C15. B, C15 nuclear extracts were incubated with radiolabeled wild-type UV21 (21) or mutant UV21M (21M) probes and a panel of cold competitors to confirm that the shifted complex was NF-{kappa}B specific. UV21 and UV21M probes were incubated without lysate (Lanes 1 and 2) or with lysate (Lanes 3 and 4). Incubation with UV21M did not yield a complex. UV21 and lysate were incubated with a 10-fold excess of cold UV21M (Lane 5) and cold UV21 (Lane 6). The complex was not reduced by competition with UV21M but was reduced by competition with UV21. UV21M and lysate were incubated with a 10-fold excess of cold UV21M, and no complex was present (Lane 7). UV21 and lysate were incubated with cold double-stranded commercially available NF-{kappa}B (Lane 8) and AP1 (Lane 9) oligonucleotides. Incubation with the NF-{kappa}B oligonucleotide but not the AP1 oligonucleotide reduced the presence of the complex. C, C15 and C17 nuclear extracts were subjected to supershift assay by preincubation with anti-p50, anti-p52, anti-bcl-3, anti-p65, anti-RelB, or anti-c-Rel antibodies before addition of probe. The complex only shifted with anti-p50. D, C15 nuclear extracts, no lysate, and purified recombinant human p50 (Promega) were subjected to supershift assay by preincubation with anti-p50. Probe alone had no complex (Lane 1). C15 had one complex (Lane 2), and the complex was shifted with anti-p50 (Lanes 3 and 4). Incubation of antibody with no lysate yielded no complex (Lanes 5 and 6). Purified human recombinant p50 incubated with probe yielded one major complex (Lane 7) and was supershifted with anti-p50 (Lane 8). E, I{kappa}B{alpha} Western blot of whole cell lysates from NPC tumors (top panel) and corresponding actin Western blot as a loading control (bottom panel). C15, C17, and C18 tumor lysates were used for SDS-PAGE and Western blot analysis.

 
Using antibodies specific for NF-{kappa}B family members, a supershifted complex was only detected with anti-p50 antibody (Fig. 1C)Citation . The effectiveness of the other antibodies in supershift analysis was confirmed through supershift analysis of cytosolic fractions (Fig. 2A)Citation . To confirm that the supershift did not result from binding of the antibody alone to the probe, antibody was incubated with probe in the absence of lysate, and a complex was not detected (Fig. 1DCitation , Lanes 5 and 6). To ensure that the complex did not contain other transcription factors, C15 nuclear extracts were subjected to EMSA and supershift in parallel to purified human recombinant p50 (Promega). C15 nuclear extracts and recombinant p50 migrated at the same position on the gel (Fig. 1DCitation , Lanes 2–4, 7, and 8). To further confirm that the complex did not contain other transcription factors, lysates were incubated with anti-SP1 and anti-SP3 antibodies, and a mobility shift was not detected by EMSA (data not shown). These data suggest that the complex in C15 nuclear extracts has only NF-{kappa}B p50.



View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Subcellular location of NF-{kappa}B family members. A, C15 and C17 cytosolic extracts were used for supershift analysis using anti-p50, anti-p52, anti-Bcl-3, anti-RelB, and anti-p65 antibodies. Cytosolic extracts had three complexes that were shifted with anti-p50, anti-p52, anti-p65, and anti-RelB. Supershifted bands are marked with asterisks. B, nuclear and cytosolic extracts from C15 and C17 tumors or normal nasopharynx biopsy were used for p105 and p50 Western blot analysis. Normal nasopharynx biopsies(labeled Normal) served as a negative tissue control. C, nuclear and cytosolic extracts from C15 and C17 were used to examine levels of other NF-{kappa}B family members by Western blot analysis. Actin served as a loading control.

 
A second, slower migrating complex was occasionally detected in C17 (Fig. 1CCitation , indicated by an asterisk). This less abundant complex shifted with anti-p65 antibody (data not shown). These data indicate that NF-{kappa}B is constitutively activated in C15 and C17, but not in C18. Interestingly, C15 and C18 had readily detectable I{kappa}B{alpha} protein, whereas I{kappa}B{alpha} was not detected in C17 (Fig. 1E)Citation . The presence of the minor complex consisting of p50 and p65 in C17 is consistent with the absence of I{kappa}B{alpha}. These data suggest NF-{kappa}B p50 homodimers may be activated via different molecular mechanisms in NPC. In C15, it is likely that LMP1 has induced NF-{kappa}B, and without LMP1 in C17, the absence of I{kappa}B{alpha} is responsible for the activating signal. However in both NPCs, the result is primarily activation of p50 homodimers.

C15 and C17 Cytosolic Extracts Have Other NF-{kappa}B Family Members.
EMSA was performed using cytosolic extracts to determine whether C15 and C17 express only NF-{kappa}B p50 or if they express other family members with specific activation of p50. C15 and C17 each had three NF-{kappa}B complexes (Fig. 2ACitation , Lanes 1 and 2). Cytosolic extracts were supershifted with antibodies specific to NF-{kappa}B family members to determine the identity of the complexes. When cytosolic extracts were preincubated with anti-p50, the abundance of the bottom and middle complexes were slightly reduced (Fig. 2ACitation , Lanes 3 and 4). These complexes, therefore, likely contain p50 or its precursor, p105. The abundance of the middle complex was also reduced with an accompanying supershifted band when preincubated with anti-p65, indicating that the middle complex has both p50 and p65 (Fig. 2ACitation , Lanes 13 and 16). The top complex was eliminated by incubation with antibodies to p52, Bcl-3, and RelB, and a supershift was observed with the antibody to RelB, indicating that the complex consists of p52, Bcl-3, and RelB (Fig. 2ACitation , Lanes 5–10). These data suggest that C15 and C17 have multiple cytosolic NF-{kappa}B complexes.

To confirm the location of NF-{kappa}B family members in C15 and C17, Western blot analyses were performed on nuclear and cytosolic extracts (Fig. 2B)Citation . Normal human adenoid mucosal tissue was used as a normal tissue control. Nuclear p105 or p50 was not detected in normal tissue, whereas C15 and C17 had high levels of nuclear p105. Normal tissue had high levels of cytosolic p105 and p50 (Fig. 2C)Citation . Possible cytosolic contamination of nuclear extracts was eliminated because the adenoid mucosal tissue, which was fractionated in parallel with C15 and C17, completely lacked nuclear p105 but retained considerable amounts of cytosolic p105 (Fig. 2B)Citation . The location of other NF-{kappa}B family members was also confirmed by Western blot analysis of nuclear and cytosolic fractions, with actin used as a loading control (Fig. 2C)Citation . Low levels of p65 were detected in C15 and C17 nuclear extracts with abundant p65 in the cytosol, confirming the EMSA data (Fig. 2C)Citation . RelB and cRel were not detected in either C15 or C17 nuclear extracts, but cRel was readily detectable in C15 and C17 cytosolic extracts (Fig. 2C)Citation . As compared with C17, C15 had p100 and increased levels of cytosolic RelB, which are both transcriptionally regulated by NF-{kappa}B. Again, this suggests a specific activation and translocation of NF-{kappa}B p50 homodimers in NPC.

Tumor Tissues Have More Nuclear p50 than Normal Tissue.
Several different types of normal human tissue were subjected to EMSA and supershift analysis to compare NF-{kappa}B activation in tumor tissue versus normal human tissue. Normal human adenoid mucosal tissue was separated from lymphoid tissue. Because C15 and C17 tumors are of epithelial origin, adenoid mucosal tissue may provide the most relevant normal tissue control. Whole tonsil tissue and normal nasopharynx tissue were also used as controls. All normal tissues had dramatically lower levels of nuclear NF-{kappa}B than NPC tumors, although the lysates contained readily detectable actin (Fig. 3A)Citation . Activated NF-{kappa}B was not detected in adenoid mucosal tissue, whereas adenoid lymphoid tissue and whole tonsil tissue had low levels of activated NF-{kappa}B with one to three nuclear complexes. Normal nasopharynx had low levels of activated NF-{kappa}B with one nuclear complex. Some level of background NF-{kappa}B activation in tonsil and lymphoid tissue was to be expected because the tissue may have been chronically inflamed. At least one complex in each tissue with activated NF-{kappa}B was shifted with anti-p50 antibody.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Levels of nuclear p50 in C15 and C17 compared with nuclear p50 in normal tissues. A, nuclear extracts from tumors and a panel of normal tissues were used for EMSA and anti-p50 supershift analysis (top panel). Normal adenoids were dissected into pure mucosal and lymphoid tissues. Whole tonsillar tissue and normal nasopharynx biopsies were also used. Tumors have higher levels of NF-{kappa}B. An actin Western blot was performed as an indication of protein integrity (bottom panel). B, nuclear extracts from tumors and normal tissues were used in an ELISA assay to detect the presence of NF-{kappa}B p50 (Clontech). TNF-treated HeLa nuclear extract provided by the manufacturer was used as a positive control. The results of the ELISA confirm the EMSA.

 
To confirm these EMSA data, nuclear extracts from normal and tumor tissues were used for a p50-specific ELISA (Fig. 3B)Citation . The graph represents three separate experiments, and within each experiment, three different passages of C15 and C17 nuclear extracts were used. TNF-treated HeLa nuclear extracts were provided by the manufacturer as a positive control. Confirming the EMSA data, C15 had the highest levels of nuclear p50. The normal epithelial tissues, adenoid mucosa, and normal nasopharynx had very low levels of nuclear p50. A p65-specific ELISA also did not detect nuclear p65 in C15 or C17 (data not shown). These data confirm that in passaged NPCs, levels of NF-{kappa}B activation and, more specifically, levels of NF-{kappa}B p50 activation are significantly higher than those in normal epithelial tissues. Taken together, the EMSA, Western blot, and ELISA data all indicate that NF-{kappa}B p50 homodimers are the only form of nuclear NF-{kappa}B present in NPC, but not in normal epithelial tissue.

C15 Expresses High Levels of Bcl-3.
NF-{kappa}B p50 lacks a transactivation domain; however, when bound to Bcl-3, Bcl-3 promotes DNA binding and provides transactivation function to p50 homodimers. To determine whether the nuclear p50 homodimers in C15 and C17 may be transcriptionally active through the expression of Bcl-3, Western blot analysis was performed. Bcl-3 was detected in C15 and C17 whole cell lysates (Fig. 4A)Citation , with three bands detected in the Bcl-3 immunoblot. Preincubation with a Bcl-3-specific peptide provided by the manufacturer reduced the intensity of all three bands, indicating that all three bands are forms of Bcl-3 (Fig. 4A)Citation . Previous studies have indicated that Bcl-3 is highly phosphorylated, and the size of these bands was consistent with reported Bcl-3 phosphoforms (32 , 40) .



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Levels of Bcl-3. A, C15 and C17 whole cell lysates were used for immunoblot. Anti-Bcl-3 antibody was preabsorbed with a Bcl-3-specific peptide provided by the manufacturer before incubation with the immunoblot to identify Bcl-3-specific bands. C15 and C17 have high levels of Bcl-3, which can be identified as three bands on an immunoblot. B, to identify the location of Bcl-3 and compare levels with normal tissue, C15 and C17 tumors and adenoid mucosal tissue were fractionated into cytosolic and nuclear fractions and used for Bcl-3 immunoblot analysis. Actin Western blot was used as a loading control (bottom panel). Adenoid mucosal tissue had little Bcl-3, and tumor Bcl-3 was in the nuclear fraction.

 
Western blot analysis of cytosolic and nuclear fractions detected very low levels of Bcl-3 in adenoid mucosal tissue, with abundant nuclear Bcl-3 in C15 and C17 (Fig. 4B)Citation . The presence of high levels of nuclear Bcl-3 suggests that Bcl-3 may function in NPC.

Bcl-3 Coimmunoprecipitates with p50.
Whole cell lysates from C15, C17, and C18 were either directly loaded onto a SDS-PAGE gel or immunoprecipitated without antibody or with anti-Bcl-3 antibody and immunoblotted with anti-p50/p105 antibody to determine whether p50 homodimers are complexed with Bcl-3. In tumor lysates, p50 consistently immunoprecipitated with anti-Bcl-3 (Fig. 5A)Citation . To confirm the interaction between p50 and Bcl-3, Bcl-3 was immunoprecipitated with anti-p50/p105. All three Bcl-3-specific bands immunoprecipitated with anti-p50/p105 in the reverse immunoprecipitation (Fig. 5B)Citation . p50 is also known to bind the histone deacetylase HDAC1, and, when bound, the homodimers are transcriptionally inactive (41) . Duplicate tumor lysates were either directly loaded onto a SDS-PAGE gel or immunoprecipitated without antibody or anti-HDAC1 and immunoblotted with anti-p50/p105 antibody. In contrast to Bcl-3, p50 did not immunoprecipitate with anti-HDAC1 (Fig. 5C)Citation . These data indicate that in NPC, p50 homodimers are not bound to the transcriptionally repressive HDAC1 but are bound to the transcriptionally activating Bcl-3, suggesting that the homodimers are functionally active.



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Immunoprecipitations. A, 75 µg of whole cell lysates were immunoprecipitated without antibody or anti-Bcl-3 antibody, and a p50/p105 immunoblot was performed. p50 immunoprecipitated with anti-Bcl-3. Twenty-five µg of whole cell lysates were also directly loaded onto the gel to serve as a positive control for the Western blot (first three lanes). B, to confirm that p50 and Bcl-3 interact in the nucleus, 75 µg of whole cell lysates or nuclear lysates were immunoprecipitated with anti-p50/p105 antibody, and a Bcl-3 immunoblot was performed. Nuclear Bcl-3 immunoprecipitated with anti-p50/p105. C, 75 µg of whole cell tumor lysates were immunoprecipitated without antibody or anti-HDAC1 antibody, and a p50/p105 immunoblot was performed. p50 or p105 did not immunoprecipitate with anti-HDAC1. Twenty-five µg of whole lysates were also directly loaded onto the gel to serve as a positive control for the Western blot (first three lanes).

 
p50 and Bcl-3 Are Activated in Primary NPCs.
Paraffin-embedded tissue sections from 10 patients with NPC were stained with the CS1-4 monoclonal antibody for LMP1, anti-Bcl-3, or anti-p50. Positively stained tumor cell nuclei are indicated by purple staining. All sections were stained with antibody-appropriate isotype negative controls, and significant background staining was not detected (Fig. 6A and ECitation ; CS1-4 negative control not shown). The left column is the p50 and isotype control stains (Fig. 6, A–D)Citation . The right column is the Bcl-3 and isotype control stains (Fig. 6, E–H)Citation . Immunohistochemistry confirmed the presence of nuclear p50 in a significant proportion of C15 cells and served as a positive control (Fig. 6B)Citation . The absence of nuclear p50 in many tumor cells may reflect another layer of regulation of p50 that is perhaps linked to the status of LMP1 expression or cell cycle status. Two representative primary NPC sections that stained positive for p50 are shown (Fig. 6, C and D)Citation . Both sections exhibited strong nuclear staining in epithelial tumor cells (Fig. 6, C and D)Citation . Immunohistochemistry confirmed the presence of abundant Bcl-3 in C15, which served as a positive control for Bcl-3 stains (Fig. 6F)Citation . Abundant Bcl-3 was readily detected in the tumor cell nuclei of primary NPC sections (Fig. 6, G and H)Citation . Infiltrating lymphocytes also stained weakly positive for Bcl-3 (Fig. 6, G and H)Citation . LMP1 was detected in 4 of 10 sections, p50 was detected in 8 of 9 sections, and Bcl-3 was detected in 6 of 10 sections (Table 1)Citation .



View larger version (116K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Immunohistochemical stains of paraffin-embedded tissue. A, C15 sections stained using rabbit IgG as an isotype negative control for p50 stains. B, C15 section stained with anti-p50/p105 antibody. C and D, two representative primary NPC sections stained with anti-p50/p105. E, C15 section stained using mouse IgG2A as an isotype negative control for Bcl-3 stains. F, C15 section stained with anti-Bcl-3. G and H, two representative primary NPC sections stained with anti-Bcl-3.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Summary of immunohistochemical stains of primary NPCs

 
p50 and Bcl-3 Are Bound to the egfr Promoter in C15.
LMP1 (CTAR1) has the ability to uniquely activate NF-{kappa}B p50 homodimers and EGFR at the mRNA level (17) . EGFR protein is abundant in C15, detectable in C17, and undetectable in C18 (Fig. 7A)Citation . p50 homodimers bind to four of five consensus NF-{kappa}B binding sites within the egfr promoter (38) . ChIP was used to determine whether, in NPC, p50 homodimers/Bcl-3 complexes are bound to the egfr promoter. Briefly, ground tumors were formaldehyde-cross-linked, lysed, sonicated, and immunoprecipitated with anti-p50 or anti-Bcl-3. Lysates were treated with proteinase K, and DNA was purified and subjected to PCR. Using an internal oligonucleotide probe, PCR products were subjected to Southern blot hybridization to increase the sensitivity and specificity of the assay. Primers were designed for the region of the egfr promoter that has three NF-{kappa}B consensus binding sites. PCR products from genomic DNA were sequenced to confirm the identity of the PCR products. Water served as a negative PCR control (Fig. 7BCitation , Lane 1), and C15, C17, and C18 genomic DNA served as positive controls for the PCR reaction (Fig. 7BCitation , Lanes 2–4). NF-{kappa}B consensus sites within the egfr promoter immunoprecipitated with anti-p50 in C15 (Fig. 7BCitation , Lane 5), but not in C17 or C18 (Fig. 7BCitation , Lanes 6 and 7). NF-{kappa}B consensus sites within the egfr promoter also immunoprecipitated with anti-Bcl-3 in C15 (Fig. 7BCitation , Lane 8), but not in C17 or C18. Thus, the p50 homodimer/Bcl-3 complexes that are bound to the egfr promoter are detectable in C15 but not in C17 or C18 (Fig. 7BCitation , Lanes 9 and 10). The correlating levels of bound p50/Bcl-3 complexes to EGFR expression suggest that the complex may activate the egfr promoter in a LMP1-dependent manner.



View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. EGFR in NPC tumors. A, C15, C17, and C18 whole cell extracts were subjected to an EGFR immunoblot. EGFR was readily detected in C15. Actin served as a loading control. B, ChIP of C15, C17, and C18 using anti-p50/p105 and anti-Bcl-3 for immunoprecipitations. Results of PCR after ChIP are shown. PCR, using primers designed to flank the NF-{kappa}B sites in the egfr promoter, was performed on water negative control, genomic C15, C17, and C18 DNA positive controls (Lanes 2–4), or purified DNA after immunoprecipitation with anti-p50/105 or anti-Bcl-3 (Lanes 5–10).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
These data indicate that activated NF-{kappa}B p50 and the proto-oncogene Bcl-3 are complexed in NPC, and these complexes are bound to NF-{kappa}B sites within the egfr promoter. The activation of only one complex was unexpected because in epithelial cell lines, LMP1 activated three different dimer forms of NF-{kappa}B (34) . Nf{kappa}b1 is overexpressed in the solid tumor, non-small cell lung carcinoma, and in colon, prostate, breast, bone, and brain cancer cell lines (33) . In laryngeal papillomas, infected with human papilloma virus types 6 and 11, NF-{kappa}B is activated, and the p50 homodimer is the predominant dimer (42) . Coincidentally, EGFR is overexpressed in papilloma-infected cells (43) . Activation and overexpression of p50 within tumors and papillomas of similar cell types to those in NPC may suggest a cell type-dependent role for p50 in epithelial malignancies.

NF-{kappa}B appears to play a unique role in SCC. During mouse skin carcinogenesis studies, levels of p50 expression increase (44) . A blockade in classical NF-{kappa}B activation, through expression of the super-repressor form of I{kappa}B{alpha} in murine skin, results in hyperplastic epithelium (45 , 46) . In human epidermal tissue, a blockade in NF-{kappa}B also resulted in hyperplastic epithelium (46 , 47) . When constitutively active Ras was coexpressed with a blockade in classical NF-{kappa}B, SCC developed, possibly through a mechanism that involves, in part, an increase in cyclin-dependent kinase 4 (47) . In epidermal cells, expression of p65 resulted in a posttranscriptional decrease in cyclin- dependent kinase 4 (47) . These data are in stark contrast to other studies that suggest that NF-{kappa}B is necessary for Ras-mediated oncogenesis in fibroblasts (48) . In the epithelial cells of NPC, NF-{kappa}B activation may be necessary for oncogenesis, but classical NF-{kappa}B (p65/p50) may provide a block in proliferation (49) . Thus, NF-{kappa}B p50/p50 homodimers may be able to provide an activating signal without the proliferative block that p65 imposes.

As confirmed by Western blot, p105 and p50 were the only detectable nuclear NF-{kappa}B family members in tumor nuclei. Notably, nuclear p105 has only been reported in one other publication, in which nuclear p105 was detected in EBV-infected B lymphocytes (38) . This suggests that during EBV infection, NF-{kappa}B activation may involve nuclear transport of the normally cytosolic p105. Furthermore, p50 activation appeared to be independent of LMP1 expression and was activated in almost all examples of NPC, stressing the importance of p50 activation. This is similar to the status of NF-{kappa}B in Hodgkin’s lymphoma, where NF-{kappa}B is activated in EBV-positive and -negative samples via different molecular mechanisms (50, 51, 52) . In Hodgkin’s lymphoma Reed-Sternberg cells, constitutively active NF-{kappa}B is necessary for proliferation and survival of the cells (50, 51, 52) . This activation can occur by expression of LMP1 or by expression of nonfunctional I{kappa}B{alpha} (50, 51, 52) . In the passaged tumor C15, NF-{kappa}B was activated in the presence of LMP1, and I{kappa}B{alpha} was expressed at wild-type levels. In the passaged tumor C17, NF-{kappa}B was activated in the absence of LMP1, but I{kappa}B{alpha} was not expressed. In primary NPC sections, p50 was activated in the absence of LMP1 in 5 of 10 samples. The status of I{kappa}B{alpha} was not examined in these samples, but a study of I{kappa}B{alpha} expression in relationship to LMP1 expression in primary NPC may be informative in the future.

Alone, p50 and p52 homodimers are transcriptionally inactive unless complexed with Bcl-3, and Bcl-3 is itself a proto-oncogene (31 , 32) . Chromosomal rearrangement and overexpression of Bcl-3 are frequently detected in B-cell chronic lymphocytic leukemia and B-cell non-Hodgkin’s lymphoma (33 , 53) . Expression of Bcl-3 in cells can increase proliferation, decrease the span of G1 phase, and up-regulate cyclin D1 (36) . In this study, overexpression of Bcl-3 was found in passaged and primary NPC, suggesting that Bcl-3 may increase the proliferative capacity of NPC cells. Furthermore, it has been reported that Bcl-3 can help to increase nuclear levels of p50 and may aid in NF-{kappa}B dimer binding to DNA (54) . Therefore, the very high levels of nuclear p50 in NPC and the strong binding of p50/p50 homodimers to DNA may be due, in part, to the expression of Bcl-3. Alternatively, Bcl-3 has been found to be transcriptionally regulated by NF-{kappa}B itself in an autoregulatory loop (55) . Therefore, the high levels of Bcl-3 expression may reflect the high levels of NF-{kappa}B activation in NPC and contribute to the binding of p50 homodimers to the egfr promoter. Whereas neither Bcl-3 nor p50 has been directly implicated in transcriptional up-regulation of egfr, a recent study found that p50, but not other NF-{kappa}B family members, bound to four NF-{kappa}B consensus sites within the egfr promoter in vitro but did not transactivate the promoter. p50 homodimers have been specifically implicated in up-regulation of the bcl-2 promoter (37) , whereas p52 homodimers were selectively activated in breast cancer, and, in conjunction with Bcl-3 expression, p52 homodimers can specifically transactivate the cyclin D1 promoter (35 , 36) . These data support the hypothesis that dimer specificity exists among the NF-{kappa}B family members. It is likely that the DNA NF-{kappa}B binding sites, cell type, and other factors contribute to the specificity.

This study reveals that a very specific type of NF-{kappa}B activation occurs within NPC. The dominant NF-{kappa}B dimer is the p50/p50 homodimer, which is complexed with Bcl-3 and bound to the egfr promoter in vivo. Overexpression of p105/p50 has been detected in many cell lines derived from solid tumors and in non-small cell lung carcinoma, and it has been generally accepted that overexpression contributes to oncogenesis through dimerization with other subunits (33) . The discrete yet striking NF-{kappa}B p50 activation in NPC suggests that p50/p50 homodimer may be an important factor in the development of NPC without the activation of other NF-{kappa}B family members. p50 homodimers may, instead, contribute to oncogenesis through transcriptional up-regulation of target genes through their interaction with Bcl-3.


    ACKNOWLEDGMENTS
 
We thank Carol Shores and Adam Zanation for assistance in dissection of the adenoids. We also thank Jennifer Morrison and Bernardo Mainou for critical review of the manuscript.


    FOOTNOTES
 
Grant support: NIH Grants CA32979 and 19014 (to N. R-T.).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Nancy Raab-Traub, Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7295. E-mail: nrt{at}med.unc.edu

4 The abbreviations used are: NPC, nasopharyngeal carcinoma; LMP1, latent membrane protein 1; NF, nuclear factor; TNF, tumor necrosis factor; CTAR, COOH-terminal activating region; EMSA, electrophoretic mobility shift assay; EGFR, epidermal growth factor receptor; IKK, I{kappa}B kinase; ChIP, chromatin immunoprecipitation; AP1, activator protein 1; SCC, squamous cell carcinoma. Back

Received 6/19/03. Revised 9/ 5/03. Accepted 9/11/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kieff E., Rickinson A. B. Epstein-Barr virus and its replication 4th ed. Fields B. N. Howley P. M. Griffin D. E. Lamb R. A. Martin M. A. Roizman B. Straus S. E. Knipe D. M. eds. . Field’s Virology, Vol. 2: 2511-2573, Lippincott Williams & Wilkins Publishers Philadelphia 2001.
  2. Kaye K. M., Izumi K. M., Kieff E. Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc. Natl. Acad. Sci. USA, 90: 9150-9154, 1993.[Abstract/Free Full Text]
  3. Young L., Alfieri C., Hennessy K., Evans H., O’Hara C., Anderson K. C., Ritz J., Shapiro R. S., Rickinson A., Kieff E., et al Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N. Engl. J. Med., 321: 1080-1085, 1989.[Abstract]
  4. Fahraeus R., Fu H. L., Ernberg I., Finke J., Rowe M., Klein G., Falk K., Nilsson E., Yadav M., Busson P., et al Expression of Epstein-Barr virus-encoded proteins in nasopharyngeal carcinoma. Int. J. Cancer, 42: 329-338, 1988.[Medline]
  5. Pathmanathan R., Prasad U., Sadler R., Flynn K., Raab-Traub N. Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma. N. Engl. J. Med., 333: 693-698, 1995.[Abstract/Free Full Text]
  6. Young L. S., Dawson C. W., Clark D., Rupani H., Busson P., Tursz T., Johnson A., Rickinson A. B. Epstein-Barr virus gene expression in nasopharyngeal carcinoma. J. Gen. Virol., 69: 1051-1065, 1988.[Abstract/Free Full Text]
  7. Wang D., Liebowitz D., Kieff E. An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell, 43: 831-840, 1985.[Medline]
  8. Baichwal V. R., Sugden B. The multiple membrane-spanning segments of the BNLF-1 oncogene from Epstein-Barr virus are required for transformation. Oncogene, 4: 67-74, 1989.[Medline]
  9. Baichwal V. R., Sugden B. Transformation of Balb 3T3 cells by the BNLF-1 gene of Epstein-Barr virus. Oncogene, 2: 461-467, 1988.[Medline]
  10. Eliopoulos A. G., Young L. S. LMP1 structure and signal transduction. Semin. Cancer Biol., 11: 435-444, 2001.[Medline]
  11. Dawson C. W., Tramountanis G., Eliopoulos A. G., Young L. S. Epstein-Barr virus latent membrane protein 1 (LMP1) activates the phosphatidylinositol 3-kinase/Akt pathway to promote cell survival and induce actin filament remodeling. J. Biol. Chem., 278: 3694-3704, 2003.[Abstract/Free Full Text]
  12. Rowe M., Peng-Pilon M., Huen D. S., Hardy R., Croom-Carter D., Lundgren E., Rickinson A. B. Upregulation of bcl-2 by the Epstein-Barr virus latent membrane protein LMP1: a B-cell-specific response that is delayed relative to NF-{kappa}B activation and to induction of cell surface markers. J. Virol., 68: 5602-5612, 1994.[Abstract/Free Full Text]
  13. Wang F., Gregory C., Sample C., Rowe M., Liebowitz D., Murray R., Rickinson A., Kieff E. Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23. J. Virol., 64: 2309-2318, 1990.[Abstract/Free Full Text]
  14. Wang F., Gregory C. D., Rowe M., Rickinson A. B., Wang D., Birkenbach M., Kikutani H., Kishimoto T., Kieff E. Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23. Proc. Natl. Acad. Sci. USA, 84: 3452-3456, 1987.[Abstract/Free Full Text]
  15. Liebowitz D., Kieff E. Epstein-Barr virus latent membrane protein: induction of B-cell activation antigens and membrane patch formation does not require vimentin. J. Virol., 63: 4051-4054, 1989.[Abstract/Free Full Text]
  16. Laherty C. D., Hu H. M., Opipari A. W., Wang F., Dixit V. M. The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expression by activating nuclear factor {kappa}B. J. Biol. Chem., 267: 24157-24160, 1992.[Abstract/Free Full Text]
  17. Miller W. E., Earp H. S., Raab-Traub N. The Epstein-Barr virus latent membrane protein 1 induces expression of the epidermal growth factor receptor. J. Virol., 69: 4390-4398, 1995.[Abstract]
  18. He Z., Xin B., Yang X., Chan C., Cao L. Nuclear factor-{kappa}B activation is involved in LMP1-mediated transformation and tumorigenesis of rat-1 fibroblasts. Cancer Res., 60: 1845-1848, 2000.[Abstract/Free Full Text]
  19. Ghosh S., Karin M. Missing pieces in the NF-{kappa}B puzzle. Cell, 109 (Suppl.): S81-S96, 2002.
  20. Mayo M. W., Baldwin A. S. The transcription factor NF-{kappa}B: control of oncogenesis and cancer therapy resistance. Biochim. Biophys. Acta, 1470: M55-M62, 2000.[Medline]
  21. Mercurio F., DiDonato J. A., Rosette C., Karin M. p105 and p98 precursor proteins play an active role in NF-{kappa}B-mediated signal transduction. Genes Dev., 7: 705-718, 1993.[Abstract/Free Full Text]
  22. Naumann M., Wulczyn F. G., Scheidereit C. The NF-{kappa}B precursor p105 and the proto-oncogene product Bcl-3 are I{kappa}B molecules and control nuclear translocation of NF-{kappa}B. EMBO J., 12: 213-222, 1993.[Medline]
  23. Liou H. C., Nolan G. P., Ghosh S., Fujita T., Baltimore D. The NF-{kappa}B p50 precursor, p105, contains an internal I{kappa}B-like inhibitor that preferentially inhibits p50. EMBO J., 11: 3003-3009, 1992.[Medline]
  24. Hatada E. N., Nieters A., Wulczyn F. G., Naumann M., Meyer R., Nucifora G., McKeithan T. W., Scheidereit C. The ankyrin repeat domains of the NF-{kappa}B precursor p105 and the protooncogene bcl-3 act as specific inhibitors of NF-{kappa}B DNA binding. Proc. Natl. Acad. Sci. USA, 89: 2489-2493, 1992.[Abstract/Free Full Text]
  25. Bours V., Burd P. R., Brown K., Villalobos J., Park S., Ryseck R. P., Bravo R., Kelly K., Siebenlist U. A novel mitogen-inducible gene product related to p50/p105-NF-{kappa}B participates in transactivation through a {kappa}B site. Mol. Cell. Biol., 12: 685-695, 1992.[Abstract/Free Full Text]
  26. Fan C. M., Maniatis T. Generation of p50 subunit of NF-{kappa}B by processing of p105 through an ATP-dependent pathway. Nature (Lond.), 354: 395-398, 1991.[Medline]
  27. Naumann M., Nieters A., Hatada E. N., Scheidereit C. NF-{kappa}B precursor p100 inhibits nuclear translocation and DNA binding of NF-{kappa}B/rel-factors. Oncogene, 8: 2275-2281, 1993.[Medline]
  28. Salmeron A., Janzen J., Soneji Y., Bump N., Kamens J., Allen H., Ley S. C. Direct phosphorylation of NF-{kappa}B1 p105 by the I{kappa}B kinase complex on serine 927 is essential for signal-induced p105 proteolysis. J. Biol. Chem., 276: 22215-22222, 2001.[Abstract/Free Full Text]
  29. Heissmeyer V., Krappmann D., Wulczyn F. G., Scheidereit C. NF-{kappa}B p105 is a target of I{kappa}B kinases and controls signal induction of Bcl-3-p50 complexes. EMBO J., 18: 4766-4778, 1999.[Medline]
  30. Xiao G., Cvijic M. E., Fong A., Harhaj E. W., Uhlik M. T., Waterfield M., Sun S. C. Retroviral oncoprotein Tax induces processing of NF-{kappa}B2/p100 in T cells: evidence for the involvement of IKK{alpha}. EMBO J., 20: 6805-6815, 2001.[Medline]
  31. Bours V., Franzoso G., Azarenko V., Park S., Kanno T., Brown K., Siebenlist U. The oncoprotein Bcl-3 directly transactivates through {kappa}B motifs via association with DNA-binding p50B homodimers. Cell, 72: 729-739, 1993.[Medline]
  32. Nolan G. P., Fujita T., Bhatia K., Huppi C., Liou H. C., Scott M. L., Baltimore D. The bcl-3 proto-oncogene encodes a nuclear I{kappa}B-like molecule that preferentially interacts with NF-{kappa}B p50 and p52 in a phosphorylation-dependent manner. Mol. Cell. Biol., 13: 3557-3566, 1993.[Abstract/Free Full Text]
  33. Rayet B., Gelinas C. Aberrant rel/nfkb genes and activity in human cancer. Oncogene, 18: 6938-6947, 1999.[Medline]
  34. Paine E., Scheinman R. I., Baldwin A. S., Jr., Raab-Traub N. Expression of LMP1 in epithelial cells leads to the activation of a select subset of NF-{kappa}B/Rel family proteins. J. Virol., 69: 4572-4576, 1995.[Abstract]
  35. Cogswell P. C., Guttridge D. C., Funkhouser W. K., Baldwin A. S., Jr. Selective activation of NF-{kappa}B subunits in human breast cancer: potential roles for NF-{kappa}B2/p52 and for Bcl-3. Oncogene, 19: 1123-1131, 2000.[Medline]
  36. Westerheide S. D., Mayo M. W., Anest V., Hanson J. L., Baldwin A. S., Jr. The putative oncoprotein Bcl-3 induces cyclin D1 to stimulate G1 transition. Mol. Cell. Biol., 21: 8428-8436, 2001.[Abstract/Free Full Text]
  37. Kurland J. F., Kodym R., Story M. D., Spurgers K. B., McDonnell T. J., Meyn R. E. NF-{kappa}B1 (p50) homodimers contribute to transcription of the bcl-2 oncogene. J. Biol. Chem., 276: 45380-45386, 2001.[Abstract/Free Full Text]
  38. Baldassarre F., Mallardo M., Mezza E., Scala G., Quinto I. Regulation of NF-{kappa}B through the nuclear processing of p105 (NF-{kappa}B1) in Epstein-Barr virus-immortalized B cell lines. J. Biol. Chem., 270: 31244-31248, 1995.[Abstract/Free Full Text]
  39. Busson P., Ganem G., Flores P., Mugneret F., Clausse B., Caillou B., Braham K., Wakasugi H., Lipinski M., Tursz T. Establishment and characterization of three transplantable EBV-containing nasopharyngeal carcinomas. Int. J. Cancer, 42: 599-606, 1988.[Medline]
  40. Bundy D. L., McKeithan T. W. Diverse effects of BCL3 phosphorylation on its modulation of NF-{kappa}B p52 homodimer binding to DNA. J. Biol. Chem., 272: 33132-33139, 1997.[Abstract/Free Full Text]
  41. Zhong H., May M. J., Jimi E., Ghosh S. The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/p300 or HDAC-1. Mol. Cell, 9: 625-636, 2002.[Medline]
  42. Vancurova I., Wu R., Miskolci V., Sun S. Increased p50/p50 NF-{kappa}B activation in human papillomavirus type 6- or type 11-induced laryngeal papilloma tissue. J. Virol., 76: 1533-1536, 2002.[Abstract/Free Full Text]
  43. Miller W. E., Raab-Traub N. The EGFR as a target for viral oncoproteins. Trends Microbiol., 7: 453-458, 1999.[Medline]
  44. Budunova I. V., Perez P., Vaden V. R., Spiegelman V. S., Slaga T. J., Jorcano J. L. Increased expression of p50-NF-{kappa}B and constitutive activation of NF-{kappa}B transcription factors during mouse skin carcinogenesis. Oncogene, 18: 7423-7431, 1999.[Medline]
  45. van Hogerlinden M., Rozell B. L., Ahrlund-Richter L., Toftgard R. Squamous cell carcinomas and increased apoptosis in skin with inhibited Rel/nuclear factor-{kappa}B signaling. Cancer Res., 59: 3299-3303, 1999.[Abstract/Free Full Text]
  46. Seitz C. S., Lin Q., Deng H., Khavari P. A. Alterations in NF-{kappa}B function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-{kappa}B. Proc. Natl. Acad. Sci. USA, 95: 2307-2312, 1998.[Abstract/Free Full Text]
  47. Dajee M., Lazarov M., Zhang J. Y., Cai T., Green C. L., Russell A. J., Marinkovich M. P., Tao S., Lin Q., Kubo Y., Khavari P. A. NF-{kappa}B blockade and oncogenic Ras trigger invasive human epidermal neoplasia. Nature (Lond.), 421: 639-643, 2003.[Medline]
  48. Mayo M. W., Wang C. Y., Cogswell P. C., Rogers-Graham K. S., Lowe S. W., Der C. J., Baldwin A. S., Jr. Requirement of NF-{kappa}B activation to suppress p53-independent apoptosis induced by oncogenic Ras. Science (Wash. DC), 278: 1812-1815, 1997.[Abstract/Free Full Text]
  49. Seitz C. S., Deng H., Hinata K., Lin Q., Khavari P. A. Nuclear factor {kappa}B subunits induce epithelial cell growth arrest. Cancer Res., 60: 4085-4092, 2000.[Abstract/Free Full Text]
  50. Knecht H., Berger C., McQuain C., Rothenberger S., Bachmann E., Martin J., Esslinger C., Drexler H. G., Cai Y. C., Quesenberry P. J., Odermatt B. F. Latent membrane protein 1 associated signaling pathways are important in tumor cells of Epstein-Barr virus negative Hodgkin’s disease. Oncogene, 18: 7161-7167, 1999.[Medline]
  51. Emmerich F., Meiser M., Hummel M., Demel G., Foss H. D., Jundt F., Mathas S., Krappmann D., Scheidereit C., Stein H., Dorken B. Overexpression of I{kappa}B{alpha} without inhibition of NF-{kappa}B activity and mutations in the I{kappa}B{alpha} gene in Reed-Sternberg cells. Blood, 94: 3129-3134, 1999.[Abstract/Free Full Text]
  52. Krappmann D., Emmerich F., Kordes U., Scharschmidt E., Dorken B., Scheidereit C. Molecular mechanisms of constitutive NF-{kappa}B/Rel activation in Hodgkin/Reed-Sternberg cells. Oncogene, 18: 943-953, 1999.[Medline]
  53. Au W. Y., Horsman D. E., Ohno H., Klasa R. J., Gascoyne R. D. Bcl-3/IgH translocation (14;19)(q32;q13) in non-Hodgkin’s lymphomas. Leuk. Lymphoma, 43: 813-816, 2002.[Medline]
  54. Caamano J. H., Perez P., Lira S. A., Bravo R. Constitutive expression of Bc1–3 in thymocytes increases the DNA binding of NF-{kappa}B1 (p50) homodimers in vivo. Mol. Cell. Biol., 16: 1342-1348, 1996.[Abstract]
  55. Brasier A. R., Lu M., Hai T., Lu Y., Boldogh I. NF-{kappa}B-inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-{kappa}B1 residence. J. Biol. Chem., 276: 32080-32093, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Virol.Home page
C. Demetriades and G. Mosialos
The LMP1 Promoter Can Be Transactivated Directly by NF-{kappa}B
J. Virol., May 15, 2009; 83(10): 5269 - 5277.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Johansson, A. Jansson, U. Ruetschi, and L. Rymo
Nuclear Factor-{kappa}B Binds to the Epstein-Barr Virus LMP1 Promoter and Upregulates Its Expression
J. Virol., February 1, 2009; 83(3): 1393 - 1401.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y.-M. Kim, N. Sharma, and J. K. Nyborg
The Proto-Oncogene Bcl3, Induced by Tax, Represses Tax-Mediated Transcription via p300 Displacement from the Human T-Cell Leukemia Virus Type 1 Promoter
J. Virol., December 1, 2008; 82(23): 11939 - 11947.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S.-H. Kuo, P.-Y. Yeh, L.-T. Chen, M.-S. Wu, C.-W. Lin, K.-H. Yeh, Y.-S. Tzeng, J.-Y. Chen, P.-N. Hsu, J.-T. Lin, et al.
Overexpression of B cell-activating factor of TNF family (BAFF) is associated with Helicobacter pylori-independent growth of gastric diffuse large B-cell lymphoma with histologic evidence of MALT lymphoma
Blood, October 1, 2008; 112(7): 2927 - 2934.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. H.Y. Shair, C. I. Schnegg, and N. Raab-Traub
EBV Latent Membrane Protein 1 Effects on Plakoglobin, Cell Growth, and Migration
Cancer Res., September 1, 2008; 68(17): 6997 - 7005.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C.-P. Kung and N. Raab-Traub
Epstein-Barr Virus Latent Membrane Protein 1 Induces Expression of the Epidermal Growth Factor Receptor through Effects on Bcl-3 and STAT3
J. Virol., June 1, 2008; 82(11): 5486 - 5493.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Takami, H. Nakagami, R. Morishita, T. Katsuya, H. Hayashi, M. Mori, H. Koriyama, Y. Baba, O. Yasuda, H. Rakugi, et al.
Potential Role of CYLD (Cylindromatosis) as a Deubiquitinating Enzyme in Vascular Cells
Am. J. Pathol., March 1, 2008; 172(3): 818 - 829.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. J. Thornburg and N. Raab-Traub
Induction of Epidermal Growth Factor Receptor Expression by Epstein-Barr Virus Latent Membrane Protein 1 C-Terminal-Activating Region 1 Is Mediated by NF-{kappa}B p50 Homodimer/Bcl-3 Complexes
J. Virol., December 1, 2007; 81(23): 12954 - 12961.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K.-M. Chen, T. E. Spratt, B. A. Stanley, D. A. De Cotiis, M. C. Bewley, J. M. Flanagan, D. Desai, A. Das, E. S. Fiala, S. Amin, et al.
Inhibition of Nuclear Factor-{kappa}B DNA Binding by Organoselenocyanates through Covalent Modification of the p50 Subunit
Cancer Res., November 1, 2007; 67(21): 10475 - 10483.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. A. Mainou, D. N. Everly Jr., and N. Raab-Traub
Unique Signaling Properties of CTAR1 in LMP1-Mediated Transformation
J. Virol., September 15, 2007; 81(18): 9680 - 9692.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Dai, R. A. Phillips, and S. A. Ahmed
Despite Inhibition of Nuclear Localization of NF-{kappa}B p65, c-Rel, and RelB, 17-beta Estradiol Up-Regulates NF-{kappa}B Signaling in Mouse Splenocytes: The Potential Role of Bcl-3
J. Immunol., August 1, 2007; 179(3): 1776 - 1783.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. V. Yang, A. K. Sood, M. Chen, Y. Li, T. D. Eubank, C. B. Marsh, S. Jewell, N. A. Flavahan, C. Morrison, P.-E. Yeh, et al.
Norepinephrine Up-regulates the Expression of Vascular Endothelial Growth Factor, Matrix Metalloproteinase (MMP)-2, and MMP-9 in Nasopharyngeal Carcinoma Tumor Cells
Cancer Res., November 1, 2006; 66(21): 10357 - 10364.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Gao, D. L. Dai, M. Martinka, and G. Li
Prognostic Significance of Nuclear Factor-{kappa}B p105/p50 in Human Melanoma and Its Role in Cell Migration.
Cancer Res., September 1, 2006; 66(17): 8382 - 8388.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. A. Mainou and N. Raab-Traub
LMP1 Strain Variants: Biological and Molecular Properties.
J. Virol., July 1, 2006; 80(13): 6458 - 6468.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. Kashatus, P. Cogswell, and A. S. Baldwin
Expression of the Bcl-3 proto-oncogene suppresses p53 activation
Genes & Dev., January 15, 2006; 20(2): 225 - 235.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Y. Yeh, S.-H. Kuo, K.-H. Yeh, S.-E. Chuang, C.-H. Hsu, W. C. Chang, H.-I Lin, M. Gao, and A.-L. Cheng
A Pathway for Tumor Necrosis Factor-{alpha}-induced Bcl10 Nuclear Translocation: Bcl10 IS UP-REGULATED BY NF-{kappa}B AND PHOSPHORYLATED BY Akt1 AND THEN COMPLEXES WITH Bcl3 TO ENTER THE NUCLEUS
J. Biol. Chem., January 6, 2006; 281(1): 167 - 175.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. J. Serio, K. V. Reddy, and T. D. Bigby
Lipopolysaccharide induces 5-lipoxygenase-activating protein gene expression in THP-1 cells via a NF-{kappa}B and C/EBP-mediated mechanism
Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1125 - C1133.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Guan, S. Hou, and R. P. Ricciardi
DNA Binding of Repressor Nuclear Factor-{kappa}B p50/p50 Depends on Phosphorylation of Ser337 by the Protein Kinase A Catalytic Subunit
J. Biol. Chem., March 18, 2005; 280(11): 9957 - 9962.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Morrison, M. L. Gulley, R. Pathmanathan, and N. Raab-Traub
Differential Signaling Pathways Are Activated in the Epstein-Barr Virus-Associated Malignancies Nasopharyngeal Carcinoma and Hodgkin Lymphoma
Cancer Res., August 1, 2004; 64(15): 5251 - 5260.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thornburg, N. J.
Right arrow Articles by Raab-Traub, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thornburg, N. J.
Right arrow Articles by Raab-Traub, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online