| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
1 Department of Oncology, Albert Einstein Cancer Center, Montefiore Medical Center, Bronx, New York;
2 School of Public Health, New York Medical College, Valhalla, New York;
3 Biostatistics Unit, North Shore-Long Island Jewish Research Institute, Manhasset, New York; and
4 Department of Medical Genetics, Biomedicum Helsinki, University of Helsinki, Helsinki, Finland
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The identification of markers capable of predicting 5-FU response has been a subject of considerable interest (9) . There is significant literature to suggest that the target of 5-FU, thymidylate synthase (TS), is an important predictor of response (9) . For example, lower TS expression was associated with improved response to 5-FU in colorectal cancer patients with stage III and IV tumors (9 , 10) . In addition to TS, it has been reported that measurement of enzymes that affect the metabolism of 5-FU, including thymidine phosphorylase (TP) and dipyrimidine dehydrogenase, can also predict response (11 , 12) .
Several studies suggest p53 status is an important determinant of 5-FU sensitivity, with improved response and prolonged survival observed in patients with tumors wild-type (WT) for p53 (13, 14, 15) . Similarly, it was recently demonstrated that tumors which retained heterozygosity at either 17p or 18q showed improved response to 5-FU-based adjuvant therapy (16) . Other predictors of improved response include mismatch repair (MMR) status (17 , 18) and the ratio of antiapoptotic:proapoptotic bcl-2 family members (19) . In our own investigations, we have established that low-level amplification of c-myc was associated with longer overall survival in response to 5-FU-based adjuvant therapy (20) . More recently, these findings were extended to demonstrate that tumors with amplification of c-myc, which also retained WT p53 function, had significantly improved response to 5-FU both in vitro and in vivo (21) . A likely explanation for these findings was recently offered by Seoane et al. (22) , who demonstrated that c-myc represses p53-induction of p21WAF1/cip1 after DNA damage, promoting the induction of apoptosis over cell cycle arrest, an observation we have recently confirmed in terms of response to CPT (23) .
However, two major limitations exist in the utility of these limited numbers of markers for predicting chemotherapeutic response. First, for several of the markers described, conflicting reports also exist. For example, a number of studies have reported that TS levels fail to distinguish between patient groups with differential response to 5-FU (24, 25, 26, 27) . Likewise, whereas TS is often overexpressed in 5-FU-resistant cells in vitro (28) , studies of unselected panels of cell lines have failed to consistently show a correlation between intrinsic cellular TS levels and response (29, 30, 31) . Contrasting findings have also been observed for p53 status (24) and for TP expression, with both high and low levels of TP linked to 5-FU response (11 , 32 , 33) . Second, an approach that measures the ability of single markers to predict response to a specific agent generally fails to identify alternative treatment options.
The advent of high-throughput methodologies such as microarray-based gene expression profiling enables the transcriptional profile of a tumor sample to be determined on a global scale. A number of years ago, we suggested that such gene expression profiling could be fundamental in characterizing the phenotype of cells, including relative drug sensitivity of cancer cells (34 , 35) . Such gene expression profiling has the potential to probe more deeply into the factors that determine response to multiple drugs than a single assay. This in turn could reveal subtleties of mechanism that may be useful in identifying new drug targets, in discriminating among patients who show varying sensitivity to drugs, and in defining new treatment strategies, such as drug interactions that may be synergistic or antagonistic on a molecular level. The potential for gene expression profiling as a means toward prediction of response to chemotherapeutic agents is highlighted by its recent success in class discovery and prognosis in several cancer types (36 , 37) .
In this report, we approach this for colon cancer by defining 5-FU sensitivity for 30 colon carcinoma cell lines based on three different assays of response (growth inhibition, apoptosis, and clonogenicity) and linking this to the basal expression profile of >9000 sequences using a cDNA microarray approach. Gene sets were identified that show significant correlation with 5-FU sensitivity, and a formal statistical analysis ("leave one out" or jackknifing) was used to demonstrate that these genes are predictive for response. Importantly, this approach had greater power to predict response than four previously reported determinants of 5-FU response: TS and TP activities; and p53 and MMR status. The analysis was then repeated for sensitivity of the cell lines to CPT, a topoisomerase I inhibitor now commonly used in the treatment of colon cancer, and a second gene set, predictive for sensitivity to CPT, was identified. These experiments demonstrate that the basal gene expression profile of colon cancer cells can be used to predict response to chemotherapeutic agents and establish the potential of this approach as a means by which rational decisions regarding treatment of colon cancer can be approached.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Determination of p53 and MMR Status
The p53 status of Caco-2, Colo201, Colo205, Colo320, HT29, KM12, SW620, SW480, Dld-1, LoVo, SK-CO-1, LS174T, WiDr, SW837, RKO, HCT8, HCT116, HCT15, HCC2998, and SW1116 has been reported previously (Table 3)
. The p53 status of LIM1215, LIM2405, RW2982, RW7213, SW403, SW948, and T84 was determined by polymerase chain reaction (PCR) amplification and sequencing of exons 58 of the p53 gene, the location of the majority of p53 mutations (42)
, and confirmed by measurement of p53 protein levels by Western blot analysis. Mutations in the p53 gene are often associated with increased levels of p53 protein due to conformational changes in the p53 polypeptide that result in increased stability (43)
. DNA from each cell line was isolated using the DNeasy kit (Qiagen, Valencia, CA) and used as the template for two different PCR reactions, one amplifying exons 5 and 6, and the other amplifying exons 7 and 8. The sequences of the primers used were as follows: Exon 5 Forward, GGAATTCTGTTCACTTGTGCCCTGACTTTAAC; Exon 6 Reverse, AGGGCCACTGACAACCACCCTTAAC; Exon 7 Forward, ACAGGTCTCCCCAAGGCGCACTGG; and Exon 8 Reverse, GGAATTCTGAGGCATAACTGCACCCTTGGTCT.
|
The MMR status of 27 of the 30 cell lines was derived from the literature (Table 1)
. The MMR status of LIM1215, LIM2405, and HCC2998 cells was assessed using five fluorescence-labeled microsatellite markers (The Bethesda Panel: BAT25; BAT26; D2S123; D5S346; and D17S250). Primer sequences have been reported previously (44)
. PCR reactions were carried out in a 10-µl reaction volume containing 50100 ng of genomic DNA, 1x PCR buffer (Applied Biosystems, Foster City, CA), 250 µM each deoxynucleotide triphosphate, 0.5 µM each primer, and 1 unit of AmpliTaq Gold polymerase (Applied Biosystems). The MgCl2 concentration was 2.5 mM for BAT25 and 2.75 mM for BAT26, D2S123, D5S346, and D17S250. Predenaturation was performed at 95°C for 10 min, and final extension was performed at 72°C for 10 min in all reactions. PCR products were loaded on a 5% Long Ranger 6 M urea gel (FMC BioProducts, Rockland, ME) and run in an ABI PRISM 377 DNA Sequencer (Applied Biosystems) according to the manufacturers instructions. The data were collected automatically and analyzed by GeneScan 3.1 software (Applied Biosystems).
|
Growth Inhibition Assay
The concentration of 5-FU that induced 50% inhibition of control cell growth (GI50) was determined by staining cells with sulforhodamine B, according to the protocol used in the National Cancer Institute in vitro Anticancer Drug Discovery Screen Program (45
, 46)
. Cells were seeded in 96-well plates at plating densities ranging from 5 x 103 to 5 x 104 cells/well. As for the apoptosis assay, seeding density was assessed for each cell line before experimentation to ensure control cell density did not exceed 80% confluence at the completion of the 72-h experimental period. Twenty-four h after plating, one plate of each cell line was fixed in situ with 10% trichloroacetic acid to measure the cell population at the time of drug addition (Tz). Cells in a parallel plate were treated with 0, 0.01, 0.1, 0.5, 1, 2.5, 5, 10, 25, 50, 100, and 500 µM 5-FU for 72 h. Cells were fixed and stained with sulforhodamine B [0.4% (w/v)] for 30 min, and GI50, which is the drug concentration that results in a 50% inhibition in the net protein increase relative to control cell growth, was calculated as described previously (45
, 46)
.
Clonogenic Assay
Each cell line cultured in the growing phase was treated with 5, 50, or 500 µM 5-FU (Sigma) for 9 h. Medium was removed, and cells were harvested in trypsin, counted, and reseeded in triplicate in 6-well plates at a density of 500 cells/well. Colony formation was monitored over the following 13 weeks, depending on the cell line. When colonies were of sufficient size to enable clear visualization, cells were stained with 1% crystal violet for 30 min, washed with distilled water, air dried, and scanned using a Perfection 1250 flatbed scanner (Epson America Inc., Long Beach, CA). Colony formation was quantified by analysis of TIFF images using TotalLab 1.1 software (Nonlinear Dynamics, Durham, NC). Each cell line was assayed three times, each time in triplicate.
RNA Isolation and Preparation of Reference RNA
For isolation of RNA for cDNA microarray experiments, each cell line in the exponentially growing phase (6080% confluence) was harvested in PBS, and pellets were snap frozen in liquid nitrogen. In each case, medium was changed 12 h before harvesting cells. RNA was isolated using the RNeasy kit (Qiagen). For preparation of the reference RNA, equal amounts of RNA were pooled from 12 cell lines (Caco-2, HT29, HT29 cl.19A, HT29 cl.16E, SW620, SW480, RKO, HCT116, LS174T, Dld-1, LoVo, and WiDr) grown to confluence.
Microarray Analysis
For all microarray hybridizations, 100 µg of RNA isolated from each cell line were labeled with Cy5 dUTP, and 100 µg of reference RNA were labeled with Cy3 dUTP. Probe preparation, hybridization conditions, and array scanning procedure were as described previously (47
, 48)
. Arrays used in this report, encompassing 9216 sequences, were prepared by the microarray facility at the Albert Einstein College of Medicine (49)
. Signal and background intensities for each channel, at each spot on the microarray, were determined using Genepix Pro software (Axon Instruments, Union City, CA). Each spot was normalized by division of the ratio of red/green signal by the median ratio for the entire array and log transformed. For each cell line, microarrays were performed in duplicate using RNA isolated from two independent cell passages. For each set of replicates, the mean value for each sequence was determined and entered into a final database for further analyses.
Statistical Analyses
Normality Tests, Correlation Analyses, Comparison of Subgroups.
All 5-FU and CPT sensitivity data and TS and TP activity were tested for normality using a Shapiro-Wilk test (Proc univariate; SAS Procedures Guide Version 8; SAS Institute Inc., Cary, NC). Raw data not normally distributed were log (LN) transformed and reanalyzed for normality. Correlations between two normally distributed data sets were compared using a Pearsons correlation analysis; otherwise, data were compared by Spearmans correlation analysis. Comparisons between cell lines separated according to p53 or MMR status were made using a Mann-Whitney test.
Microarray Data.
Unsupervised cluster analysis of the cell lines was performed and displayed using the Cluster and Treeview programs of Eisen et al. (50)
. For functional Group analysis, named genes on the microarray were categorized into 1 or more of 50 functional categories, and functional group analysis was performed as described previously (48
, 51)
.
"Leave One Out" or Jackknife Analysis.
The following text describes the stepwise procedure for the jackknife statistical analysis (52)
. All jackknife analyses were performed using genes that showed a significant level of expression above background in each of the 30 cell lines (3725 of the 9216 genes on the arrays). First, from the 30 cell lines, cell line 1 was removed from consideration, leaving 29 cell lines for analysis. For these 29 cell lines, the Pearson correlation between the level of expression of each of the 3725 genes and apoptosis induced by 5-FU or CPT was computed, and the N highest absolute value correlations (i.e., corresponding to N genes) were selected. N was varied from the 10200 best-correlated genes. As a control, N randomly selected genes were also analyzed. To reduce the number of genes to a smaller set of variables, Principal Components Analysis (PCA) was performed. PCA enables a large number of variables to be reduced to linear combinations of variables that can be used to predict an outcome. From the PCA, the principal components (PCs) having the 10 largest eigenvalues were selected. In general, these 10 PCs accounted for approximately 60% of the variance in the selected genes. Next a multiple regression model was developed using the 10 PCs to predict apoptosis, based on the 29 cell lines in the analysis. Once the regression equation was derived, the 10 PCs corresponding to the "left out" cell line were computed and substituted into the derived regression equation to yield a prediction of apoptosis in the left out cell line. Thus, the final results for this first jackknife procedure were the predicted value of apoptosis for the left out cell line (y1*) and the observed value (y1).
After this first jackknife procedure was completed, the left out cell line was replaced in the dataset, and cell line 2 was removed, once again leaving 29 cell lines in the dataset with 1 cell line left out. The entire procedure was repeated, and this entire sequence of procedures was repeated for all 30 cell lines so that the final result was a set of predicted apoptosis values for each cell line that had been left out and the corresponding observed value. Each of these 30 jackknife procedures yielded 30 pairs of predicted and observed apoptosis values: y1*, y1, y2*, y2, ..., y30*, y30.
To determine how well a given regression model predicted observed apoptosis in the left out cell line, the natural log of observed apoptosis [ln(yi)] was plotted as a function of the natural log of the predicted value [ln(yi*)], and a simple linear regression was constructed. The purpose of this regression analysis was to determine whether the predicted and observed values obeyed the equation yi = yi* (i.e., whether the points fall on the line of equality). If the prediction rule is true, then the observed and predicted values would be equal or nearly equal. The measure of linear fit was r, and the hypothesis of falling on the line of equality was tested by comparing the slope to unity and y intercept to zero.
Quantitative Real-Time PCR
The expression levels of 10 genes significantly correlated with 5-FU response were selected for further confirmation using quantitative real-time PCR. In addition to significant correlation with 5-FU response, the 10 genes selected were those with the greatest expression range across the panel of 30 cell lines. RNA aliquots (5 µg) from each cell line were reverse-transcribed using SuperScript II (Invitrogen). PCR primers for specific target genes were designed using Primer Express software (Applied Biosystems). cDNA (10 ng) from each cell line was amplified with specific primers using the SYBR green Core Reagents Kit and a 7900HT real-time PCR instrument (Applied Biosystems). Expression of each gene was standardized using glyceraldehyde-3-phosphate dehydrogenase as a reference, and relative levels of expression across the panel of cell lines were quantified by calculating 2-
CT, where 
CT is the difference in CT (cycle number at which the amount of amplified target reaches a fixed threshold) between target and reference.
Measurement of TS and TP Activity
For both TS and TP activity, cell extracts were prepared by brief homogenization of cells on ice in Tris-mannitol buffer [50 mM D-mannitol, 2 mM Trizma base (pH 7.4), and 0.1% Triton X-100].
TS Activity.
TS was measured in cell extracts by measurement of [3H]2O release from [5-3H]dUMP in the presence of 5,10-methylenetetrahydrofolate (53)
. Each 150-µl assay contained 550 µg of protein extract, 50 mM Tris-HCl (pH 7.4), 10 µM [5-3H]dUMP (0.33 Ci/mmol), and 250 µM 5,10-methylenetetrahydrofolate and was incubated for 10 min at 37°C. Reactions were stopped by the addition of 0.8 ml of ice-cold 3% acid charcoal; after 10 min on ice, the samples were centrifuged (10 min at 10,000 rpm), and a 0.5-ml aliquot of the supernatant was assayed for radioactivity in a liquid scintillation spectrometer. Reactions were linear with respect to time and protein concentration and were dependent on reduced folate for activity.
TP Activity.
TP activity was measured in the supernatants of cell extracts (1050 µg of protein) by incubation in 0.2 M KH2PO4 (pH 7.8) containing 0.2 mM [5'-3H]thymidine (Moravek), as described recently (54)
. In all cases, results were expressed relative to total protein.
Immunofluorescence
For immunofluorescence detection, cells were treated with 5 or 50 µM 5-FU for 24 h and fixed, prepared, and visualized as described previously (55)
. To detect mitochondria, a mouse monoclonal HSP60 antibody was used (1:200 dilution; Santa Cruz Biotechnology, Santa Cruz, CA), and binding was detected using a goat antimouse FITC-conjugated secondary antibody (Roche Diagnostics/Boehringer Mannheim Corp., Indianapolis, IN). Cytochrome c was detected using a mouse monoclonal anti-cytochrome c IgG (1:200 dilution; PharMingen, San Diego, CA), followed by exposure to a goat antimouse Cy5-conjugated secondary antibody (Amersham Biosciences, Piscataway, NJ). Bak was detected with a rabbit polyclonal IgG (1:100 dilution; Upstate Biotechnology, Lake Placid, NY) followed by exposure to a goat Cy3-conjugated antirabbit secondary antibody (Amersham). All secondary antibodies were used at a dilution of 1:200 with incubation for 1 h. The number of cells exhibiting Bak localization to the mitochondrial membrane and concurrent cytochrome c release, with and without exposure to 5 or 50 µM 5-FU, was quantified by examination of 200 cells in each of three independent experiments.
| RESULTS |
|---|
|
|
|---|
To evaluate the reproducibility of our microarray database, the data for the 60 resulting arrays (each cell line in duplicate) were analyzed by unsupervised clustering, using the Cluster and Treeview programs (50)
. For 27 of the 30 cell lines, the duplicates (from independent experiments and different passages for the same cell lines) clustered together, illustrating the high degree of reproducibility of the microarray data (data not shown). For each cell line, the mean of the two replicates was computed and used in subsequent analyses. First, we selected genes that showed a significant level of expression above background in each of the 30 cell lines. A total of 3725 genes satisfied these criteria, which were used for subsequent analyses. Unsupervised hierarchical clustering of the 30 cell lines based on the expression levels of these 3725 genes revealed several important observations that emphasize the robust nature of this database (Fig. 1)
. First, the Colo201 and Colo205 cell lines, which were derived from the same patient, clustered together. Second, the HT29 cell line and three of its derivatives, HT29 cl.19A, HT29 cl.16E, and WiDr, clustered together. Third, the Dld-1 and HCT15 cell lines, which were derived from the same colon carcinoma by two independent researchers (56)
, clustered closely together. Finally, the SW480 and SW620 cell lines, which were generated from a primary and metastatic cancer from the same patient, respectively, also clustered together (Fig. 1)
. Previous gene expression profiling studies using large panels of cell lines have consistently demonstrated clustering of cell lines according to tissue of origin (31
, 57
, 58)
. In this study, the clustering of cell lines derived from the same patient demonstrates an additional degree of sensitivity of gene expression profiling and illustrates the ability of this technique to recognize the unique signatures that exist among individual patients, despite the common tissue origin of these tumors. In turn, should heterogeneity in gene expression be the basis for differences in response to 5-FU, it establishes the potential that these differences may be distinguishable by gene expression profiling.
|
|
|
|
Genes involved in DNA replication and repair included MLH1, PCNA, replication factor C, nucleosome assembly protein 1, origin recognition complex, and topoisomerase II. Importantly, each gene in this category was negatively correlated with 5-FU response, indicating higher expression levels in 5-FU resistant cells. Increased expression of topoisomerase II in 5-FU-resistant cells is consistent with a previous report in vivo (63) . The second functionally related group of genes enriched for expression were those involved in protein processing and trafficking, including several chaperones. As for DNA replication and repair, the majority of these sequences were negatively correlated with 5-FU-induced apoptosis. Genes in this category included chaperonin containing TCP1 subunits 4 and 8, lectin mannose-binding 1, heat shock 70kDa protein 8, nucleophosmin, and hypoxia up-regulated 1. Chaperones protect cells from environmental stress by binding denatured proteins, dissociating protein aggregates, and regulating the correct folding and intracellular translocation of newly synthesized polypeptides (64) . High basal levels of expression of these genes may enhance a cells ability to survive after 5-FU-induced genotoxic stress. Consistent with this role, nucleophosmin is up-regulated in colorectal carcinoma (65) , is translocated from the nucleolus to the nucleoplasm after treatment with anticancer drugs (66) , and has been associated with resistance to UV radiation-induced apoptosis (67) .
We also identified three proapoptotic genes (Bak, TSSC3, and DAPK1) whose expression was positively correlated with 5-FU response, suggesting that their respective gene products may play a role in 5-FU-induced apoptosis. We chose to further explore the role played by Bak for two reasons. First, it is well established that proapoptotic members of the bcl-2 family, such as Bak, translocate from a predominantly cytoplasmic localization to mitochondria, where they trigger apoptosis through a mechanism dependent on release of cytochrome c (68) . Second, Bak has previously been shown to be up-regulated in colon cancer cell lines treated with 5-FU (69) .
Subcellular localization of Bak was examined with and without 5-FU treatment in four cell lines (RKO, HCT116, RW2982, and HCC2998) by immunofluorescence. Representative photomicrographs for the RKO cell line are shown in Fig. 3
. In all cell lines examined, basal Bak expression was low and diffusely distributed. For the RKO cell line, treatment with 5 µM 5-FU for 24 h resulted in intense punctate staining for Bak in approximately 5% of cells (Fig. 3, B and D
, white arrows). This was associated with its localization to the mitochondrion, as indicated by the overlap of Bak staining with the mitochondrial marker HSP60 (Fig. 3B
, yellow arrow). Co-staining of 5-FU-treated cells for Bak and cytochrome c demonstrated that mitochondrial Bak translocation was linked to diffuse cytoplasmic localization of cytochrome c, indicative of its release from the mitochondrion (Fig. 3D
, cytochrome c, white arrows). In contrast, in untreated cells, cytochrome c staining was always punctate; co-staining with HSP60 indicated that this was due to its mitochondrial localization (data not shown). Quantitation of this event demonstrated that a 24-h exposure to 5-FU induced a concentration-dependent increase in the number of RKO cells demonstrating simultaneous Bak translocation and cytochrome c release, compared with untreated cells [0.8 ± 0.4, 3.3 ± 0.6, and 8.7 ± 2.1/200 cells counted for 0, 5, and 50 µM 5-FU, respectively (mean ± SD); P < 0.005 for both 5 and 50 µM 5-FU compared with control (paired t test)]. Similar results were obtained for the HCT116, RW2982, and HCC2998 cell lines (data not shown). These results clearly indicate a role for Bak in mediating 5-FU-induced apoptosis and serve as validation for the array data.
|
Predictive Value of Genes Correlated with 5-FU Response.
The concept behind gene profiling is that expression levels of multiple genes considered together may better predict phenotype than measurement of single markers. We hypothesized that gene expression profiling would therefore be a more effective means of predicting response to 5-FU than conventional single marker approaches. To determine whether this was the case for apoptotic response to 5 µM 5-FU, a "leave one out" or jackknife cross-validation approach was used, in which the predictive power of genes significantly correlated with 5-FU-induced apoptosis (described above) was tested. The primary objective of this statistical analysis was to develop a model that would predict level of apoptosis as a function of gene expression for multiple genes. The method used to develop this model utilized the jackknife technique (52)
, and its predictive value was validated on an independent observation.
In this approach, one cell line is omitted from the analysis, and a rule that predicts 5-FU response is derived based on the basal gene expression profile of the remaining 29 cell lines (see "Materials and Methods" for rule derivation). The predictive power of this rule is then tested on the cell line omitted at the start of the analysis. This process is repeated iteratively, on 30 separate occasions, with a different cell line omitted from each analysis.
Fig. 4A
illustrates the result of an analysis in which the 10 PCs of the 50 genes with the highest absolute correlation with 5 µM 5-FU-induced apoptosis were used to derive the predictor. The 30 data points in the figure are the observed apoptotic response for a given cell line versus the predicted value for the 30 jackknife calculations. For this analysis, the Pearsons correlation coefficient between observed and predicted apoptosis was 0.47 (P = 0.008), formally demonstrating that selection of the 50 genes best correlated with 5 µM 5-FU response had excellent predictive value. In contrast, derivation of a predictor based on 50 randomly selected genes resulted in poor correlation between observed and predicted apoptosis (r = 0.099; P = 0.601; Fig. 4B
).
|
Repetition of these analyses using apoptosis induction by 5-FU at concentrations of 50 and 500 µM failed to identify gene sets capable of predicting response. However, at these higher concentrations, the continuum of apoptotic response across the panel of 30 cell lines is less pronounced because the majority of cell lines undergo significant apoptosis. In parallel, genes significantly correlated with apoptotic response tended to have less variation in expression range across the 30 cell lines and thus are less robust predictors of apoptotic response. Furthermore, except for brief periods of time after bolus administration, the 50 and 500 µM concentrations of 5-FU are 12 orders of magnitude greater than those achievable in vivo and may indicate that, due to toxicity, these concentrations of drug do not stimulate a complete biological response, thus decreasing the influence of a specific gene program on cellular response to this agent at these higher concentration.
Predictive Efficacy of TS and TP Activity and of p53 and MMR Status.
Having demonstrated the ability of the basal gene expression profile of colon carcinoma cells to predict response to 5-FU, we compared the efficacy of this approach with four previously established determinants of 5-FU response: TS and TP activity; and p53 (72)
and MMR status (73
, 74)
.
Levels of TS and TP have previously been linked to 5-FU response, with high and low activity of TS and TP, respectively, associated with 5-FU resistance. Measurement of TS and TP activities in the panel of 30 cell lines demonstrated that TS activity was negatively correlated with 5-FU-induced apoptosis, and TP activity was positively correlated with 5-FU-induced apoptosis, although this was not statistically significant for all concentrations of 5-FU tested (Fig. 5
; Table 3
). This link between low TS/high TP activity and enhanced 5-FU response is consistent with some (31)
, but not all, previous reports in which basal TS and TP levels in a panel of unselected cell lines have been correlated with 5-FU response (29
, 30
, 32)
. To determine the predictive efficacy of these markers on 5-FU-induced apoptosis, we used a jackknife approach similar to that used for the gene expression data. For these analyses however, only a single marker, basal TS or TP activity, was used to derive the rule. Prediction of apoptotic response using basal TS activity resulted in a weak correlation between observed and predicted 5-FU-induced apoptosis that was not statistically significant (r = 0.21 and P = 0.28, r = 0.07 and P = 0.70, and r = 0.23 and P = 0.23 for apoptosis induction at 5, 50, and 500 µM 5-FU, respectively; all values are log transformed). Likewise TP activity failed to predict response, except for apoptosis induction at the highest concentration of 5-FU tested (r = 0.11 and P = 0.56 and r = 0.06 and P = 0.77 for 5 and 50 µM 5-FU-induced apoptosis, respectively; and r = 0.45 and P = 0.01 for apoptosis induced at 500 µM 5-FU). Analyses for 5 µM 5-FU are shown in Fig. 6, A and B
.
|
|
Similar to p53, conflicting reports also exist regarding the effect of tumor MMR status on 5-FU response (17
, 75
, 76)
. The MMR status of the 30 cell lines is shown in Table 1
. Comparison of the effect of 5-FU-induced apoptosis in 21 MMR-proficient and 9 MMR-deficient cell lines revealed no significant difference in 5-FU-induced apoptosis at any of the concentrations of 5-FU tested (Fig. 6D)
.
Therefore, in summary, for the clinically relevant concentration of 5-FU (5 µM), gene expression profiling had greater predictive power than four previously reported determinants of 5-FU response.
Extension of Analysis to CPT.
A limitation of using single markers to predict response to specific agents is that they do not necessarily identify sensitivity to alternate treatment options. An assay capable of determining the treatment likely to be most effective for a particular tumor, therefore, would clearly have greater clinical benefit. To test this, we extended our analyses to the topoisomerase I inhibitor CPT, an alternative chemotherapeutic agent with proven efficacy in the treatment of colon tumors nonresponsive to 5-FU (77
, 78) , and determined whether the microarray database could be reanalyzed to predict relative response to CPT.
As described for 5-FU, the panel of 30 cell lines was characterized for response to CPT-induced apoptosis (Fig. 7)
. Fig. 7
illustrates the continuum of response of the panel of 30 cell lines to 1 µM CPT-induced apoptosis. No significant differences in CPT-induced apoptosis were observed when cell lines were separated according to p53 or MMR status (data not shown). Importantly, several cell lines relatively resistant to 5-FU exhibited sensitivity to CPT, and the converse was also true. These included Colo205 (rank order of apoptotic response, 7 versus 27 for 5-FU and CPT, respectively), HT29 cl.16E (rank order of apoptotic response, 14 versus 30 for 5-FU and CPT, respectively), and LIM1215 (rank order of apoptotic response, 23 versus 2 for 5-FU and CPT, respectively).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
This study demonstrated several advantages of a gene expression profiling approach for prediction of 5-FU response. First, gene expression profiling outperformed four previously reported markers (TS and TP activity; p53 and MMR status) in predicting apoptotic response to 5-FU. Low TS and high TP expression, respectively, have previously been linked with improved sensitivity to 5-FU in vitro (31 , 32) . Consistent with these studies, in general, basal TS activity was negatively correlated with 5-FU-induced apoptosis, and basal TP activity was positively correlated with 5-FU-induced apoptosis. However, a jackknife analysis using TS or TP activity to predict 5-FU response demonstrated that these markers were less efficient at predicting response (r = 0.21 and P = 0.28 and r = 0.11 and P = 0.56 for TS and TP activity, respectively) than the gene expression profiling approach (r = 0.47, P = 0.008).
Likewise, no relationship between p53 and MMR status of the cell lines and response to 5-FU was observed. The lack of a significant difference in 5-FU response among p53 WT and mutant colon cancer cell lines is consistent with some previous reports in which a panel of cell lines has been studied (19) . In contrast, however, use of isogenic cell systems has demonstrated that deletion of p53 from a p53 WT cell line (HCT116) results in marked resistance to 5-FU (79) , whereas reintroduction of functional p53 into a p53 mutant colon cancer cell line significantly enhanced 5-FU-mediated cell killing (80) . A similar disparity exists among in vivo studies in which some, but not others, have demonstrated improved 5-FU sensitivity in p53 WT tumors (13, 14, 15 , 24) . Use of an isogenic cell system has also demonstrated that MMR-deficient colon cancer cells are more resistant to 5-FU (73 , 81) . As for p53 status, however, studies in vivo have failed to consistently demonstrate a link between tumor MMR status and response to 5-FU (16, 17, 18 , 74 , 75) . The present findings also reflect this lack of consistency for these markers in predicting sensitivity and support the concept that measurement of multiple, rather than single, markers may better predict 5-FU response.
A second advantage of gene expression profiling over single marker approaches is that predictors of response to each of multiple agents can potentially be determined from a single assay. In the present study, this was demonstrated for CPT, an alternative for treatment of tumors refractory to 5-FU (77 , 78) . Here, reanalysis of the same database used to predict response to 5-FU was able to identify a gene expression profile capable of predicting response to CPT.
For both 5-FU and CPT, a continuum of response in terms of induction of apoptosis was observed across the panel of 30 cell lines. This illustrates that simple classification of cell lines as sensitive or resistant to a given drug is a difficult process and that consideration of the relative magnitude of the response of a given cell line, or tumor, to multiple chemotherapeutic agents is likely to be a more practical approach. In this study, a jackknife cross-validation strategy demonstrated that selection of the 50 best-correlated genes with 5-FU response and the 149 best-correlated genes with CPT response maximally and significantly predicted response to each agent. Importantly, use of these gene expression profiles enables robust prediction of the magnitude of the apoptotic response to each of these agents, thereby adding an additional dimension to the predictive evaluation not afforded by dichotomous "yes" or "no" marker studies, such as p53 status.
Additionally, the ability to predict the likelihood of response to multiple agents could enhance the ability to determine whether single agents or combination therapies would be most appropriate for treatment of a specific tumor. The use of combination therapies is becoming increasingly common, and the ability to identify profiles of gene expression predictive of response to multiple agents in a given tumor could provide a basis for rational clinical decisions regarding the specific combination of therapies likely to result in maximal response and minimize avoidable toxicity.
Finally, the gene expression profiling approach identified a number of links between the mechanisms of action of chemotherapeutic agents and the likelihood of inducing a response. For example, a positive correlation between basal levels of Bak expression and sensitivity to 5-FU was identified. Furthermore, we demonstrated that 5-FU induced localization of Bak to the mitochondria, which was linked to release of cytochrome c. We also identified a significant negative correlation between the basal expression level of hypoxia inducible factor 1
(HIF1
) and sensitivity to 5-FU (Table 2)
. HIF1
is a transcription factor that is up-regulated under hypoxic conditions and plays a pivotal role in the adaptive response to hypoxia (82)
. There is evidence that hypoxia is associated with resistance to radiation therapy and chemotherapy (82)
, including 5-FU (83
, 84)
. Although HIF1
is primarily regulated at the posttranslational level, transcription of HIF1
is also up-regulated under hypoxic conditions (85)
. It is possible that higher expression of HIF1
in 5-FU-resistant cell lines may serve as a surrogate marker of cellular redox status and, subsequently, sensitivity to 5-FU.
This study therefore demonstrates that the basal gene expression profile of a tumor can be used to predict probability of response to multiple chemotherapeutic options and can provide significant insight into underlying mechanisms. Our immediate challenge is to use similar analyses with resected tumor tissue or biopsy specimens. Such analyses will either confirm the predictive value of the gene sets for response to 5-FU and CPT or identify variations of the gene sets that may better predict clinical response. Collection of such gene expression/clinical data is ongoing at our institution. Because there are multiple strategies for analyzing the data, and there may be other investigators who have begun to accumulate gene expression data on colon cancer patient response and outcome to these as well as to other drugs, the entire gene expression data set for the 30 colon carcinoma cell lines is made available on our web site.5
Finally, in addition to gene expression profiling, considerable advances have now been made in other high-throughput profiling technologies, including mutation screening (Single Nucleotide Polymorphism analysis and complete genome hybridization), and proteomics. Combination of predictive gene sets identified by gene expression profiling with these methodologies may enhance the prediction of tumor response to chemotherapy and provide further insights into the molecular characterization of tumor cells.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: John M. Mariadason, Department of Oncology, Albert Einstein Cancer Center, Montefiore Medical Center, 111 East 210th Street, Bronx, New York 10467. Phone: (718) 920-2025; Fax: (718) 882-4464; E-mail: jmariada{at}aecom.yu.edu
5 http://sequence.aecom.yu.edu/bioinf/Augenlicht/default.html. ![]()
Received 7/23/03. Revised 9/ 3/03. Accepted 9/ 5/03.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Z. Yuan, J. Shin, A. Wilson, S. Goel, Y.-H. Ling, N. Ahmed, H. Dopeso, M. Jhawer, S. Nasser, C. Montagna, et al. An A13 Repeat within the 3'-Untranslated Region of Epidermal Growth Factor Receptor (EGFR) Is Frequently Mutated in Microsatellite Instability Colon Cancers and Is Associated with Increased EGFR Expression Cancer Res., October 1, 2009; 69(19): 7811 - 7818. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. PILATI, E. MAMMANO, S. MOCELLIN, E. TESSARI, M. LISE, and D. NITTI Hepatic Arterial Infusion for Unresectable Colorectal Liver Metastases Combined or Not with Systemic Chemotherapy Anticancer Res, October 1, 2009; 29(10): 4139 - 4144. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Brody, T. Hucl, C. L. Costantino, J. R. Eshleman, E. Gallmeier, H. Zhu, M. S. van der Heijden, J. M. Winter, A. K. Wikiewicz, C. J. Yeo, et al. Limits to Thymidylate Synthase and TP53 Genes as Predictive Determinants for Fluoropyrimidine Sensitivity and Further Evidence for RNA-Based Toxicity as a Major Influence Cancer Res., February 1, 2009; 69(3): 984 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Uemura, H. F. Yerushalmi, G. Tsaprailis, D. E. Stringer, K. E. Pastorian, L. Hawel III, C. V. Byus, and E. W. Gerner Identification and Characterization of a Diamine Exporter in Colon Epithelial Cells J. Biol. Chem., September 26, 2008; 283(39): 26428 - 26435. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Pezo, S. J. Gandhi, L. A. Shirley, R. G. Pestell, L. H. Augenlicht, and R. H. Singer Single-Cell Transcription Site Activation Predicts Chemotherapy Response in Human Colorectal Tumors Cancer Res., July 1, 2008; 68(13): 4977 - 4982. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jhawer, S. Goel, A. J. Wilson, C. Montagna, Y.-H. Ling, D.-S. Byun, S. Nasser, D. Arango, J. Shin, L. Klampfer, et al. PIK3CA Mutation/PTEN Expression Status Predicts Response of Colon Cancer Cells to the Epidermal Growth Factor Receptor Inhibitor Cetuximab Cancer Res., March 15, 2008; 68(6): 1953 - 1961. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Laguinge, R. N. Samara, W. Wang, W. S. El-Deiry, G. Corner, L. Augenlicht, L. Mishra, and J. M. Jessup DR5 Receptor Mediates Anoikis in Human Colorectal Carcinoma Cell Lines Cancer Res., February 1, 2008; 68(3): 909 - 917. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sagiv, U. Rozovski, D. Kazanov, E. Liberman, and N. Arber Gene Expression Analysis Proposes Alternative Pathways for the Mechanism by Which Celecoxib Selectively Inhibits the Growth of Transformed but not Normal Enterocytes Clin. Cancer Res., November 15, 2007; 13(22): 6807 - 6815. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sekine, J. D. Minna, K. Nishio, N. Saijo, and T. Tamura Genes Regulating the Sensitivity of Solid Tumor Cell Lines to Cytotoxic Agents: A Literature Review Jpn. J. Clin. Oncol., May 1, 2007; 37(5): 329 - 336. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Del Rio, F. Molina, C. Bascoul-Mollevi, V. Copois, F. Bibeau, P. Chalbos, C. Bareil, A. Kramar, N. Salvetat, C. Fraslon, et al. Gene Expression Signature in Advanced Colorectal Cancer Patients Select Drugs and Response for the Use of Leucovorin, Fluorouracil, and Irinotecan J. Clin. Oncol., March 1, 2007; 25(7): 773 - 780. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Huang, K. Reeves, X. Han, C. Fairchild, S. Platero, T. W. Wong, F. Lee, P. Shaw, and E. Clark Identification of Candidate Molecular Markers Predicting Sensitivity in Solid Tumors to Dasatinib: Rationale for Patient Selection Cancer Res., March 1, 2007; 67(5): 2226 - 2238. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Grade, P. Hormann, S. Becker, A. B. Hummon, D. Wangsa, S. Varma, R. Simon, T. Liersch, H. Becker, M. J. Difilippantonio, et al. Gene Expression Profiling Reveals a Massive, Aneuploidy-Dependent Transcriptional Deregulation and Distinct Differences between Lymph Node-Negative and Lymph Node-Positive Colon Carcinomas Cancer Res., January 1, 2007; 67(1): 41 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Davalos, H. Dopeso, J. Castano, A. J. Wilson, F. Vilardell, J. Romero-Gimenez, E. Espin, M. Armengol, G. Capella, J. M. Mariadason, et al. EPHB4 and Survival of Colorectal Cancer Patients. Cancer Res., September 15, 2006; 66(18): 8943 - 8948. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Wilson, D.-S. Byun, N. Popova, L. B. Murray, K. L'Italien, Y. Sowa, D. Arango, A. Velcich, L. H. Augenlicht, and J. M. Mariadason Histone Deacetylase 3 (HDAC3) and Other Class I HDACs Regulate Colon Cell Maturation and p21 Expression and Are Deregulated in Human Colon Cancer J. Biol. Chem., May 12, 2006; 281(19): 13548 - 13558. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fan, M. Zhan, J. Shen, J. L. Martindale, X. Yang, T. Kawai, and M. Gorospe En masse nascent transcription analysis to elucidate regulatory transcription factors Nucleic Acids Res., March 15, 2006; 34(5): 1492 - 1500. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Boyer, W. L. Allen, E. G. McLean, P. M. Wilson, A. McCulla, S. Moore, D. B. Longley, C. Caldas, and P. G. Johnston Pharmacogenomic identification of novel determinants of response to chemotherapy in colon cancer. Cancer Res., March 1, 2006; 66(5): 2765 - 2777. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-J. Kim, H. C. Kang, S.-G. Jang, K. Kim, S.-A Ahn, H.-J. Yoon, S. N. Yoon, and J.-G. Park Oligonucleotide microarray analysis of distinct gene expression patterns in colorectal cancer tissues harboring BRAF and K-ras mutations Carcinogenesis, March 1, 2006; 27(3): 392 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chowdary, J. Lathrop, J. Skelton, K. Curtin, T. Briggs, Y. Zhang, J. Yu, Y. Wang, and A. Mazumder Prognostic Gene Expression Signatures Can Be Measured in Tissues Collected in RNAlater Preservative J. Mol. Diagn., February 1, 2006; 8(1): 31 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Alazzouzi, V. Davalos, A. Kokko, E. Domingo, S. M. Woerner, A. J. Wilson, L. Konrad, P. Laiho, E. Espin, M. Armengol, et al. Mechanisms of Inactivation of the Receptor Tyrosine Kinase EPHB2 in Colorectal Tumors Cancer Res., November 15, 2005; 65(22): 10170 - 10173. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Alhopuro, H. Alazzouzi, H. Sammalkorpi, V. Davalos, R. Salovaara, A. Hemminki, H. Jarvinen, J.-P. Mecklin, S. Schwartz Jr., L. A. Aaltonen, et al. SMAD4 Levels and Response to 5-Fluorouracil in Colorectal Cancer Clin. Cancer Res., September 1, 2005; 11(17): 6311 - 6316. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. L. Allen and P. G. Johnston Role of Genomic Markers in Colorectal Cancer Treatment J. Clin. Oncol., July 10, 2005; 23(20): 4545 - 4552. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perathoner, D. Pirkebner, G. Brandacher, G. Spizzo, S. Stadlmann, P. Obrist, R. Margreiter, and A. Amberger 14-3-3{sigma} Expression Is an Independent Prognostic Parameter for Poor Survival in Colorectal Carcinoma Patients Clin. Cancer Res., May 1, 2005; 11(9): 3274 - 3279. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Ghadimi, M. Grade, M. J. Difilippantonio, S. Varma, R. Simon, C. Montagna, L. Fuzesi, C. Langer, H. Becker, T. Liersch, et al. Effectiveness of Gene Expression Profiling for Response Prediction of Rectal Adenocarcinomas to Preoperative Chemoradiotherapy J. Clin. Oncol., March 20, 2005; 23(9): 1826 - 1838. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Andersen, T. Heine, R. Sneve, I. Konig, H. E. Krokan, B. Epe, and H. Nilsen Incorporation of dUMP into DNA is a major source of spontaneous DNA damage, while excision of uracil is not required for cytotoxicity of fluoropyrimidines in mouse embryonic fibroblasts Carcinogenesis, March 1, 2005; 26(3): 547 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chan and D. J. Kerr Can we individualise chemotherapy for colorectal cancer? Ann. Onc., July 1, 2004; 15(7): 996 - 999. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |