| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
B p50 Homodimer/Bcl-3 Complexes in Nasopharyngeal Carcinoma
1 Department of Microbiology-Immunology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina;
2 Subang Jaya Medical Centre, Selangor DE, Malaysia; and
3 Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina
| ABSTRACT |
|---|
|
|
|---|
B. In epithelial cells, two regions of LMP1 induce specific forms of NF-
B. COOH-terminal activating region 2 only activates p52/p65 dimers, whereas COOH-terminal activating region 1 activates p50/p50, p50/p52, and p52/p65 dimers and also uniquely up-regulates the epidermal growth factor receptor (EGFR) at the mRNA level. Deregulation of specific NF-
B members is associated with the development of many cancers. In this study, the status of NF-
B activation was investigated in NPC to determine which NF-
B dimers may contribute to the development of NPC. Electrophoretic mobility shift assay, immunoblot, ELISA, and immunohistochemistry data demonstrate that in NPC, NF-
B p50 homodimers are specifically activated, and this activation is not dependent on LMP1 expression. Coimmunoprecipitation assays indicate that homodimers are bound to the transcriptional coactivator Bcl-3, and chromatin immunoprecipitation indicates that this complex is bound to NF-
B consensus motifs within the egfr promoter in NPC. The discrete yet striking NF-
B p50 activation in NPC suggests that p50/p50 homodimers may be important factors in the development of NPC and may contribute to oncogenesis through transcriptional up-regulation of target genes through their interaction with Bcl-3. | INTRODUCTION |
|---|
|
|
|---|
LMP1 is an EBV protein that is essential for EBV-induced B-lymphocyte transformation (2)
. It is expressed in all EBV-associated malignancies, except Burkitts lymphoma, and is the EBV oncogene because it can transform rodent fibroblasts and is tumorigenic in nude mice (3, 4, 5, 6, 7, 8, 9)
. LMP1 acts as a constitutively active TNF receptor and activates cellular signaling pathways such as c-Jun-NH2-terminal kinase, cdc42, Akt, and NF-
B (1
, 10
, 11) . Through these signaling pathways, LMP1 expression results in transcriptional up-regulation of cellular genes such as icam-1, cd80, cd23, cd54, bcl-2, traf1, a20, and egfr (12, 13, 14, 15, 16, 17)
. In addition, LMP1-mediated NF-
B activation is necessary for LMP1-induced fibroblast transformation and B-cell transformation (1
, 18)
.
NF-
B is a family of transcription factors that regulates a wide variety of biological processes including inflammation, apoptosis, cell cycle control, and cell migration (19
, 20)
. The mammalian NF-
B family of transcription factors consists of five members, p65 (RelA), c-Rel, RelB, p50, and p52, all of which contain a Rel homology domain. The transcription factors form dimers among themselves and bind DNA at NF-
B consensus sites. NF-
B activation is tightly regulated by the I
B family of proteins (19
, 20)
. The mammalian I
B family of proteins consists of seven members, all of which have a series of ankyrin repeats responsible for protein-protein interactions. The mammalian I
B proteins include p105 (NF
B1, the p50 precursor), p100 (NF
B2, the p52 precursor), I
B
, I
Bß, I
B
, I
B
, and Bcl-3. I
B
regulates classical NF-
B, which consists of a p50/p65 heterodimer. Under normal conditions, the p50/p65 heterodimer is sequestered in the cytosol through an interaction with I
B
. When a cell receives an extracellular stimulus, such as TNF binding to its receptor, a signaling cascade is activated that results in activation of the IKK complex. IKK phosphorylates I
B
, which targets it for ubiquitination and degradation by the proteasome. Degradation of I
B
releases the p50/p65 heterodimer, so it is able to translocate to the nucleus, bind its target DNA sequence, and initiate transcription of target genes (19
, 20)
. Unlike activation of classical NF-
B, activation of p52 or p50 also involves their ability to bind their respective precursor proteins, p100 and p105 (21, 22, 23, 24, 25, 26)
. Binding to their precursor proteins can sequester p52 and p50 in the cytosol (21
, 23
, 24
, 27)
. In a signaling cascade that involves activation of IKK, p100 and p105 can be phosphorylated and partially cleaved to yield the product proteins p52 and p50, respectively (28, 29, 30)
. This allows nuclear translocation of p50 and p52 and binding to target DNA sequences. Neither p50 nor p52 has transactivation domains. However, both homodimers can bind the I
B family member Bcl-3 that can provide a transactivation function (31
, 32)
.
Deregulation of specific NF-
B members is associated with the development of many cancers (33)
. Aberrant NF-
B and I
B expression is detected in hematopoietic tumors and solid tumors alike in the form of overexpression, chromosomal rearrangements, and mutations. For example, Bcl-3 is overexpressed in B-cell chronic lymphocytic leukemia and B-cell non-Hodgkins lymphoma (33)
. I
B
is often mutated or truncated in EBV-negative Hodgkins disease (33)
. p105/50 is often overexpressed in non-small cell lung carcinoma and colon, prostate, breast, bone, and brain cancer cell lines, and p100/p52 is frequently overexpressed in breast and colon carcinomas (33)
.
The EBV LMP1-activated forms of NF-
B and their functions are necessary for B-cell transformation (1)
. In epithelial cells, two regions of LMP1 induce specific forms of NF-
B (34)
. CTAR2 only activates p52/p65 dimers. CTAR1 activates p50/p50, p50/p52, and p52/p65 dimers and also uniquely up-regulates the EGFR at the mRNA level (17
, 34)
. It has been reported previously that p52 homodimers are selectively activated in breast cancers and that p52 activation is coupled with Bcl-3 expression (35)
. It has also been reported that p52 homodimers in combination with Bcl-3 expression uniquely up- regulate cyclin D1 expression and that p50 homodimers uniquely up-regulate bcl-2 expression (36
, 37)
. These data indicate that dimer specificity may exist with distinct biological functions.
In this study, NF-
B activation was analyzed in NPC to determine which NF-
B dimers may play a role in the development of NPC. In NPC, NF-
B p50 homodimers were specifically activated, and this activation was not necessarily dependent on LMP1 expression. Homodimers were bound to the transcriptional coactivator Bcl-3, and the complex was bound to NF-
B consensus motifs within the egfr promoter (38)
. These data indicate that p50 homodimers may be transcriptionally active in NPC and may play an essential role in tumor development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Extracts and Western Blots.
Tumor and normal tissue were pulverized using a B. Braun Mikro-Dismembrator II. Pulverized tissue was washed once with cold PBS, and cells were lysed with radioimmunoprecipitation assay buffer supplemented with protease and phosphatase inhibitor mixtures (Sigma). Alternatively, cells were separated into nuclear and cytosolic fractions as described below. Equal amounts of protein were used for SDS-PAGE and Western blotting. Primary antibodies used for Western blots include anti-p50, anti-p52, anti-cRel, anti-RelB, anti-
-actin, anti-Bcl-3 (Santa Cruz Biotechnology), and anti-p65 (Rockland). Secondary antibodies used were horseradish peroxidase-conjugated antimouse and antirabbit (Amersham Pharmacia) and antigoat (DAKO). Blots were developed using Pierce Supersignal West Pico Chemiluminescence system. Bcl-3 antibody was preincubated with a Bcl-3-specific peptide for 2 h at room temperature as directed by the manufacturer (Santa Cruz Biotechnology) before application to the Western blot to confirm the specificity of the antibody.
Nuclear and Cytosolic Separation.
Pulverized tissue was washed once with cold PBS. Tissue cells were lysed by incubation in a hypotonic buffer [20 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and protease and phosphatase inhibitor mixtures (Sigma)] for 15 min on ice followed by addition of NP40 to a final concentration of 1%. Nuclei were pelleted by low-speed centrifugation at 1200 rpm for 10 min at 4°C. The supernatant was collected as the cytosolic fraction. The crude nuclear pellet was further purified using Optiprep (Sigma) reagent as directed by the manufacturer. Briefly, crude nuclei were resuspended in a 25% solution of Optiprep and underlaid with 30% and 35% layers of Optiprep. The gradient was spun for 20 min at 10,000 x g. The band of nuclei was collected from the 30%/35% interface, washed, pelleted, and lysed with nuclear extraction buffer [20 mM Tris (pH 8.0), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, protease inhibitor mixture (Sigma), and phosphatase inhibitor mixture (Sigma)] with the salt concentration adjusted to 400 mM with 5 M NaCl. Insoluble nuclear material was pelleted at high speed for 10 min.
EMSA.
EMSAs were performed as described previously (35)
. Briefly, an oligonucleotide (UV21) of the NF-
B site from the H-2Kb gene (CAGGGCTGGGGATTCCCCATCTCCCACAGTTTCACTTC) was labeled with [
-32P]dCTP using the Klenow fragment from DNA polymerase I. Two µg of nuclear extract or 20 µg of cytosolic extract were incubated with radiolabeled probe. For competition experiments, a mutant probe (UV21M) was made by mutating the underlined NF-
B consensus site to CAGGGCTGCCCATTCGGGATCTCCACAGTTTCACTTC. Nuclear extracts and hot UV21 or UV21M were incubated in the presence of a 10-fold molar excess of cold probe or double-stranded NF-
B or AP1 oligonucleotides (Promega). For supershift assays, antibody (0.55 µg) was incubated with extracts, no extracts, or purified human recombinant p50 (Promega) before addition of radiolabeled probe. Antibodies used were the same as those described for Western blots.
ELISA.
Levels of p50 and p65 in nuclear lysates were measured using Clontech Mercury Transfactor ELISA kits as described by the manufacturer.
Immunoprecipitations.
Whole cell lysates for immunoprecipitation were made in Tris NaCl EDTA buffer with 0.5% CHAPS. Whole cell or nuclear lysates (75 µg) were precleared with Gamma-bind plus Sepharose (Amersham Pharmacia) for 2 h at 4°C. Precleared lysates were immunoprecipitated with 5 µl of anti-p50 or anti-Bcl-3 antibody overnight at 4°C. Immunoprecipitations were incubated with Gamma-bind plus Sepharose for 2 h at 4°C. Immunoprecipitations were washed two times, resuspended in SDS-PAGE sample buffer, boiled, and used for SDS-PAGE and Western blots.
Immunohistochemistry.
Paraffin-embedded sections were deparaffinized with Histo-clear (National Diagnostics) and rehydrated with graded alcohol treatments. Antigen retrieval was carried out by microwave treatment for 15 min in citrate buffer (pH 6.0). Sections were permeabilized with methanol and blocked in 5% normal goat serum in TBS (pH 7.0). Sections were incubated with primary antibody or the corresponding isotype control (CS1-4 or mouse IgG1, DAKO; anti-p50 or rabbit IgG, Santa Cruz Biotechnology; and anti-Bcl-3 or mouse IgG2A, Novo Castra) for 3 h at room temperature in a humidified chamber. After washing, sections were incubated with alkaline phosphatase-labeled polymer conjugated to antimouse and antirabbit antibodies (DAKO EnVision Systems). The slides were incubated in the substrate-chromogen 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (DAKO) supplemented with levamisole (DAKO) and counterstained with nuclear fast red (DAKO). Slides were then dehydrated and mounted.
ChIP.
Snap-frozen tissue was pulverized using a B. Braun Mikro-Dismembrator II. Pulverized tissue was resuspended in 50 ml of DMEM and cross-linked in 1% formaldehyde for 15 min at room temperature. The cross-linking reaction was quenched with 120 mM glycine, and the tumor slurry was pelleted and washed with cold PBS. The tumor pellet was lysed in radioimmunoprecipitation assay buffer [10 mM Tris-HCl (pH 8.0), 140 mM NaCl, 1% Triton X-100, 0.1% SDS, and 1% deoxycholic acid] spiked with protease inhibitor mixture (Sigma) for 30 min at 4°C. Lysates were sonicated with a Misonix XL-2020 Sonicator on power setting 3 for six cycles with 6-s pulses and 4-s rests to yield an average DNA size of approximately 500 bp. The lysates were clarified, and they were precleared with 300 µl of Gamma-bind plus Sepharose (Amersham Pharmacia) for 2 h at 4°C. The beads were pelleted, the supernatant was split into equal volumes, and either anti-p50 or anti-Bcl-3 was added (Santa Cruz Biotechnology) and incubated overnight at 4°C. Immunoprecipitates were then incubated with Gamma-bind plus Sepharose and washed four times (5 min each), and DNA/protein was eluted from the beads with 1% SDS, 1x Tris EDTA at 65°C. The beads were pelleted, and the supernatant was saved. The cross-linking was reversed overnight at 65°C. The samples were then treated with proteinase K at 37°C for 2 h, LiCl was added, and DNA was phenol-chloroform purified, precipitated, pelleted, and resuspended in 20 µl. Purified DNA was used for PCR. Primer sequences designed to flank the NF-
B sites in the egfr promoter were 5'-GGGGACCCGAATAAAGGAGCAGTTT-3' and 5'-CTGAGGAGTTAATTTCCGAGAGGGG-3'. Taq polymerase (Promega) was used to amplify 300 ng of genomic template or 4 µl of ChIP product. PCR products were run on a 10% nondenaturing polyacrylamide gel and transferred to Hybond-N+ nucleic acid membrane (Amersham). An oligonucleotide probe was end-labeled with [
-32P]ATP using polynucleotide kinase. The probe was hybridized to the membrane in Rapid-hyb buffer (Amersham) as directed by the manufacturer, and developed by autoradiography.
| RESULTS |
|---|
|
|
|---|
B p50.
B activation in NPC, C15, C17, and C18 nuclear extracts were prepared for EMSA. Using a radiolabeled oligonucleotide probe (UV21) with the NF-
B consensus site from the MHC I promoter, a single complex was consistently detected in C15 and C17 but not C18, with higher levels of activated NF-
B in C15 (Fig. 1A)
B specific, C15 nuclear extracts were incubated with a radiolabeled probe with a mutated NF-
B consensus site (UV21M) and a panel of cold competitors. Incubation of radiolabeled UV21 and UV21M without lysate did not produce any complexes (Fig. 1B
B probe. The complex was not reduced with a 10-fold excess of cold UV21M (Fig. 1B
B specific. As expected, complexes were not detected after incubation of extract with UV21M and cold UV21M (Fig. 1B
B oligonucleotide (Promega; Fig. 1B
B specific.
|
B family members, a supershifted complex was only detected with anti-p50 antibody (Fig. 1C)
B p50.
|
B is constitutively activated in C15 and C17, but not in C18. Interestingly, C15 and C18 had readily detectable I
B
protein, whereas I
B
was not detected in C17 (Fig. 1E)
B
. These data suggest NF-
B p50 homodimers may be activated via different molecular mechanisms in NPC. In C15, it is likely that LMP1 has induced NF-
B, and without LMP1 in C17, the absence of I
B
is responsible for the activating signal. However in both NPCs, the result is primarily activation of p50 homodimers.
C15 and C17 Cytosolic Extracts Have Other NF-
B Family Members.
EMSA was performed using cytosolic extracts to determine whether C15 and C17 express only NF-
B p50 or if they express other family members with specific activation of p50. C15 and C17 each had three NF-
B complexes (Fig. 2A
, Lanes 1 and 2). Cytosolic extracts were supershifted with antibodies specific to NF-
B family members to determine the identity of the complexes. When cytosolic extracts were preincubated with anti-p50, the abundance of the bottom and middle complexes were slightly reduced (Fig. 2A
, Lanes 3 and 4). These complexes, therefore, likely contain p50 or its precursor, p105. The abundance of the middle complex was also reduced with an accompanying supershifted band when preincubated with anti-p65, indicating that the middle complex has both p50 and p65 (Fig. 2A
, Lanes 13 and 16). The top complex was eliminated by incubation with antibodies to p52, Bcl-3, and RelB, and a supershift was observed with the antibody to RelB, indicating that the complex consists of p52, Bcl-3, and RelB (Fig. 2A
, Lanes 510). These data suggest that C15 and C17 have multiple cytosolic NF-
B complexes.
To confirm the location of NF-
B family members in C15 and C17, Western blot analyses were performed on nuclear and cytosolic extracts (Fig. 2B)
. Normal human adenoid mucosal tissue was used as a normal tissue control. Nuclear p105 or p50 was not detected in normal tissue, whereas C15 and C17 had high levels of nuclear p105. Normal tissue had high levels of cytosolic p105 and p50 (Fig. 2C)
. Possible cytosolic contamination of nuclear extracts was eliminated because the adenoid mucosal tissue, which was fractionated in parallel with C15 and C17, completely lacked nuclear p105 but retained considerable amounts of cytosolic p105 (Fig. 2B)
. The location of other NF-
B family members was also confirmed by Western blot analysis of nuclear and cytosolic fractions, with actin used as a loading control (Fig. 2C)
. Low levels of p65 were detected in C15 and C17 nuclear extracts with abundant p65 in the cytosol, confirming the EMSA data (Fig. 2C)
. RelB and cRel were not detected in either C15 or C17 nuclear extracts, but cRel was readily detectable in C15 and C17 cytosolic extracts (Fig. 2C)
. As compared with C17, C15 had p100 and increased levels of cytosolic RelB, which are both transcriptionally regulated by NF-
B. Again, this suggests a specific activation and translocation of NF-
B p50 homodimers in NPC.
Tumor Tissues Have More Nuclear p50 than Normal Tissue.
Several different types of normal human tissue were subjected to EMSA and supershift analysis to compare NF-
B activation in tumor tissue versus normal human tissue. Normal human adenoid mucosal tissue was separated from lymphoid tissue. Because C15 and C17 tumors are of epithelial origin, adenoid mucosal tissue may provide the most relevant normal tissue control. Whole tonsil tissue and normal nasopharynx tissue were also used as controls. All normal tissues had dramatically lower levels of nuclear NF-
B than NPC tumors, although the lysates contained readily detectable actin (Fig. 3A)
. Activated NF-
B was not detected in adenoid mucosal tissue, whereas adenoid lymphoid tissue and whole tonsil tissue had low levels of activated NF-
B with one to three nuclear complexes. Normal nasopharynx had low levels of activated NF-
B with one nuclear complex. Some level of background NF-
B activation in tonsil and lymphoid tissue was to be expected because the tissue may have been chronically inflamed. At least one complex in each tissue with activated NF-
B was shifted with anti-p50 antibody.
|
B activation and, more specifically, levels of NF-
B p50 activation are significantly higher than those in normal epithelial tissues. Taken together, the EMSA, Western blot, and ELISA data all indicate that NF-
B p50 homodimers are the only form of nuclear NF-
B present in NPC, but not in normal epithelial tissue.
C15 Expresses High Levels of Bcl-3.
NF-
B p50 lacks a transactivation domain; however, when bound to Bcl-3, Bcl-3 promotes DNA binding and provides transactivation function to p50 homodimers. To determine whether the nuclear p50 homodimers in C15 and C17 may be transcriptionally active through the expression of Bcl-3, Western blot analysis was performed. Bcl-3 was detected in C15 and C17 whole cell lysates (Fig. 4A)
, with three bands detected in the Bcl-3 immunoblot. Preincubation with a Bcl-3-specific peptide provided by the manufacturer reduced the intensity of all three bands, indicating that all three bands are forms of Bcl-3 (Fig. 4A)
. Previous studies have indicated that Bcl-3 is highly phosphorylated, and the size of these bands was consistent with reported Bcl-3 phosphoforms (32
, 40)
.
|
Bcl-3 Coimmunoprecipitates with p50.
Whole cell lysates from C15, C17, and C18 were either directly loaded onto a SDS-PAGE gel or immunoprecipitated without antibody or with anti-Bcl-3 antibody and immunoblotted with anti-p50/p105 antibody to determine whether p50 homodimers are complexed with Bcl-3. In tumor lysates, p50 consistently immunoprecipitated with anti-Bcl-3 (Fig. 5A)
. To confirm the interaction between p50 and Bcl-3, Bcl-3 was immunoprecipitated with anti-p50/p105. All three Bcl-3-specific bands immunoprecipitated with anti-p50/p105 in the reverse immunoprecipitation (Fig. 5B)
. p50 is also known to bind the histone deacetylase HDAC1, and, when bound, the homodimers are transcriptionally inactive (41)
. Duplicate tumor lysates were either directly loaded onto a SDS-PAGE gel or immunoprecipitated without antibody or anti-HDAC1 and immunoblotted with anti-p50/p105 antibody. In contrast to Bcl-3, p50 did not immunoprecipitate with anti-HDAC1 (Fig. 5C)
. These data indicate that in NPC, p50 homodimers are not bound to the transcriptionally repressive HDAC1 but are bound to the transcriptionally activating Bcl-3, suggesting that the homodimers are functionally active.
|
|
|
B p50 homodimers and EGFR at the mRNA level (17)
. EGFR protein is abundant in C15, detectable in C17, and undetectable in C18 (Fig. 7A)
B binding sites within the egfr promoter (38)
. ChIP was used to determine whether, in NPC, p50 homodimers/Bcl-3 complexes are bound to the egfr promoter. Briefly, ground tumors were formaldehyde-cross-linked, lysed, sonicated, and immunoprecipitated with anti-p50 or anti-Bcl-3. Lysates were treated with proteinase K, and DNA was purified and subjected to PCR. Using an internal oligonucleotide probe, PCR products were subjected to Southern blot hybridization to increase the sensitivity and specificity of the assay. Primers were designed for the region of the egfr promoter that has three NF-
B consensus binding sites. PCR products from genomic DNA were sequenced to confirm the identity of the PCR products. Water served as a negative PCR control (Fig. 7B
B consensus sites within the egfr promoter immunoprecipitated with anti-p50 in C15 (Fig. 7B
B consensus sites within the egfr promoter also immunoprecipitated with anti-Bcl-3 in C15 (Fig. 7B
|
| DISCUSSION |
|---|
|
|
|---|
B p50 and the proto-oncogene Bcl-3 are complexed in NPC, and these complexes are bound to NF-
B sites within the egfr promoter. The activation of only one complex was unexpected because in epithelial cell lines, LMP1 activated three different dimer forms of NF-
B (34)
. Nf
b1 is overexpressed in the solid tumor, non-small cell lung carcinoma, and in colon, prostate, breast, bone, and brain cancer cell lines (33)
. In laryngeal papillomas, infected with human papilloma virus types 6 and 11, NF-
B is activated, and the p50 homodimer is the predominant dimer (42)
. Coincidentally, EGFR is overexpressed in papilloma-infected cells (43)
. Activation and overexpression of p50 within tumors and papillomas of similar cell types to those in NPC may suggest a cell type-dependent role for p50 in epithelial malignancies.
NF-
B appears to play a unique role in SCC. During mouse skin carcinogenesis studies, levels of p50 expression increase (44)
. A blockade in classical NF-
B activation, through expression of the super-repressor form of I
B
in murine skin, results in hyperplastic epithelium (45
, 46)
. In human epidermal tissue, a blockade in NF-
B also resulted in hyperplastic epithelium (46
, 47)
. When constitutively active Ras was coexpressed with a blockade in classical NF-
B, SCC developed, possibly through a mechanism that involves, in part, an increase in cyclin-dependent kinase 4 (47)
. In epidermal cells, expression of p65 resulted in a posttranscriptional decrease in cyclin- dependent kinase 4 (47)
. These data are in stark contrast to other studies that suggest that NF-
B is necessary for Ras-mediated oncogenesis in fibroblasts (48)
. In the epithelial cells of NPC, NF-
B activation may be necessary for oncogenesis, but classical NF-
B (p65/p50) may provide a block in proliferation (49)
. Thus, NF-
B p50/p50 homodimers may be able to provide an activating signal without the proliferative block that p65 imposes.
As confirmed by Western blot, p105 and p50 were the only detectable nuclear NF-
B family members in tumor nuclei. Notably, nuclear p105 has only been reported in one other publication, in which nuclear p105 was detected in EBV-infected B lymphocytes (38)
. This suggests that during EBV infection, NF-
B activation may involve nuclear transport of the normally cytosolic p105. Furthermore, p50 activation appeared to be independent of LMP1 expression and was activated in almost all examples of NPC, stressing the importance of p50 activation. This is similar to the status of NF-
B in Hodgkins lymphoma, where NF-
B is activated in EBV-positive and -negative samples via different molecular mechanisms (50, 51, 52)
. In Hodgkins lymphoma Reed-Sternberg cells, constitutively active NF-
B is necessary for proliferation and survival of the cells (50, 51, 52)
. This activation can occur by expression of LMP1 or by expression of nonfunctional I
B
(50, 51, 52)
. In the passaged tumor C15, NF-
B was activated in the presence of LMP1, and I
B
was expressed at wild-type levels. In the passaged tumor C17, NF-
B was activated in the absence of LMP1, but I
B
was not expressed. In primary NPC sections, p50 was activated in the absence of LMP1 in 5 of 10 samples. The status of I
B
was not examined in these samples, but a study of I
B
expression in relationship to LMP1 expression in primary NPC may be informative in the future.
Alone, p50 and p52 homodimers are transcriptionally inactive unless complexed with Bcl-3, and Bcl-3 is itself a proto-oncogene (31
, 32)
. Chromosomal rearrangement and overexpression of Bcl-3 are frequently detected in B-cell chronic lymphocytic leukemia and B-cell non-Hodgkins lymphoma (33
, 53)
. Expression of Bcl-3 in cells can increase proliferation, decrease the span of G1 phase, and up-regulate cyclin D1 (36)
. In this study, overexpression of Bcl-3 was found in passaged and primary NPC, suggesting that Bcl-3 may increase the proliferative capacity of NPC cells. Furthermore, it has been reported that Bcl-3 can help to increase nuclear levels of p50 and may aid in NF-
B dimer binding to DNA (54)
. Therefore, the very high levels of nuclear p50 in NPC and the strong binding of p50/p50 homodimers to DNA may be due, in part, to the expression of Bcl-3. Alternatively, Bcl-3 has been found to be transcriptionally regulated by NF-
B itself in an autoregulatory loop (55)
. Therefore, the high levels of Bcl-3 expression may reflect the high levels of NF-
B activation in NPC and contribute to the binding of p50 homodimers to the egfr promoter. Whereas neither Bcl-3 nor p50 has been directly implicated in transcriptional up-regulation of egfr, a recent study found that p50, but not other NF-
B family members, bound to four NF-
B consensus sites within the egfr promoter in vitro but did not transactivate the promoter. p50 homodimers have been specifically implicated in up-regulation of the bcl-2 promoter (37)
, whereas p52 homodimers were selectively activated in breast cancer, and, in conjunction with Bcl-3 expression, p52 homodimers can specifically transactivate the cyclin D1 promoter (35
, 36)
. These data support the hypothesis that dimer specificity exists among the NF-
B family members. It is likely that the DNA NF-
B binding sites, cell type, and other factors contribute to the specificity.
This study reveals that a very specific type of NF-
B activation occurs within NPC. The dominant NF-
B dimer is the p50/p50 homodimer, which is complexed with Bcl-3 and bound to the egfr promoter in vivo. Overexpression of p105/p50 has been detected in many cell lines derived from solid tumors and in non-small cell lung carcinoma, and it has been generally accepted that overexpression contributes to oncogenesis through dimerization with other subunits (33)
. The discrete yet striking NF-
B p50 activation in NPC suggests that p50/p50 homodimer may be an important factor in the development of NPC without the activation of other NF-
B family members. p50 homodimers may, instead, contribute to oncogenesis through transcriptional up-regulation of target genes through their interaction with Bcl-3.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Nancy Raab-Traub, Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7295. E-mail: nrt{at}med.unc.edu
4 The abbreviations used are: NPC, nasopharyngeal carcinoma; LMP1, latent membrane protein 1; NF, nuclear factor; TNF, tumor necrosis factor; CTAR, COOH-terminal activating region; EMSA, electrophoretic mobility shift assay; EGFR, epidermal growth factor receptor; IKK, I
B kinase; ChIP, chromatin immunoprecipitation; AP1, activator protein 1; SCC, squamous cell carcinoma. ![]()
Received 6/19/03. Revised 9/ 5/03. Accepted 9/11/03.
| REFERENCES |
|---|
|
|
|---|
B activation and to induction of cell surface markers. J. Virol., 68: 5602-5612, 1994.
B. J. Biol. Chem., 267: 24157-24160, 1992.
B activation is involved in LMP1-mediated transformation and tumorigenesis of rat-1 fibroblasts. Cancer Res., 60: 1845-1848, 2000.
B puzzle. Cell, 109 (Suppl.): S81-S96, 2002.
B: control of oncogenesis and cancer therapy resistance. Biochim. Biophys. Acta, 1470: M55-M62, 2000.[Medline]
B-mediated signal transduction. Genes Dev., 7: 705-718, 1993.
B precursor p105 and the proto-oncogene product Bcl-3 are I
B molecules and control nuclear translocation of NF-
B. EMBO J., 12: 213-222, 1993.[Medline]
B p50 precursor, p105, contains an internal I
B-like inhibitor that preferentially inhibits p50. EMBO J., 11: 3003-3009, 1992.[Medline]
B precursor p105 and the protooncogene bcl-3 act as specific inhibitors of NF-
B DNA binding. Proc. Natl. Acad. Sci. USA, 89: 2489-2493, 1992.
B participates in transactivation through a
B site. Mol. Cell. Biol., 12: 685-695, 1992.
B by processing of p105 through an ATP-dependent pathway. Nature (Lond.), 354: 395-398, 1991.[Medline]
B precursor p100 inhibits nuclear translocation and DNA binding of NF-
B/rel-factors. Oncogene, 8: 2275-2281, 1993.[Medline]
B1 p105 by the I
B kinase complex on serine 927 is essential for signal-induced p105 proteolysis. J. Biol. Chem., 276: 22215-22222, 2001.
B p105 is a target of I
B kinases and controls signal induction of Bcl-3-p50 complexes. EMBO J., 18: 4766-4778, 1999.[Medline]
B2/p100 in T cells: evidence for the involvement of IKK
. EMBO J., 20: 6805-6815, 2001.[Medline]
B motifs via association with DNA-binding p50B homodimers. Cell, 72: 729-739, 1993.[Medline]
B-like molecule that preferentially interacts with NF-
B p50 and p52 in a phosphorylation-dependent manner. Mol. Cell. Biol., 13: 3557-3566, 1993.
B/Rel family proteins. J. Virol., 69: 4572-4576, 1995.
B subunits in human breast cancer: potential roles for NF-
B2/p52 and for Bcl-3. Oncogene, 19: 1123-1131, 2000.[Medline]
B1 (p50) homodimers contribute to transcription of the bcl-2 oncogene. J. Biol. Chem., 276: 45380-45386, 2001.
B through the nuclear processing of p105 (NF-
B1) in Epstein-Barr virus-immortalized B cell lines. J. Biol. Chem., 270: 31244-31248, 1995.
B p52 homodimer binding to DNA. J. Biol. Chem., 272: 33132-33139, 1997.
B determines its association with CBP/p300 or HDAC-1. Mol. Cell, 9: 625-636, 2002.[Medline]
B activation in human papillomavirus type 6- or type 11-induced laryngeal papilloma tissue. J. Virol., 76: 1533-1536, 2002.
B and constitutive activation of NF-
B transcription factors during mouse skin carcinogenesis. Oncogene, 18: 7423-7431, 1999.[Medline]
B signaling. Cancer Res., 59: 3299-3303, 1999.
B function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-
B. Proc. Natl. Acad. Sci. USA, 95: 2307-2312, 1998.
B blockade and oncogenic Ras trigger invasive human epidermal neoplasia. Nature (Lond.), 421: 639-643, 2003.[Medline]
B activation to suppress p53-independent apoptosis induced by oncogenic Ras. Science (Wash. DC), 278: 1812-1815, 1997.
B subunits induce epithelial cell growth arrest. Cancer Res., 60: 4085-4092, 2000.
B
without inhibition of NF-
B activity and mutations in the I
B
gene in Reed-Sternberg cells. Blood, 94: 3129-3134, 1999.
B/Rel activation in Hodgkin/Reed-Sternberg cells. Oncogene, 18: 943-953, 1999.[Medline]
B1 (p50) homodimers in vivo. Mol. Cell. Biol., 16: 1342-1348, 1996.
B-inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-
B1 residence. J. Biol. Chem., 276: 32080-32093, 2001.This article has been cited by other articles:
![]() |
C. Demetriades and G. Mosialos The LMP1 Promoter Can Be Transactivated Directly by NF-{kappa}B J. Virol., May 15, 2009; 83(10): 5269 - 5277. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Johansson, A. Jansson, U. Ruetschi, and L. Rymo Nuclear Factor-{kappa}B Binds to the Epstein-Barr Virus LMP1 Promoter and Upregulates Its Expression J. Virol., February 1, 2009; 83(3): 1393 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Kim, N. Sharma, and J. K. Nyborg The Proto-Oncogene Bcl3, Induced by Tax, Represses Tax-Mediated Transcription via p300 Displacement from the Human T-Cell Leukemia Virus Type 1 Promoter J. Virol., December 1, 2008; 82(23): 11939 - 11947. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kuo, P.-Y. Yeh, L.-T. Chen, M.-S. Wu, C.-W. Lin, K.-H. Yeh, Y.-S. Tzeng, J.-Y. Chen, P.-N. Hsu, J.-T. Lin, et al. Overexpression of B cell-activating factor of TNF family (BAFF) is associated with Helicobacter pylori-independent growth of gastric diffuse large B-cell lymphoma with histologic evidence of MALT lymphoma Blood, October 1, 2008; 112(7): 2927 - 2934. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H.Y. Shair, C. I. Schnegg, and N. Raab-Traub EBV Latent Membrane Protein 1 Effects on Plakoglobin, Cell Growth, and Migration Cancer Res., September 1, 2008; 68(17): 6997 - 7005. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-P. Kung and N. Raab-Traub Epstein-Barr Virus Latent Membrane Protein 1 Induces Expression of the Epidermal Growth Factor Receptor through Effects on Bcl-3 and STAT3 J. Virol., June 1, 2008; 82(11): 5486 - 5493. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takami, H. Nakagami, R. Morishita, T. Katsuya, H. Hayashi, M. Mori, H. Koriyama, Y. Baba, O. Yasuda, H. Rakugi, et al. Potential Role of CYLD (Cylindromatosis) as a Deubiquitinating Enzyme in Vascular Cells Am. J. Pathol., March 1, 2008; 172(3): 818 - 829. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Thornburg and N. Raab-Traub Induction of Epidermal Growth Factor Receptor Expression by Epstein-Barr Virus Latent Membrane Protein 1 C-Terminal-Activating Region 1 Is Mediated by NF-{kappa}B p50 Homodimer/Bcl-3 Complexes J. Virol., December 1, 2007; 81(23): 12954 - 12961. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-M. Chen, T. E. Spratt, B. A. Stanley, D. A. De Cotiis, M. C. Bewley, J. M. Flanagan, D. Desai, A. Das, E. S. Fiala, S. Amin, et al. Inhibition of Nuclear Factor-{kappa}B DNA Binding by Organoselenocyanates through Covalent Modification of the p50 Subunit Cancer Res., November 1, 2007; 67(21): 10475 - 10483. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Mainou, D. N. Everly Jr., and N. Raab-Traub Unique Signaling Properties of CTAR1 in LMP1-Mediated Transformation J. Virol., September 15, 2007; 81(18): 9680 - 9692. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dai, R. A. Phillips, and S. A. Ahmed Despite Inhibition of Nuclear Localization of NF-{kappa}B p65, c-Rel, and RelB, 17-beta Estradiol Up-Regulates NF-{kappa}B Signaling in Mouse Splenocytes: The Potential Role of Bcl-3 J. Immunol., August 1, 2007; 179(3): 1776 - 1783. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Yang, A. K. Sood, M. Chen, Y. Li, T. D. Eubank, C. B. Marsh, S. Jewell, N. A. Flavahan, C. Morrison, P.-E. Yeh, et al. Norepinephrine Up-regulates the Expression of Vascular Endothelial Growth Factor, Matrix Metalloproteinase (MMP)-2, and MMP-9 in Nasopharyngeal Carcinoma Tumor Cells Cancer Res., November 1, 2006; 66(21): 10357 - 10364. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gao, D. L. Dai, M. Martinka, and G. Li Prognostic Significance of Nuclear Factor-{kappa}B p105/p50 in Human Melanoma and Its Role in Cell Migration. Cancer Res., September 1, 2006; 66(17): 8382 - 8388. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Mainou and N. Raab-Traub LMP1 Strain Variants: Biological and Molecular Properties J. Virol., July 1, 2006; 80(13): 6458 - 6468. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kashatus, P. Cogswell, and A. S. Baldwin Expression of the Bcl-3 proto-oncogene suppresses p53 activation Genes & Dev., January 15, 2006; 20(2): 225 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Yeh, S.-H. Kuo, K.-H. Yeh, S.-E. Chuang, C.-H. Hsu, W. C. Chang, H.-I Lin, M. Gao, and A.-L. Cheng A Pathway for Tumor Necrosis Factor-{alpha}-induced Bcl10 Nuclear Translocation: Bcl10 IS UP-REGULATED BY NF-{kappa}B AND PHOSPHORYLATED BY Akt1 AND THEN COMPLEXES WITH Bcl3 TO ENTER THE NUCLEUS J. Biol. Chem., January 6, 2006; 281(1): 167 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Serio, K. V. Reddy, and T. D. Bigby Lipopolysaccharide induces 5-lipoxygenase-activating protein gene expression in THP-1 cells via a NF-{kappa}B and C/EBP-mediated mechanism Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1125 - C1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Guan, S. Hou, and R. P. Ricciardi DNA Binding of Repressor Nuclear Factor-{kappa}B p50/p50 Depends on Phosphorylation of Ser337 by the Protein Kinase A Catalytic Subunit J. Biol. Chem., March 18, 2005; 280(11): 9957 - 9962. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Morrison, M. L. Gulley, R. Pathmanathan, and N. Raab-Traub Differential Signaling Pathways Are Activated in the Epstein-Barr Virus-Associated Malignancies Nasopharyngeal Carcinoma and Hodgkin Lymphoma Cancer Res., August 1, 2004; 64(15): 5251 - 5260. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |