Cancer Research AACR Conference on Molecular Diagnostics - 2008  Joint Metastasis Research Society-AACR Conference on Metastasis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, A.
Right arrow Articles by Aburatani, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, A.
Right arrow Articles by Aburatani, H.
[Cancer Research 63, 8629-8633, December 15, 2003]
© 2003 American Association for Cancer Research


Regular Articles

An Opposing View on WWOX Protein Function as a Tumor Suppressor

Akira Watanabe1, Yoshitaka Hippo1, Hirokazu Taniguchi1, Hiroko Iwanari3, Masakazu Yashiro4, Kosei Hirakawa4, Tatsuhiko Kodama2 and Hiroyuki Aburatani1

1 Genome Science Division and
2 Laboratory of Systems Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, Tokyo;
3 Perseus Proteomics, Inc., Tokyo; and
4 First Department of Surgery, Osaka City University Medical School, Osaka, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
WW domain-containing oxidoreductase (WWOX) is a candidate tumor suppressor gene. Because mutation or deletion in the coding region of WWOX is rarely found, it is speculated that the appearance of aberrant transcripts affects progression of various cancers. However, little is known about the role in these cancers of the WWOX protein. To characterize endogenous WWOX proteins, we analyzed WWOX expression using newly generated monoclonal antibodies. In immunoblot analysis of 49 cancer cell lines, only the normal form of the protein was detectable, although some of cell lines exhibited aberrant WWOX RNA transcripts. Accumulation of truncated proteins was observed by inhibiting proteasomal degradation with MG-132, whereas expression level of normal protein did not change, suggesting truncated proteins may be subjected to rapid degradation through proteasomal machinery. Immunohistochemistry for cancer cells demonstrated that WWOX protein levels are not decreased but rather elevated in gastric and breast carcinoma, challenging the notion of WWOX as a classical tumor suppressor. In noncancerous cells, WWOX was observed only in epithelial cells, including hormone-regulated cells such as Leydig cells, follicular cells, prostate epithelium, and mammary glands. Interestingly, restricted staining in nuclei was observed in some mammary gland cells while other epithelial cells exhibited localization of WWOX in cytoplasm. Nuclear localization of WWOX was also confirmed in confluent human fibroblast KMS-6, whereas WWOX was associated mainly with mitochondria before reaching confluence, indicating that WWOX shuttles between cytoplasm and nuclei. These findings provide novel insights into aspects of human WWOX function in both normal and malignant cells.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Common fragile sites can contribute to oncogenesis by facilitating gene inactivation through chromosomal deletion or amplification (1) . The common fragile site FRA16D on chromosome 16q23.3-24.2 is localized within a large region of chromosomal instability in cancers defined by loss of heterozygosity (2, 3, 4, 5) and homozygous deletion (6 , 7) . Mashimo et al. (8) reported that microcell-mediated chromosome transfer of chromosome 16q23-24 resulted in strong suppression of metastatic activity in prostatic cancer cell lines, indicating the presence of a major tumor suppressor gene associated with cancer progression on 16q23.3-24.2.

WW domain-containing oxidoreductase (WWOX) was cloned from this FRA16D site (9 , 10) . From its deduced amino acid sequence, two functional domains were predicted; the first, at the NH2 terminus, is a tandem WW domain that is likely to be involved in protein-protein interactions. The second is short-chain dehydrogenase/reductase domain that is shared in common among metabolic enzymes of steroid hormones (11) . On the basis of the function of these motifs and the observation that WWOX shows elevated expression in hormonally regulated tissues such as testis, prostate, and ovary, it has been speculated that WWOX is functionally related to steroid hormones (9) .

WWOX is reported to behave aberrantly in cancers of the breast, ovary, esophagus, and lung (9 , 12, 13, 14, 15, 16) . Although truncated WWOX transcripts are frequently observed in cancers from these tissues, mutations or deletions of the gene in the coding region are rarely found. Ectopic expression of WWOX protein induces apoptosis (11) and suppression of tumor growth both in vitro and in vivo (17) . From these findings, WWOX was proposed to be a candidate tumor suppressor gene in which the function is presumably inactivated by the dominant negative action of truncated products from aberrant transcripts (17) . However, a consistent picture of the subcellular localization of WWOX has not yet emerged (11 , 17) , and the dominant negative theory of WWOX action has remained untested without direct examination of endogenous expression of WWOX protein. Consequently, little is known about the role of WWOX protein in cancer progression.

To address these issues, we performed immunoblotting, subcellular localization analysis, and immunohistochemistry using newly generated monoclonal antibodies and provide new insights into the molecular understanding of WWOX protein in normal and cancer cells.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor Cell Lines.
The stomach cancer cell lines OCUM-2M, OCUM-2MD3, and OCUM-2MLN were previously established by Yashiro et al. (18) and Fujiwara et al. (19) . An additional 46 tumor cell lines derived from different tumor types (stomach, liver, lung, colon, esophagus, pancreas, kidney, brain, and breast) were obtained from the American Type Culture Collection (Manassas, VA), Riken Cell Bank (Tsukuba, Japan), Cell Resource Center for Biomedical Research at Tohoku University (Sendai, Japan), and Japanese Collection of Research Bioresources (Tokyo, Japan). Human skin fibroblast KMS-6 was purchased from Dainippon Pharmaceutical Co. Ltd. (Osaka, Japan)

Reverse Transcription-PCR and Northern Blot Analysis.
cDNA derived from human WWOX was synthesized with oligodeoxythymidylic acid primer from 1 µg of total RNA and diluted up to 80 µl as described previously (20) . Reverse transcription-PCR was performed with Advantage cDNA polymerase mixture (Clontech, Palo Alto, CA) and 1 µl of cDNA for 1 cycle of 94°C for 2 min, followed by 35 cycles of 94°C for 30 s, 63°C for 30 s, and 68°C for 3 min. Primers for amplification of sequence from exon 1 to 9 were 5'-GTGCCTCCACAGTCAGCCATG-3' (sense) and 5'-CATCCCTCCCAGACCCTCCAGT-3' (antisense). Glyceraldehyde-3-phosphate dehydrogenase primers were CATGTGGGCCATGAGGTCCACCAC (sense) and AATGCCTCCTGCACCACCAACTGC (antisense). Northern blot analysis and quantification of mRNA expression, using 20 µg of total RNA encoding normal WWOX, was performed as described previously (20) .

Generation of Anti-WWOX Monoclonal Antibodies.
A glutathione S-transferase-fusion protein of human WWOX derived from normal tissue was constructed in the expression vector pET 41 (Novagen, Madison, WI). Fusion proteins were induced in BL-21 Codon Plus (DE3; Stratagene, La Jolla, CA) and purified using Glutathione Sepharose 4B (Amersham Biosciences, Uppsala, Sweden) according to the manufacture’s instructions. Recombinant glutathione S-transferase-WWOX was used for 3 cycles of immunization against female BALB/c mice. Spleen cells were isolated and fused with NS-1 myeloma cells (Dainippon Pharmaceutical Co., Ltd.). Hybridomas were selected by ELISA against the purified recombinant glutathione S-transferase-fused WWOX. After ELISA against glutathione S-transferase-WWOX, 90 hybridoma clones were selected and purified by limited dilution. For mass production, 7 clones of hybridomas were grown in mice ascites. Ascite fluids were collected and purified using ammonium sulfate.

Epitope Mapping.
To obtain an antibody that recognizes both normal full-length and truncated proteins, we determined the epitope of each antibody by immunoblotting with recombinant normal and truncated WWOX proteins to correspond to amino acids 1–186, 1–98, amino acids 54–122, amino acids 171–414, and {Delta}exon7–8 inserted into expression vector pcDNA4/HisMax (Invitrogen, Carlsbad, CA). Expression vectors with inserts were transfected into COS-7 using FuGENE 6 Transfection Reagent (Roche, Mannheim, Germany). Recombinant WWOX proteins containing the NH2-terminal leader peptide Xpress epitope were obtained 2 days after transfection, and expression of proteins were confirmed by immunoblotting with anti-Xpress antibody (Invitrogen) and antimouse IgG antibody according to the following procedure.

Immunoblot Analysis.
Proteins (10 µg) were resolved on 12% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Hybond-P; Amersham Biosciences, Piscataway, NJ). After blocking the membranes with 2% nonfat milk in PBS for 1 h, immunoblotting was performed with an anti-WWOX antibody H2267 as primary antibody. Peroxidase-conjugated antimouse IgG antibody (Amersham Biosciences) was used as secondary antibody, and ECL-PLUS Detection System (Amersham Biosciences) was used as substrate for chemiluminescent detection. Quantification of WWOX protein level was performed on a Densitograph Lane and Spot Analyzer (Atto, Tokyo, Japan). To examine rapid degradation of truncated proteins, an inhibition of proteasomal machinery assay was performed using the proteasome inhibitor MG-132, obtained from the Peptide Institute (Osaka, Japan). A total of 5 µM MG-132 dissolved in DMSO or DMSO only was used to treat HCT-116 cells for 10 h, followed by immunoblot analysis.

Immunohistochemical Analysis.
Immunohistochemical analysis was performed against samples from a formalin-fixed, paraffin embedded tissue archive. Tissue collection and the subsequent study had full local research ethics approval. The sections were deparaffinised in xylene, washed in ethanol, and rehydrated in Tris-buffered saline. Antigen retrieval was performed in 10 mM citrate buffer pH 7.0 at 120°C for 10 min, followed by incubation with 2% nonfat milk in Tris-buffered saline. Sections were then incubated an antibody H2267 (50 µg/ml) for 1 h, followed by secondary staining with Dako Envision+ (Dako Ltd., Cambridge, United Kingdom). All sections were counter stained with Mayer’s hematoxylin.

Subcellular Localization Analysis.
Immunostaining of culture cells were performed after fixation in 4% paraformaldehyde and permeabilization in 0.2% Triton X-100 followed by incubation with 2% nonfat milk in Tris-buffered saline. To gain higher, an antibody in immunostaining were biotinylated by reacting antibodies with N-hydroxysuccinimide biotin. A biotinylated antibody H2267-biotin (50 µg/ml) was applied as primary antibody for 1 h and FITC-labeled Avidin (Vector Laboratories, Inc., Burlingame, CA) was used as secondary reagent. Dual-color detection by confocal laser scan microscopy was performed after treatment with a 0.5 µM solution of the mitochondrial stain MitoTracker Red CMXRos (Molecular Probes, Inc., Eugene, OR).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation and Characterization of Monoclonal Antibodies against Human WWOX.
We established 90 clones of hybridoma producing antihuman WWOX antibodies. To select antibodies that can recognize both normal and truncated proteins, we performed epitope mapping for antibodies from 7 clones. Antibody H2267 recognized a region within amino acids 54–98 (Fig. 1A)Citation . All truncated WWOX proteins with {Delta}exon 5–8, {Delta}exon 6–8 and a novel isoform {Delta}exon7–8, described below in this study, possess amino acids 1–136. Thus, antibody H2267 can recognize both normal and truncated WWOX proteins and was selected for use in the following study.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Epitope mapping of anti-WWOX monoclonal antibody H2267. A, immunoblot analysis was performed with anti-WWOX antibody H2267 (Lanes 1–6) and anti-Xpress antibody (Lane 7). Xpress-tagged proteins were obtained by transfection of expression vector with inserts into COS7 cells. B, a schematic representation of various recombinant WWOX proteins, asterisk marked bars indicate the deduced region where the epitope of antibody H2267 resides.

 
Expression Analysis of WWOX Transcripts and Proteins in Cancer Cell Lines.
We examined the expression of WWOX by reverse transcription-PCR in 49 cancer cell lines derived from stomach, liver, lung, colon, esophagus, pancreas, kidney, brain, and breast. Except for the gastric cancer cell line MKN7 that lacks full-length transcripts containing exons 1–9, all of the 48 remaining cell lines expressed full-length transcripts containing exons 1–9. In addition to full-length transcripts, aberrant transcripts were found in OCUM-2MD3, SCH, AGS, LoVo, HCT-116, Capan-1, and MCF-7 (Fig. 2A)Citation . Sequence analysis of these transcripts revealed a novel aberrant transcript in OCUM-2MD3 and HLE in which alternative splicing resulted in the absence of exons 7–8.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Expression of WWOX transcripts and proteins in cancer cell lines. A, reverse transcription-PCR for amplification of fragments containing exons 1–9 of WWOX. B, reverse transcription-PCR for GAPDH as an internal control. C, immunoblot analysis of WWOX using anti-WWOX antibody H2267. Note only normal WWOX protein was detected. D, proteasome inhibitor MG-132 (5 µM) induced accumulation of truncated protein of WWOX in HCT-116 cells. + and - indicates with or without MG-132, respectively.

 
Next, we examined the expression of WWOX proteins in cancer cells by immunoblot analysis. We anticipated the presence of truncated proteins corresponding to the aberrant transcripts identified in seven of the cell lines. However, truncated proteins of Mr 35,000 for {Delta}exon5–8, Mr 26,100 for {Delta}exon 6–8, and Mr 35,200 for {Delta}exon7–8, that would correspond to the truncated WWOX mRNA transcripts could not be identified in any of the seven cell lines. The 48 cell lines, except for MKN7, expressed a normal WWOX protein (Fig. 2C)Citation .

Mechanism for Truncated WWOX Protein Absence.
We next investigated the reason why truncated products from aberrant transcripts were not detected by immunoblotting. We first suspected that the small amount of aberrant transcripts in cell lines was undetectable: Even in cells with a relatively large amount of aberrant transcripts such as Capan-1 and MCF7, the quantitative ratio of aberrant to normal transcripts determined by Northern blotting was 0.63 and 0.069, respectively. However, truncated proteins could readily be detected in HCT-116 cells treated with the proteasome inhibitor MG-132 (Fig. 2D)Citation , whereas expression levels of normal WWOX remained unchanged, suggesting that truncated WWOX proteins are not usually detectable due to rapid and selective degradation.

Immunohistochemistry in Tumor and Normal Tissues.
To describe WWOX expression in vivo, immunohistochemical analysis was performed. If WWOX is a tumor suppressor, decreased expression may be expected in cancer. However, strong staining in cytoplasm was unexpectedly observed in 10 of 16 cases of gastric carcinoma (Fig. 3A)Citation and 5 of 5 cases of breast carcinoma (data not shown), whereas staining in surrounding noncancerous cells was weak. In normal tissues, staining was observed only in epithelial cells, particularly in hormone-regulated organs such as testis (Fig. 3B)Citation , thyroid (Fig. 3C)Citation , prostate, and mammary glands, consistent with the previous analysis by Northern blotting (9) and our Gene Expression Database by oligonucleotide microarray.5 In testis, WWOX was enriched in Leydig cells, which are known to produce testosterones (Fig. 3B)Citation . Interestingly, staining in nucleus was observed in mammary epithelia (Fig. 3D)Citation , whereas other epithelial cells were stained in the cytoplasm (Fig. 3, A–C)Citation .



View larger version (120K):
[in this window]
[in a new window]
 
Fig. 3. Immunohistochemical analysis of WWOX. A, strong staining is observed in gastric cancer cell (right and inset), but only weak staining in normal epithelium (top left) and no staining in intestinal metaplasia (bottom left) was observed in gastric cancer tissue (x100). Magnification is shown in inset (x400). B, strong staining in Leydig cells (center) and weak staining in testicular epithelium is observed in testis (x200). C, strong staining in follicular epithelium was observed in thyroid (x400). D, restricted nuclear staining is observed in some cells, whereas most cells showed reactivity in cytoplasm in mammary glands (x400).

 
Subcellular Localization Analysis in Culture Cells.
Subcellular localization of endogenous WWOX in cultured cells was determined by confocal laser scan microscopy analysis. Dual-color detection of WWOX and mitochondria demonstrated that localization of WWOX was mainly to mitochondria (Fig. 4, A–C)Citation . However, as shown in Fig. 4DCitation , WWOX translocates into nuclei under confluent culture conditions.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4. Subcellular localization of WWOX in human skin fibroblast KMS-6 cells by laser confocal microscopy. A, WWOX protein stained with anti-WWOX antibody A2267. B, mitochondria stained with MitoTracker Red CMXRos. C, merged image demonstrates localization of endogenous WWOX protein in mitochondria. D, WWOX translocates into nucleus in KMS-6 under confluent culture conditions.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study is an extension of our initial goal of identifying tumor suppressor loci in gastric cancer. We had searched for genomic homozygous deletions in the highly metastatic schirrous gastric cancer cell line OCUM-2MD3 using representational differential analysis with isogenic gastric fibroblast as a reference. This analysis identified several homozygously deleted fragments of ~300bp, including fragments mapped in 3p14 and 16q23, latterly identified as intronic region of fragile histidine triad at FRA3B and WWOX at FRA16D, respectively. Both fragments were deleted during malignant progression to OCUM-2MD3 from OCUM-2M, a poorly metastatic and isogenic ancestral line of OCUM-2MD3. As well as fragile histidine triad, alterations in WWOX such as rare point mutations and frequent intronic deletions and expression of aberrant transcripts found in gastric cancers (unpublished results). Prompted by these notable similarities of WWOX to fragile histidine triad, which now established as a tumor suppressor after a long period of controversy (21) , we set out to analyze WWOX at the protein level.

To make sure of WWOX as a tumor suppressor, the following two points are needed: (a) whether protein expression of WWOX in cancer declines; and (b) what impact of aberrant transcripts in cancer has (17) . To verify these issues, we focused on chasing a fate of aberrant transcripts and making protein expression in cancer clear by immunohistochemistry.

By immunoblotting with an antibody, which can recognize both full-length and truncated WWOX, we were not able to detect truncated proteins and only detected normal WWOX proteins from cell lines, which expressed normal and truncated RNA transcripts. Truncated proteins were not detectable under physiological condition until proteasomal inhibitor MG-132 was treated(Fig. 2D)Citation . These observations indicate that truncated WWOX proteins in cancer are unstable and subject to rapid proteasomal degradation and contradicts the possibility that truncated WWOX proteins acts in a dominant negative manner. On account of the possibility that mutated WWOX acts in the dominant negative manner, we examined sequence analysis in the coding region. Cancer-specific missense mutations in coding region were not found in 49 cell lines examined, although polymorphism, which were identified in normal individuals, were found in these cell lines (data not shown). This result is consistent to a report by Paige et al. (12) , indicating that cancer progression is rarely caused by mutation of WWOX.

Our immunohistochemical analysis in most specimens examined showed expression of WWOX in cancer cells is rather elevated by comparison with that in noncancerous cells. Therefore, we did not find predicted evidences of WWOX as a tumor suppressor. Aberrant transcripts of WWOX could be produced as a result of chromosomal instability in 16q23.3-24.2 region, where another tumor suppressor gene might reside. Thus, at present, we cannot conclude that WWOX is a tumor suppressor.

We next examined localization of WWOX protein. A consistent picture of the subcellular localization of WWOX has yet to emerge: localization of ectopic WWOX in Golgi apparatus was observed by Bednarek et al. (17) , whereas Chang et al. (11) reported that endogenous WWOX is localized in mitochondria and translocated to nuclei after tumor necrosis factor {alpha} stimulation. The discrepancy between two previous studies in the subcellular localization of WWOX may be caused by the difference between endogenous and ectopic expression. We confirmed that intrinsic WWOX localizes mainly in mitochondria and translocates into nuclei under confluent culture conditions. Because nuclear localization of WWOX was also detected in vivo, this translocation may be relevant to its function. Our observations are consistent with the report by Chang et al., who demonstrated interaction of WWOX with p53 (11) and phosphorylation of Tyr33 within WW domain by c-Jun NH2-terminal kinase 1 (22) . Shifting of WWOX localization may be controlled by phosphorylation of tyrosine within the WW domain.

In summary, to our knowledge, this is the first article describing expression of WWOX protein in cancers. Our results show there is little possibility that aberrant transcripts in cancer cells behave in a dominant negative fashion. Besides, immunohistochemical analysis in this study was not able to detect down-regulation of WWOX protein in cancer. Thus, our result by protein expression analysis using specific antibody did not support WWOX as a tumor suppressor. Additional characterization of WWOX protein such as mechanism of WWOX translocation will be required to elucidate its function.


    ACKNOWLEDGMENTS
 
We gratefully acknowledge Drs. Shuichi Tsutsumi, Shumpei Ishikawa, and Eiji Warabi for useful comments, Saori Fukui for protein expression, and Erio Ashihara-Fujita for cell culture.


    FOOTNOTES
 
Grant support: Grants-in-Aid for Scientific Research (B) 12557051 and 13218019 and Scientific Research on Priority Areas (C) 12217031 from Ministry of Education, Culture, Sports, Science and Technology (H. A.). This study was carried out as a part of The Technology Development for Analysis of Protein Expression and Interaction in Bioconsortia on R&D of New Industrial Science and Technology Frontiers which was supported by Industrial Science, Technology and Environmental, Policy Bureau, Ministry of Economy, Trade and Industry and delegated to New Energy Development Organization.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Drs. Watanabe and Hippo contributed equally to this study.

Requests for reprints: Hiroyuki Aburatani, Genome Science Division, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1, Komaba, Meguro-ku, Tokyo 153-8904, Japan. Phone: 81-3-5452-5352; Fax: 81-3-5452-5355; E-mail: haburata-tky{at}umin.ac.jp

5 http://www2.genome.rcast.u-tokyo.ac.jp/database/. Back

Received 4/18/03. Revised 9/16/03. Accepted 9/29/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sutherland G. R., Baker E., Richards R. I. Fragile sites still breaking. Trends Genet., 14: 501-506, 1998.[Medline]
  2. Suzuki H., Komiya A., Emi M., Kuramochi H., Shiraishi T., Yatani R., Shimazaki J. Three distinct commonly deleted regions of chromosome arm 16q in human primary and metastatic prostate cancers. Genes Chromosomes Cancer, 17: 225-233, 1996.[Medline]
  3. Driouch K., Dorion-Bonnet F., Briffod M., Champeme M. H., Longy M., Lidereau R. Loss of heterozygosity on chromosome arm 16q in breast cancer metastases. Genes Chromosomes Cancer, 19: 185-191, 1997.[Medline]
  4. Chen T., Sahin A., Aldaz C. M. Deletion map of chromosome 16q in ductal carcinoma in situ of the breast: refining a putative tumor suppressor gene region. Cancer Res., 56: 5605-5609, 1996.[Abstract/Free Full Text]
  5. Li C., Berx G., Larsson C., Auer G., Aspenblad U., Pan Y., Sundelin B., Ekman P., Nordenskjold M., van Roy F., Bergerheim U. S. Distinct deleted regions on chromosome segment 16q23-24 associated with metastases in prostate cancer. Genes Chromosomes Cancer, 24: 175-182, 1999.[Medline]
  6. Paige A. J., Taylor K. J., Stewart A., Sgouros J. G., Gabra H., Sellar G. C., Smyth J. F., Porteous D. J., Watson J. E. A 700-kb physical map of a region of 16q23.2 homozygously deleted in multiple cancers and spanning the common fragile site FRA16D. Cancer Res., 60: 1690-1697, 2000.[Abstract/Free Full Text]
  7. Krummel K. A., Roberts L. R., Kawakami M., Glover T. W., Smith D. I. The characterization of the common fragile site FRA16D and its involvement in multiple myeloma translocations. Genomics, 69: 37-46, 2000.[Medline]
  8. Mashimo T., Watabe M., Cuthbert A. P., Newbold R. F., Rinker-Schaeffer C. W., Helfer E., Watabe K. Human chromosome 16 suppresses metastasis but not tumorigenesis in rat prostatic tumor cells. Cancer Res., 58: 4572-4576, 1998.[Abstract/Free Full Text]
  9. Bednarek A. K., Laflin K. J., Daniel R. L., Liao Q., Hawkins K. A., Aldaz C. M. WWOX, a novel WW domain-containing protein mapping to human chromosome 16q23.3-24.1, a region frequently affected in breast cancer. Cancer Res., 60: 2140-2145, 2000.[Abstract/Free Full Text]
  10. Ried K., Finnis M., Hobson L., Mangelsdorf M., Dayan S., Nancarrow J. K., Woollatt E., Kremmidiotis G., Gardner A., Venter D., Baker E., Richards R. I. Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells. Hum. Mol. Genet., 9: 1651-1663, 2000.[Abstract/Free Full Text]
  11. Chang N. S., Pratt N., Heath J., Schultz L., Sleve D., Carey G. B., Zevotek N. Hyaluronidase induction of a WW domain-containing oxidoreductase that enhances tumor necrosis factor cytotoxicity. J. Biol. Chem., 276: 3361-3370, 2001.[Abstract/Free Full Text]
  12. Paige A. J., Taylor K. J., Taylor C., Hillier S. G., Farrington S., Scott D., Porteous D. J., Smyth J. F., Gabra H., Watson J. E. WWOX: a candidate tumor suppressor gene involved in multiple tumor types. Proc. Natl. Acad. Sci. USA, 98: 11417-11422, 2001.[Abstract/Free Full Text]
  13. Driouch K., Prydz H., Monese R., Johansen H., Lidereau R., Frengen E. Alternative transcripts of the candidate tumor suppressor gene, WWOX, are expressed at high levels in human breast tumors. Oncogene, 21: 1832-1840, 2002.[Medline]
  14. Kuroki T., Trapasso F., Shiraishi T., Alder H., Mimori K., Mori M., Croce C. M. Genetic alterations of the tumor suppressor gene WWOX in esophageal squamous cell carcinoma. Cancer Res., 62: 2258-2260, 2002.[Abstract/Free Full Text]
  15. Yakicier M. C., Legoix P., Vaury C., Gressin L., Tubacher E., Capron F., Bayer J., Degott C., Balabaud C., Zucman-Rossi J. Identification of homozygous deletions at chromosome 16q23 in aflatoxin B1 exposed hepatocellular carcinoma. Oncogene, 20: 5232-5238, 2001.[Medline]
  16. Yendamuri S., Kuroki T., Trapasso F., Henry A. C., Dumon K. R., Huebner K., Williams N. N., Kaiser L. R., Croce C. M. WW domain containing oxidoreductase gene expression is altered in non-small cell lung cancer. Cancer Res., 63: 878-881, 2003.[Abstract/Free Full Text]
  17. Bednarek A. K., Keck-Waggoner C. L., Daniel R. L., Laflin K. J., Bergsagel P. L., Kiguchi K., Brenner A. J., Aldaz C. M. WWOX, the FRA16D gene, behaves as a suppressor of tumor growth. Cancer Res., 61: 8068-8073, 2001.[Abstract/Free Full Text]
  18. Yashiro M., Chung Y. S., Nishimura S., Inoue T., Sowa M. Peritoneal metastatic model for human scirrhous gastric carcinoma in nude mice. Clin. Exp. Metastasis, 14: 43-54, 1996.[Medline]
  19. Fujihara T., Sawada T., Hirakawa K., Chung Y. S., Yashiro M., Inoue T., Sowa M. Establishment of lymph node metastatic model for human gastric cancer in nude mice and analysis of factors associated with metastasis. Clin. Exp. Metastasis, 16: 389-398, 1998.[Medline]
  20. Hippo Y., Yashiro M., Ishii M., Taniguchi H., Tsutsumi S., Hirakawa K., Kodama T., Aburatani H. Differential gene expression profiles of scirrhous gastric cancer cells with high metastatic potential to peritoneum or lymph nodes. Cancer Res., 61: 889-895, 2001.[Abstract/Free Full Text]
  21. Ohta M., Inoue H., Cotticelli M. G., Kastury K., Baffa R., Palazzo J., Siprashvili Z., Mori M., McCue P., Druck T., Croce C. M., Huebner K. The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell, 84: 587-597, 1996.[Medline]
  22. Chang N. S., Doherty J., Ensign A. JNK1 physically interacts with WW domain-containing oxidoreductase (WOX1) and inhibits WOX1-mediated apoptosis. J. Biol. Chem., 278: 9195-9202, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
T. Morikawa, A. Sugiyama, H. Kume, S. Ota, T. Kashima, K. Tomita, T. Kitamura, T. Kodama, M. Fukayama, and H. Aburatani
Identification of Toll-Like Receptor 3 as a Potential Therapeutic Target in Clear Cell Renal Cell Carcinoma
Clin. Cancer Res., October 1, 2007; 13(19): 5703 - 5709.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Ito, S.-i. Funahashi, N. Yamauchi, J. Shibahara, Y. Midorikawa, S. Kawai, Y. Kinoshita, A. Watanabe, Y. Hippo, T. Ohtomo, et al.
Identification of ROBO1 as a Novel Hepatocellular Carcinoma Antigen and a Potential Therapeutic and Diagnostic Target.
Clin. Cancer Res., June 1, 2006; 12(11): 3257 - 3264.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N.-S. Chang, J. Doherty, A. Ensign, L. Schultz, L.-J. Hsu, and Q. Hong
WOX1 Is Essential for Tumor Necrosis Factor-, UV Light-, Staurosporine-, and p53-mediated Cell Death, and Its Tyrosine 33-phosphorylated Form Binds and Stabilizes Serine 46-phosphorylated p53
J. Biol. Chem., December 30, 2005; 280(52): 43100 - 43108.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. P. Mahajan, Y. E. Whang, J. L. Mohler, and H. S. Earp
Activated Tyrosine Kinase Ack1 Promotes Prostate Tumorigenesis: Role of Ack1 in Polyubiquitination of Tumor Suppressor Wwox
Cancer Res., November 15, 2005; 65(22): 10514 - 10523.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Watanabe, S. Jiang, W. Takabe, R. Ohashi, T. Tanaka, Y. Uchiyama, K. Katsumi, H. Iwanari, N. Noguchi, M. Naito, et al.
Expression of the LXR{alpha} Protein in Human Atherosclerotic Lesions
Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 622 - 627.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S.-i. Fukumoto, N. Yamauchi, H. Moriguchi, Y. Hippo, A. Watanabe, J. Shibahara, H. Taniguchi, S. Ishikawa, H. Ito, S. Yamamoto, et al.
Overexpression of the Aldo-Keto Reductase Family Protein AKR1B10 Is Highly Correlated with Smokers' Non-Small Cell Lung Carcinomas
Clin. Cancer Res., March 1, 2005; 11(5): 1776 - 1785.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-I Sze, M. Su, S. Pugazhenthi, P. Jambal, L.-J. Hsu, J. Heath, L. Schultz, and N.-S. Chang
Down-regulation of WW Domain-containing Oxidoreductase Induces Tau Phosphorylation in Vitro: A POTENTIAL ROLE IN ALZHEIMER'S DISEASE
J. Biol. Chem., July 16, 2004; 279(29): 30498 - 30506.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, A.
Right arrow Articles by Aburatani, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, A.
Right arrow Articles by Aburatani, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online