Cancer Research Grants  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cuenca, A.
Right arrow Articles by Sotomayor, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cuenca, A.
Right arrow Articles by Sotomayor, E. M.
[Cancer Research 63, 9007-9015, December 15, 2003]
© 2003 American Association for Cancer Research


Immunology

Extra-Lymphatic Solid Tumor Growth Is Not Immunologically Ignored and Results in Early Induction of Antigen-Specific T-Cell Anergy

Dominant Role of Cross-Tolerance to Tumor Antigens

Alex Cuenca1, Fengdong Cheng1, Hongwei Wang1, Jason Brayer1, Pedro Horna1, Lingping Gu2, Harold Bien2, Ivan M. Borrello2, Hyam I. Levitsky2 and Eduardo M. Sotomayor1

1 Department of Interdisciplinary Oncology, H. Lee Moffitt Cancer Center and Research Institute at the University of South Florida, Tampa, Florida, and
2 Department of Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A better understanding of how solid malignancies arise in an immunocompetent host, avoid immune recognition, and ultimately progress to widely disseminated cancer is essential to effectively harness the immune system against solid tumors. Because of their extra-lymphatic localization, it has been proposed that solid malignancies are just ignored by the immune system, thereby allowing their uncontrolled growth and dissemination. Alternatively, as most of the solid tumors are unable to express costimulatory molecules, the "signal one without signal two" model of tolerance induction has been frequently evoked to account for the failure of the immune system to reject antigenic tumors in vivo. In this study, we showed, however, that the extra-lymphatic growth of solid tumors is not immunologically ignored by the lymphoid compartment, resulting instead in the early induction of antigen-specific CD4+ T-cell tolerance. Furthermore, analysis of parent-into-F1 bone marrow (BM) chimeras demonstrates that presentation of tumor antigens by BM-derived antigen-presenting cells represents the dominant mechanism in solid tumor-induced CD4+ T-cell tolerance. Our findings of early development of antigen-specific T-cell unresponsiveness mediated by BM-derived antigen-presenting cells, not only provides a plausible explanation for the failure of the immune system to reject antigenic solid tumors in vivo, but more importantly, they have identified a barrier that, if appropriately manipulated, may lead to approaches to effectively harness the immune system against solid malignancies.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Solid tumors, the most common form of malignancies in humans, remain largely incurable with the treatment modalities currently available. In recent years, a significant effort has been devoted to the development of novel therapeutic strategies against these malignancies (1, 2, 3) . The demonstration that immune cells are able to destroy chemotherapy-resistant tumor cells (4 , 5) , together with the better understanding of the mechanisms regulating immune responses (6 , 7) , has led to a renewed interest in immunotherapy as a potential noncross-resistant treatment modality for solid malignancies. However, before we can effectively harness the immune system against solid tumors, it is critical to better understand first how it is that these tumors arise in an immunocompetent host, outmaneuver immune recognition, and ultimately progress to widely disseminated cancer.

In recent years, several explanations have been proposed to account for the inability of the immune system to recognize and reject a malignant tumor. Among them, the immune ignorance and the immune tolerance mechanisms have gained particular attention. Given that most solid tumors form outside of the lymphoid organs, it has been proposed that the lack of tumor immunity is just the result of tumor cells being ignored by tumor-specific T cells residing in the lymphoid compartment (8 , 9) . Alternatively, it has been argued that a successful tumor growth in an otherwise immunocompetent host relates to the immune system "seeing" tumors more as self than as foreign, leading to the induction of unresponsiveness to tumor antigens in a fashion similar to the induction of peripheral tolerance to self-antigens (10 , 11) . Recent studies in mice in which T cells specific for tumor-associated antigens could be followed in vivo have indeed provided experimental evidence that the natural response of the immune system to tumor antigens seems to be the induction of T-cell tolerance rather than T-cell activation (12 , 13) .

Despite the demonstrated ability of solid malignancies to induce antigen-specific T-cell tolerance in vivo, none of the mechanisms proposed, to date, can completely and adequately explain how it is that these tumors may induce this state of unresponsiveness. For many years it has been postulated that tolerance to tumor antigens results from a direct encounter of antigen-specific T cells with tumor cells that are ill-equipped to provide the necessary signals for T-cell activation. Solid tumor cells, it is argued, can provide an antigen-specific signal through engagement of the T-cell receptor (TCR) (signal one) but lack the full complement of costimulatory signaling (signal two) required to yield a fully activated and functional T-cell response. According to this model therefore, in the absence of signal two, the direct encounter of solid tumor cells with antigen-specific T cells would result in the induction of T-cell anergy rather than T-cell activation (14 , 15) . Unfortunately, such an encounter in the case of nonlymphatic tumors would require that naïve T cells traffic beyond the circulatory and lymphatic vessels, a scenario quite unlikely to occur in vivo, because only activated T cells venture into the peripheral tissues.

In this study, we evaluated the relative contribution of either mechanism (immune ignorance versus immune tolerance) in influencing the fate of antigen-specific CD4+ T cells during the extra-lymphatic growth of solid tumors. The results of this analysis provided the following conclusions: (a) extra-lymphatic solid tumor growth is not immunologically ignored by the lymphoid compartment because antigen-specific CD4+ T cells isolated from the lymphoid organs of tumor-bearing mice lost their naïve phenotype and undergo clonal expansion in vivo; (b) despite lack of tumor invasion to the lymphoid organs—and therefore lack of a direct tumor-T-cell interaction—antigen-specific T cells are rendered tolerant early during tumor progression; (c) analysis of parent-into-F1 bone marrow (BM) chimeras demonstrates that solid tumor-induced T-cell tolerance requires presentation of tumor antigen by BM-derived antigen-presenting cells (APC) (cross-tolerance); and (d) the development of antigen-specific T-cell tolerance mediated by BM-derived APCs imposes a significant barrier to therapeutic vaccination against solid malignancies.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mice.
Six to 8-week-old male BALB/c, C57BL/6, or BALB/cxC57BL/6 F1 mice were obtained from the NIH (Frederick, MD). Male BALB/c severe combined immunodeficiency (SCID) or C57BL/6 SCID, ages 6–8 weeks, were purchased from The Jackson Laboratory (Bar Harbor, ME). TCR-transgenic mice expressing an {alpha}ß TCR specific for amino acids 110–120 from influenza hemagglutinin presented by I-Ed were a generous gift of Harold von Boehmer (16) . The transgenic mice used in these experiments were heterozygous for the transgene. TCR-transgenic mice (OT-II) expressing an {alpha}ß TCR specific for peptide 323–339 from ovalbumin (OVA) presented by MHC class II, I-Ab (17) were provided by Dr. William Heath (The Walter and Eliza Hall Institute of Medical Research, Victoria, Australia). All of the experiments involving the use of mice were performed in accordance with protocols approved by the Animal Care and Use Committees of the University of South Florida College of Medicine and Johns Hopkins University School of Medicine.

Tumor Cells.
Renal cell carcinoma cells (Renca) were obtained from the American Type Culture Collection (Manassas, VA). Cells were cultured in vitro in RPMI 1640, supplemented with 10% FCS, penicillin/streptomycin (50 units/ml), L-glutamine (2 mM), and 2-mercaptoethanol (50 mM; complete media), and were grown as an adherent population at 37°C, 5% CO2. DA3 mammary adenocarcinoma cells were kindly provided by Dr. Diana M. Lopez (University of Miami School of Medicine). These cells grow as an adherent population in DMEM supplemented with 10% FCS, 50 units/ml penicillin/streptomycin, and Oxaloacetate. Pyruvate, Insulin supplement (Sigma, St. Louis, MO). RencaHA was generated by calcium phosphate-mediated plasmid transfection with the construct pIHA, which encodes the HA molecule of the influenza virus A/PR/8/34 (H1N1; Ref. 18 ). Transfection of DA3 tumor cells with the construct pIHA was achieved using the Lipofectamine Plus Reagent (Invitrogen, Carlsbad, CA). RencaHA and DA3 tumor-expressing HA (DA3HA) were selected and grown in their respective complete media supplemented with the neomycin analogue G418 (400 µg/ml). All tumor cell lines are regularly checked for Mycoplasma and endotoxin levels, and they have shown to be free of contamination. HA expression by transfected tumor cells was determined by staining with the anti-HA-biotinylated antibody H-18 as described previously (18) . Expression of MHC class I molecules by transfected and nontransfected tumor cells was determined by staining with a FITC-conjugated anti-H-2Kd antibody (BD PharMingen, San Diego, CA). The expression of class II molecules was determined by staining with the biotinylated monoclonal antibody (MAb) 14.4.4 followed by phycoerythrin (PE)-conjugated streptavidin (Caltag, Burlingame, CA) and expression of B7.1 costimulatory molecules by staining with a FITC-conjugated anti-CD80 antibody (BD PharMingen). Ten thousand gated events were collected on a FACScan (Becton Dickinson, San Jose, CA) and analyzed using Flow-Jo software.

B16 melanoma cells (H-2b) transfected with Ovalbumin (B16-OVA) were kindly provided by Dr. Paolo Dellabona (Instituto San Rafaelle, Milan, Italy). These cells are routinely cultured in complete media supplemented with hygromycin (Sigma).

In Vivo Tumor Challenge.
Transfected tumor cells and their wild-type counterparts were detached from the culture flasks with trypsin (Sigma) and suspended in complete media. Tumor cells were counted, and viability was assessed by trypan blue exclusion. If viability was 100%, cells were washed three times in sterile HBSS and injected either i.v. (Renca tumors) or s.c. (DA3 and B16 tumors) in a total volume of 0.2 ml, 1 x 106 tumor cells/mouse. Tumor-free survival was determined by twice weekly inspection, and mice were euthanized after s.c. tumor development (DA3 mammary tumor and B16 melanoma). Renca-bearing mice were euthanized after the first sign of increased respiratory rate or decreased motion. These animals had the presence of tumors (lung nodules) confirmed at autopsy.

Adoptive Transfer of Antigen-Specific T Cells.
Single-cell suspensions were made from peripheral lymph nodes and spleen collected from TCR-transgenic donors. The percentage of lymphocytes double positive for CD4 and the TCR was determined by flow cytometry. Briefly, the percentage of anti-HA-transgenic CD4+ T cells was assessed by double staining with FITC-conjugated goat antimouse CD4 (Caltag) and biotinylated rat anticlonotypic TCR antibody MAb 6.5. Ten thousand gated events were collected on a FACScan (Becton Dickinson) and analyzed using Flow-Jo software. For those experiments involving adoptive transfer of anti-OVA CD4+ T cells (OT-II), the percentage of transgenic T cells was determined by staining with Cychrome-labeled antimouse CD4 (BD PharMingen), anti-V{alpha}2-PE, and anti-Vß5FITC antibodies (BD PharMingen). Cells were washed three times in sterile HBSS and injected into the tail vein of male recipients such that a total of 2.5 x 106 CD4+ anti-HA TCR+ T cells or anti-OVA OT-II-transgenic CD4+ T cells was transferred to each animal.

Reisolation of Transgenic T Cells after in Vivo Transfer.
Transgenic CD4+ T cells injected into tumor-free mice or tumor-bearing mice were reisolated from either the draining lymph nodes or the spleen of these animals on the days specified under each experimental design. In all experiments, unless otherwise noted, 3 mice/group were used. Each mouse was given a unique identification number so that the various measurements of T-cell function was correlated within an individual, as well as between mice in the same group or between groups. Briefly, to analyze the fate and function of antigen-specific transgenic CD4+ T cells present in the draining lymph nodes, the peritracheal, peribronchial, and mediastinal lymph nodes were harvested from tumor-free as well as from RencaWT- or RencaHA-bearing mice. Lymph nodes from 3 animals/group were pooled, and cell suspensions were made by passage over nylon mesh and centrifugation on a Ficoll gradient (Ficoll-Paque; Pharmacia Biotech, Uppsala, Sweden). Between 2 and 3 x 106 lymph node cells were obtained from the pooled samples of tumor-bearing mice and between 0.5 and 1 x 106 cells from tumor-free animals. T cells from the spleen of tumor-free or tumor-bearing mice were purified by passage through nylon mesh and centrifugation on a Ficoll gradient followed by passage through nylon wool. Optimization of this technique has allowed us to obtain at least 5 x 106 highly purified T cells/spleen.

The phenotypic and functional characteristics of antigen-specific CD4+-transgenic T cells reisolated from either the spleen or lymph nodes were analyzed as described below:

Flow Cytometric Analysis.
Purified T cells were stained with FITC-conjugated goat antimouse CD4 (Caltag) and biotinylated rat anticlonotypic TCR antibody MAb 6.5 followed by phycoerythrin-conjugated streptavidin (Caltag). For this analysis, 50,000 gated events were collected on a FACScan and analyzed using Flow-Jo software. Data represent the mean + SE of the percentage of cells expressing the clonotypic TCR. Background staining of splenocytes or lymph node cells from naive BALB/c mice was usually <0.10%. Expression of activation markers (CD44 and CD45Rb) on clonotype-positive cells reisolated from the spleen and draining lymph nodes was determined by three-color flow cytometric analysis. Cells were stained with Cychrome-labeled antimouse CD4 (BD PharMingen), biotinylated anti-TCR clonotype MAb 6.5 followed by phycoerythrin-labeled streptavidin, and either FITC-conjugated antimouse CD44 (BD PharMingen) or FITC-conjugated antimouse CD45RB (BD PharMingen). Live gating on CD4+ T cells was set and 100,000 events collected/sample.

Antigen-Specific Proliferation.
Purified T cells (4 x 104/well) from the different experimental groups were mixed with fresh splenocytes (8 x 104/well) from syngeneic mice to which either 12.5 µg/ml synthetic HA-peptide (amino acids 110–120, SFERFEIFPKE) or 3 µg of synthetic OVA-peptide (amino acids 323–339, ISQAVHAAHAEINEAGR) were or not added. Cells were pulsed with [3H]thymidine (1 mCi/well; Amersham, Arlington Heights, IL) after 3 days in culture. Cells were harvested 18 h later with a Packard Micromate cell harvester. Thymidine incorporation into DNA was measured as cpm on a Packard Matrix 96 direct ß counter. Data are calculated as cpm in the peptide-pulsed group minus cpm from cells cultured in medium alone divided by the number of clonotype-positive cells in the well as determined by fluorescence-activated cell sorting (FACS). Values (cpm) for T cells cultured in media alone (no peptide group) are usually <10% relative to the peptide-pulsed group. Values are displayed as the mean ± SE cpm/100 clonotype+ T cells/well.

Cytokine Release.
T cells purified and plated as above were cultured with media alone or cognate peptide (either HA-peptide or OVA-peptide) plus fresh syngeneic splenocytes. Forty-eight h later, supernatants are collected and stored at -70°C until assayed for interleukin (IL)-2 or IFN-{gamma} by ELISA (R&D Systems, Minneapolis, MN). Values for T cells cultured in media alone are usually <10% of the values for HA-stimulated T cells. Data represent pg/ml of the specific cytokine/100 clonotype-positive T cells/well.

Response to Vaccinia Antigens.
Normal BALB/c splenocytes were infected with wild-type vaccinia virus (3 plaque-forming units/cell) for 4 h. Infected cells were washed three times and then cultured with purified T cells from the different experimental groups at a stimulator/responder ratio of 2:1. [3H]Thymidine incorporation was determined after 3 days in culture. Values represent mean + SE of triplicate cultures. From a parallel plate, supernatants were collected after 48 h of T-cell stimulation with vaccinia antigens and assayed for IFN-{gamma} by ELISA.

In Vivo Immunization with Recombinant Vaccinia Construct Encoding-HA.
Vaccinia-HA was prepared as described previously (19) . On the days indicated for each particular experiment, mice were immunized by s.c. inoculation with 1 x 107 plaque-forming units of recombinant vaccinia encoding HA suspended in 0.1 ml of HBSS.

PCR of Lymph Nodes.
DNA was extracted from the lymph nodes of tumor-free and RencaHA-bearing mice by using the Qiamp Tissue kit (Qiagen, Chasworth, CA). HA-specific PCR was performed using the primers F and R. Isolated DNA was mixed with these primers, Taq enzyme, 1% Triton, and water. A total of 25 µl of this solution was mixed with 25 µl of Mßp Easy Start solution. Cycling conditions were 95°C for 5 min, 95°C for 1 min, 62°C for 2 min, and 72°C for 2 min. Positive control DNA was extracted from RencaHA tumor cells. As negative control, we used lymph nodes from tumor-free animals or RencaWT-bearing mice. Sequence for the F primer is GGATCTCGAGCTCAAGCTTAGCAAAAGCAGGGGAAAATAAAAACAACC and for the R primer is CTGCAGAATTCGGATCCGATGCATATTCTGCACTGCA. The PCR product is ~1.8 Kb. The sensitivity of this technique was determined by serial dilutions of RencaHA tumor cells with either 5 x 106 RencaWT cells or normal splenocytes, and it was able to detect one RencaHA tumor cell in 1 x 105 cells.

Construction of BM-Chimeric Mice.
The femurs and tibiae from either BALB/c SCID mice or C57B6/SCID mice were obtained, and BM cells were harvested by flushing the bones with RPMI at 4°C. Single-cell suspensions were obtained by passing BM cells through a cell strainer (Becton Dickinson, Franklin Lakes, NJ). Cells were washed three times in sterile HBSS, and 4 x 106 BM cells from either BALB/c SCID mice (H-2d) or C57BL/6 SCID mice (H-2b) were injected into the tail vein of irradiated (1000 rads) BALB/c x C57BL/6 F1 (H-2dxb) recipients. Three months after BM transplant, one mouse from each group was sacrificed to assess donor chimerism by flow cytometry as described previously (20) . Briefly, splenocytes were stained for I-Ed and I-Ab using the MAb 14.4.4 and MAb Y3P, respectively, followed by FITC-goat-antimouse IgG2a secondary antibody (data not shown).

For the adoptive transfers of anti-HA-specific CD4+ T cells into the chimeric mice, we mated the BALB/c TCR transgenics to C57BL/6 mice to generate H-2dxbF1 TCR-transgenic offspring. It is necessary to use F1 TCR-transgenic donors to ensure that any nontransgenic T cells that are transferred into the chimeras are not alloreactive to the recipient resulting in graft versus host reaction. Furthermore, the transgenic donor population was obtained from the thymus of H-2dxb F1 TCR-transgenic animals to avoid any contaminating MHC class II-bearing APCs. CD8+ T cells and double negative thymocytes were depleted using the antibodies 3.155 and J.11.d.2, respectively. The percentage of T cells doubly positive for CD4 and the clonotypic TCR was determined by flow cytometry as described above. Then, 1 x 106 CD4+ anti-HA TCR+ T cells were injected into the tail vein of immune-reconstituted chimeric mice. Clonotypic CD4+ T cells injected into tumor-free chimeric mice or mice challenged with RencaHA tumors (1 x 106 tumor cells) were reisolated from the spleen or lymph nodes of these animals on the days specified under each experimental design. Then, their phenotypic and functional characteristics were evaluated as described above.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Phenotypic Characteristics of Renca Tumors.
To study antigen-specific T-cell responses to a model antigen expressed by solid tumors, we first transfected Renca tumor cells with the construct pIHA, which encodes the HA molecule of the influenza virus A/PR/8/34 (H1N1). A stable transfectant (RencaHA) was selected, expanded, and its phenotypic characteristics were evaluated by FACS analysis. As shown in Fig. 1ACitation , RencaHA and RencaWT tumor cells express similar levels of MHC class I molecules but neither expression of MHC class II molecules nor the costimulatory molecule CD80 were detected by FACS analysis. Expression of HA protein by RencaHA tumor cells was demonstrated by staining with the anti-HA antibody H-18 (Fig. 1ACitation , HA-hatched histogram), as well as by culture of irradiated RencaHA tumor cells with a CD8+ T-cell clone specific for a Kd-restricted peptide epitope of HA (18) . Indeed, these CD8+ T cells produced IL-2 after in vitro incubation with RencaHA tumor cells, whereas no cytokine was detected in the supernatants of T cells cultured with RencaWT tumor cells (Fig. 1B)Citation . Intravenous injection of either RencaWT or RencaHA into BALB/c mice resulted in tumor progression with similar kinetics (Fig. 1C)Citation .



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Phenotypic characteristics of Renca tumors. A, RencaHA tumor cells (hatched histogram) or RencaWT cells (shaded histogram) were stained for the expression of MHC class I, MHC class II molecules, and the costimulatory molecule B7.1 (CD80) as indicated in "Materials and Methods." HA-expression was determined by staining with the anti-HA antibody H-18. Ten thousand gated events were collected on a FACScan and analyzed using Flow-Jo software. Isotype control staining is shown as open histogram. B, IL-2 production by CD8+ T cells specific for a Kd-restricted epitope of HA. A total of 1 x 105 CD8+ T cells was cultured with a similar number of irradiated RencaWT or RencaHA tumor cells. After 24 h, supernatants were collected and assayed for IL-2 by ELISA. C, kinetics of growth of Renca tumors. BALB/c mice were injected i.v. with 1 x 106 RencaWT or RencaHA tumor cells on day 0 and were inspected twice weekly for tumor development. Mice were euthanized at the first sign of increased respiratory rate or decreased motion. Animals had the presence of tumors confirmed at autopsy (lung nodules). Ten mice were included in each group.

 
Extra-Lymphatic Growth of RencaHA Tumor.
In previous studies, we have demonstrated that i.v. injection of RencaWT or RencaHA cells into BALB/c mice resulted in growth of multiple pulmonary malignant nodules, but no obvious metastasis were found in the lymph nodes or the spleen of tumor-bearing mice (19) . To further confirm the absence of RencaHA tumor cells in the lymphoid organs of tumor-bearing mice, we used HA-specific primers for PCR analysis of lymph nodes isolated from these animals. As shown in Fig. 2Citation , no HA-signal was detected in the thoracic lymph nodes from RencaHA-bearing mice (Tum LN 1 and 2). Similarly, absence of RencaHA tumor cells in the spleen of these animals was confirmed by PCR analysis (data not shown). Lack of detection of RencaHA cells in lymphoid organs was not caused by a complete loss of HA expression by tumor cells because FACS analysis of RencaHA cells isolated from the lung nodules of these same animals shows lower but still detectable levels of HA-expression (data not shown).



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. PCR analysis of thoracic lymph nodes from tumor-bearing mice. BALB/c mice were given 1 x 106 RencaHA tumor cells i.v. Ten days later, all mice, including a group not challenged with tumor, received 2.5 x 106-transgenic CD4+ T cells. Mice were sacrificed on day +8 after T-cell transfer, and the thoracic lymph nodes were harvested. DNA was extracted from the thoracic lymph nodes of tumor-free (Nl LN) and RencaHA-bearing mice (Tu LN). HA-specific PCR analysis was then performed as described in "Materials and Methods." As a positive control, we used DNA extracted from RencaHA tumor cells (percentage of RencaHA cells).

 
Extra-Lymphatic RencaHA Growth Is Not Immunologically Ignored by Tumor-Specific CD4+ T Cells Residing in Draining Lymph Nodes.
The availability of tumor cells expressing a model antigen (HA) and an identifiable population of anti-HA/I-Ed-transgenic CD4+ T cell enabled us, therefore, to assess the fate and function of antigen-specific T cells during the extra-lymphatic growth of a solid malignancy in vivo. On the basis of the adoptive transfer system reported by Kearny et al. (21) , anti-HA/I-Ed-transgenic CD4+ T cells were transferred into tumor-free BALB/c mice or mice with established RencaWT or RencaHA tumors. Eight days after T-cell transfer, mice were sacrificed, and the phenotypic and functional characteristic of clonotype-positive CD4+ T cells reisolated from the thoracic lymph nodes of these mice was determined. As seen in Fig. 3ACitation , a significant expansion of clonotype-positive CD4+ T cells was found only in the draining lymph nodes of RencaHA-bearing mice relative to mice bearing RencaWT or tumor-free mice (4, 0.85, and 0.80%, respectively). After the first week, this percentage declined, and by 22 days after T-cell transfer, the percentage of clonotype-positive cells in the draining lymph nodes of RencaHA-bearing mice approached the baseline level present in the other groups (data not shown). Although the percentage of clonotype-positive T cells in mice bearing RencaHA declined after an initial expansion, their complete elimination was never observed, even at later time points in the face of an extensive tumor burden.



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Phenotypic and functional analysis of HA-specific CD4+ T cells isolated from the draining lymph nodes of Renca-bearing mice. BALB/c mice were given either 1 x 106 RencaHA or RencaWT tumor cells i.v. Ten days later, all mice, including a group not challenged with tumor, received 2.5 x 106-transgenic CD4+ T cells. Mice were sacrificed 8 days after T-cell transfer, and the thoracic lymph nodes from 3 animals/group were harvested and pooled. A, lymph node cells were analyzed by two-color flow cytometry staining for CD4 versus anti-HA TCR clonotype as indicated in "Materials and Methods." Values represent mean ± SE of the percentage of double positive T cells. B, purified T cells from the thoracic lymph nodes of tumor free, RencaWT, and RencaHA were stained with Cychrome-labeled antimouse CD4, biotinylated anti-TCR clonotype monoclonal antibody 6.5 followed by phycoerythrin-labeled streptavidin and FITC-conjugated antimouse CD44. Live gating on CD4+ T cells was set, and 100,000 events were collected/sample. Mean fluorescence intensity ± SE is shown. C, representative fluorescence-activated cell sorting profile of CD45Rb and CD44 expression by anti-HA CD4+ T cells isolated from the lymph nodes of Renca-bearing mice. Purified T cells were stained as described in "Materials and Methods." Shaded histograms in each figure correspond to clonotype-positive T cells from RencaWT-bearing mice. Open histograms correspond to clonotype-positive T cells from RencaHA. D, lymph node cells (4 x 104/well) were mixed with fresh BALB/c splenocytes to which HA-peptide (12.5 µg/ml) was added. [3H]Thymidine incorporation was assayed after 3 days of incubation and is shown as mean ± SE cpm/100 clonotype-positive T cells/well. E, in a parallel plate, lymph node cells were cultured with fresh splenocytes and HA-peptide as indicated above. Forty-eight h later, supernatants were collected and assayed for IL-2 by ELISA. Data represent mean ± SE of triplicate cultures and is expressed as the amount of cytokine produced/100 clonotype-positive T cells. Shown is a representative experiment of three independent experiments with similar results.

 
Three-color flow cytometric analysis of clonotype-positive CD4+ T cells was performed to address whether phenotypic changes associated with antigen recognition occur in the draining lymph nodes of RencaHA-bearing mice. An increase in the expression of CD44 was observed on HA-specific transgenic T cells in RencaHA-bearing mice (mean fluorescence: 300) relative to RencaWT (mean fluorescence: 119) and nontumor-bearing mice (mean fluorescence: 90; Fig. 3BCitation ). A FACS profile displaying this increased CD44 expression on antigen-specific CD4+ T cells reisolated from RencaHA-bearing mice, compared with antigen-specific CD4+ T cells from RencaWT, is shown in Fig. 3CCitation . Clonotype-positive T cells isolated from RencaHA-bearing mice also display a decreased expression of CD45Rb, indicative that these T cells have encountered HA-antigen in vivo and have lost their naïve phenotype (Fig. 3C)Citation . It should be point that these phenotypic changes in antigen-specific T cells from RencaHA-bearing mice occurred in the absence of tumor metastasis to the lymphoid organs as determined by PCR evaluation.

Despite this initial expansion of HA-specific CD4+ T cells in RencaHA-bearing mice and loss of the naive phenotype, T cells from this group are functionally impaired, as determined by their diminished antigen-specific proliferation (Fig. 3D)Citation and IL-2 production (Fig. 3E)Citation , as compared with the functional responses of T cells from either tumor-free or RencaWT-bearing mice.

Taken together, the extra-lymphatic growth of RencaHA tumors is not immunologically ignored and results in a loss of the naïve phenotype and functional impairment of antigen-specific CD4+ T cells residing in the draining lymph nodes of tumor-bearing mice.

Induction of T-Cell Unresponsiveness in Vivo Is Not a Unique Characteristic of Renca Tumors.
To assess whether the induction of T-cell unresponsiveness is a common feature of solid malignancies and not a unique characteristic of Renca tumors, we analyzed the fate and function of antigen-specific CD4+ T cells during the growth of DA3 mammary tumor and B16-melanoma tumors. DA3 is a well-characterized tumor cell line derived from the D1–7,12-dimethylbenz(a)anthracene-3 mammary tumor syngeneic to BALB/c mice (22 , 23) . DA3HA was generated by Lipofectamine transfection of wild-type mammary tumor cells. Similar to our findings in the RencaHA tumor model, the s.c. growth of DA3HA mammary tumor is not ignored by the immune system and also led to the induction of antigen-specific T-cell unresponsiveness. As seen in Fig. 4ACitation , growth of DA3HA tumor cells resulted in increased percentage of antigen-specific CD4+ T cells in the spleen of tumor-bearing mice. Such an effect, indicative of tumor antigen recognition in vivo, occurred in the absence of DA3HA tumor metastasis to the spleen as determined by PCR analysis using HA-specific primers (data not shown). Despite this expansion however, antigen-specific T cells from DA3HA-bearing mice were found to be unresponsive as ascertained by their blunted proliferative response to HA-peptide in vitro (Fig. 4B)Citation .



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Changes in antigen-specific CD4+ T cells isolated from the spleen of mammary tumor- or melanoma-bearing mice. BALB/c mice were given 2.5 x 106 anti-HA CD4+-transgenic T cells i.v. Ten days later, mice were challenged with either 1 x 106 DA3-WT or DA3-HA tumor cells given s.c. or received no tumor. Twelve days later, mice were sacrificed, and T cells were isolated from their spleen as indicated in "Materials and Methods." A, purified T cells were analyzed by two-color flow cytometry staining for CD4 versus anti-HA TCR clonotype as in Fig. 3Citation . Values represent mean ± SE of the percentage of double positive T cells. Shown is a representative experiment of three independent experiments with similar results. B, HA-specific proliferation was determined as in Fig. 3Citation . Data represent mean ± SE cpm/100 clonotype-positive T cells/well. C, C57BL/6 mice were given 2.5 x 106 anti-ovalbumin (OVA) -transgenic CD4+ T cells i.v. Seven days later, mice were challenged s.c. with either 1 x 106 B16-WT- or B16-OVA-expressing tumor cells or received no tumor. On day +7 after tumor challenge, all of the animals were sacrificed, and T cells were isolated from their spleen. Then, 5 x 104-purified T cells were cultured with fresh splenocytes from C57BL/6 mice in the presence or not of 3 µg/ml ovalbumin-peptide 323–339. Forty-eight h later, supernatants were collected and assayed for IL-2 by ELISA. Data represent mean ± SE of triplicate wells and is representative of two independent experiments.

 
The induction of antigen-specific CD4 T-cell unresponsiveness is not restricted to solid tumors expressing HA as a model tumor antigen. Indeed, CD4+ T cells expressing an {alpha}ß TCR specific for OVA-peptide323–339 (OT-II-transgenic T cells) reisolated from the spleen of B16-OVA-bearing mice were also functionally impaired (Fig. 4C)Citation , as determined by their significantly diminished IL-2 production relative to the responses of antigen-specific T cells from either tumor-free or B16-WT-bearing mice.

Therefore, a common feature of solid tumor growth is the induction of CD4+ T-cell unresponsiveness, which is antigen specific, occurs in the absence of tumor invasion to the lymphoid organs, and it is established early during the growth of a variety of solid malignancies.

Cross-Presentation of Tumor Antigens by BM-Derived APCs Is Responsible for the Induction of T-Cell Tolerance during Solid Tumor Growth.
The above findings of induction of CD4+ T-cell unresponsiveness in the absence of metastasis to the lymphoid organs suggest that cells other than tumor cells themselves may carry the tumor antigens from the extra-lymphatic site to the lymphoid organs and be responsible for tolerance induction. Given the increasing evidence supporting a central role for host BM-derived APCs in the induction of peripheral tolerance to self-antigens (24, 25, 26, 27) , we evaluated next whether these cells may also be responsible for tolerance to tumor antigens expressed by solid malignancies. To assess the relative contribution of BM-derived APCs, we compared T-cell recognition of a model tumor antigen (HA) in two sets of BM chimeras. In the first set (H2dSCID->H2dxb), the host’s APCs express the restricting element (I-Ed) required for presentation of the model antigen to TCR-transgenic T cells, whereas in the second set (H2bSCID->H2dxb), they do not. After immune reconstitution, anti-HA TCR-transgenic CD4+ T cells from H2dxb F1 donors were transferred to both sets of chimeras, which were then challenged—or not—with RencaHA tumor. With this experimental design, if tolerance induction requires tumor-antigen presentation by BM-derived cells, T-cell unresponsiveness would only be seen in chimeras in which the APCs express the required restricting element (H2dSCID->H2dxb). As shown in Figs. 5Citation and 6Citation , tumor antigen processing and presentation by host’s APCs is absolutely required for the development of antigen-specific CD4+ T-cell tolerance. Indeed, a significant clonal expansion of HA-specific T cells was observed in the spleen of H2d->H2dxb tumor-bearing mice relative to their tumor-free counterparts (4.36 versus 1.15%, respectively; Fig. 5Citation ). This clonal expansion was even more dramatic in the draining lymph nodes of H2d->H2dxb tumor-bearing chimera as compared with tumor-free chimera (13.7% HA-specific T cells versus 0.14%, respectively; Fig. 5Citation , bottom panel). In sharp contrast, no change in the percentage of clonotypic CD4+ T cells was observed in the spleen of H2b->H2dxb tumor-bearing chimeras (where host’s APCs cannot present antigen) relative to tumor-free H2b->H2dxb chimeras (1.09 versus 1.08% respectively; Fig. 5Citation , top panel). Similarly, no change in the percentage of clonotypic T cells was observed in the thoracic lymph nodes of H2b->H2dxb tumor-bearing chimeras (data not shown).



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Changes in clonotype-positive T cells in H-2d->H-2dxb tumor-bearing chimeras. Three months after bone marrow reconstitution, H-2b SCID->H-2dxb (top panel) or H-2d SCID->H-2dxb chimeras (bottom panel) received i.v. 1 x 106 anti-HA CD4+ TCR-transgenic T cells from H-2dxb (F1) donors. One day later, half the animals in each set of chimeras were challenged with 1 x 106 RencaHA tumor cells given i.v. On day +8 after tumor challenge, all of the animals were sacrificed, and purified T cells from the spleen or the thoracic lymph nodes were analyzed by two-color flow cytometry staining for CD4 versus anti-HA TCR clonotype (monoclonal antibody 6.5) as in Fig. 3Citation . Three mice were included/group. Shown are representative fluorescence-activated cell sorting plots from individual mice in each group. Top right quadrant numbers: percentage of double positive T cells.

 


View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Solid tumor-induced antigen-specific CD4+ T-cell tolerance requires tumor antigen presentation by bone marrow-derived APCs. Three months after bone marrow reconstitution, H-2d SCID->H-2dxb (left panel) or H-2b SCID->H-2dxb chimeras (right panel) received 1 x 106 anti-HA CD4+ TCR-transgenic T cells i.v. One day later, half the animals in each set of chimeras were challenged with 1 x 106 RencaHA tumor cells given i.v. On day +8 after tumor challenge, all of the animals were sacrificed, and T cells were purified from their spleens as described in "Materials and Methods." A, purified splenic T cells from tumor-free or tumor-bearing chimeras were stained with Cychrome-labeled antimouse CD4, biotinylated anti-TCR clonotype monoclonal antibody 6.5 followed by phycoerythrin-labeled streptavidin and FITC-conjugated antimouse CD45Rb as in Fig. 3Citation . Mean fluorescence intensity ± SE is shown (2 mice/group). B, in vitro proliferative response of clonotype-positive T cells to stimulation with HA110–120 peptide. Purified T cells (4 x 104/well) from tumor-free (no tumor) or tumor-bearing chimeras (RencaHA) were mixed with fresh splenocytes (8 x 104/well) from F1 mice to which HA peptide (100 µg/ml) was added. [3H]Thymidine incorporation was assayed and is shown as cpm from which values for medium alone were subtracted. Values represent the mean of the cpm/100 clonotype-positive T cells/well from 3 mice in each group. C, purified T cells (4 x 104/well) were mixed with fresh splenocytes (8 x 104/well) from naive F1 mice to which HA peptide (100 µg/ml) were added. Forty-eight h later, supernatants were collected and assayed for IL-2 by ELISA. Data represent mean + SE of the cpm/100 clonotype-positive T cells/well from 3 mice in each group. Shown is a representative experiment of two independent experiments with similar results.

 
FACS analysis of activation/memory markers on clonotype+ CD4+ T cells revealed that T cells from the spleen of H2d->H2dxb tumor-bearing chimeras had decreased expression of CD45Rb as compared with T cells from tumor-free chimeras, indicative of having encountered HA-antigen in vivo. (Fig. 6ACitation , left panel). In sharp contrast, T cells from H2b->H2dxb tumor-bearing chimeras displayed similar expression of CD45Rb as compared with T cells from tumor-free mice (Fig. 6ACitation , right panel).

Despite the significant expansion of HA-specific CD4+ T cells in H2d->H2dxb tumor-bearing chimeras (Fig. 5)Citation , T cells from this group had a decreased proliferation (Fig. 6BCitation , left panel) and are unable to produce IL-2 (Fig. 6CCitation , left panel) in response to HA-peptide. Therefore, as previously observed in a syngeneic BALB/c system (12) , antigen-specific CD4+ T cells from H2d->H2dxb tumor-bearing chimeras were rendered unresponsive during RencaHA progression. In sharp contrast, CD4+ HA-specific T cells remained responsive in H2b->H2dxb tumor-bearing chimeras. In fact, the persistence of their naïve phenotype (Fig. 6ACitation , right panel) together with their normal proliferative response (Fig. 6BCitation , right panel) and IL-2 production (Fig. 6CCitation , right panel) after HA-stimulation in vitro is consistent with CD4+ HA-specific T cells never having encountered antigen in vivo.

Therefore, because T-cell tolerance is only seen in the H2d->H2dxb chimeras but not in the H2b->H2dxb chimeras (which lack the appropriate APC population), the induction of this state of unresponsiveness requires APCs that uptake antigens shed from the extra-lymphatic solid tumor, followed by migration of these cells to the lymphoid organs for presentation of processed antigenic peptides to antigen-specific T cells.

Induction of Tolerance to Tumor Antigens by BM-Derived APCs Limits the Efficacy of Therapeutic Vaccination.
Tumor antigen-specific CD4+ T cells are central in orchestrating an effective and sustained antitumor response (13 , 28, 29, 30) . Our findings that BM-derived APCs can induce unresponsiveness of these critical T cells may have sobering implications for the continued development of effective cancer immunotherapy. Indeed, as shown in Fig. 7Citation , antigen-specific CD4+ T cells from RencaHA-bearing mice were found to be unresponsive to a potent immunogen such as a recombinant vaccinia-encoding influenza hemagglutinin (vacc-HA). Briefly, tumor-free animals or RencaHA-bearing mice were immunized at two different intervals after T-cell transfer (early vaccination: day +2; late vaccination: day +16). Six days after either immunization (days +8 and +22, respectively), animals were sacrificed, and the percentage and function of CD4+ T cells were determined. Immunization of tumor-free mice resulted in a significant expansion of clonotype-positive CD4+ T cells in the spleen of these animals (Fig. 7ACitation , no tumor). Reminiscent of our findings in the draining lymph nodes of RencaHA-bearing mice (Fig. 3)Citation , the percentage of clonotype-positive T cells was also increased in the spleen of unimmunized tumor-bearing mice (Fig. 7ACitation : day +8, {blacksquare}). Strikingly, immunization of RencaHA-bearing mice with vacc-HA failed to induced an additional expansion of HA-specific T cells (Fig. 7ACitation : day +8, cross-hatched bar).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Cross-tolerance to tumor antigens limits the efficacy of therapeutic immunization. BALB/c mice were given 1 x 106 RencaHA tumor cells i.v. Ten days later, all mice, including a group not challenged with a tumor, received 2.5 x 106-transgenic T cells. Half the mice in each group were immunized with 1 x 107 plaque-forming units of vaccinia encoding influenza hemagglutinin (vacc-HA) s.c. on day 2 (early vaccination) or day 16 after T-cell transfer (late vaccination). Animals were sacrificed for analysis 6 days after immunization (days +8 and +22, respectively). A, purified T cells from the spleen of unimmunized and vacc-HA-immunized animals were analyzed by two color flow cytometry staining for CD4 versus anti-HA TCR clonotype as in Fig. 3Citation . Values represent mean ± SE of percentage of T cells expressing the clonotypic TCR. T cells were cultured with media alone or HA peptide (12.5 µg/ml) plus fresh BALB/c splenocytes, and 48 h later, supernatants were collected and assayed for IFN-{gamma} (B) and IL-2 (C) by ELISA. Data represent mean + SE of triplicate cultures from 4 animals in each group and are expressed as the amount of cytokine produced/100 clonotype-positive T cells. Values for T cells cultured in media alone were <10% of the values for stimulated T cells. Shown is a representative experiment of four independent experiments with similar results.

 
T cells from tumor-free mice primed with vacc-HA in vivo release IFN-{gamma} upon in vitro culture with HA-peptide (Fig. 7B)Citation . This response was almost absent in mice bearing RencaHA, even when immunization with vacc-HA occurred as early as 2 days after T-cell transfer and assayed 6 days later (Fig. 7BCitation : RencaHA, day +8). Although incubation with HA peptide resulted in measurable IL-2 release even in the absence of in vivo priming with vacc-HA, this response was also decreased in the RencaHA-bearing mice (Fig. 7CCitation : day +8).

As expected, analysis of the response of antigen-specific T cells to late vaccination (day +16 after T-cell transfer) reveals that although clonotype-positive T cells are still present in the spleen of tumor-bearing mice, they are now fully unresponsive to immunization (Fig. 7Citation : day +22). Indeed, clonotype-positive T cells failed to expand in response to vacc-HA immunization (Fig. 7A)Citation and display a blunted IFN-{gamma} (Fig. 7B)Citation and IL-2 production (Fig. 7C)Citation upon restimulation with HA-peptide in vitro. This unresponsive state was associated with a lack of antitumor response to vaccination because RencaHA grew with similar kinetics in untreated as well as vaccinated tumor-bearing mice (data not shown).

This lack of response to therapeutic immunization was not the result of a global immunosuppression induced by solid tumor growth because at the time that clonotype-positive T-cells in RencaHA-bearing mice were already anergic, the other elements of the T-cell repertoire were still fully responsive to vaccinia antigens (Table 1)Citation . Indeed, although the T-cell proliferative response to HA peptide was again diminished in RencaHA-bearing mice relative to tumor-free mice (33,540 versus 64,797 cpm, respectively), these same mice had a proliferative response to vaccinia antigens that was equivalent to nontumor-bearing mice primed with vacc-HA (103,297 versus 106,101 cpm, respectively). Furthermore, at the time that clonotype-positive T cells from RencaHA were profoundly impaired in their ability to produce IFN-{gamma} (170 versus 1603 pg/ml in tumor-free mice), the other elements of the T-cell repertoire were still responsive to immunization with vaccinia antigens, as determined by their production of IFN-{gamma} in similar amounts to T cells from tumor-free mice (4757 ± 805 and 6348 ± 540 pg/ml, respectively).


View this table:
[in this window]
[in a new window]

 
Table 1 Response of T cells to vaccinia-encoding influenza hemagglutinin immunization

BALB/c mice were given 1 x 106 RencaHA tumor cells i.v. or received no tumor. Ten days later, all mice received 2.5 x 106 anti-HA-transgenic T cells. Sixteen days after T-cell transfer, all mice were immunized with vaccinia-encoding influenza hemagglutinin. On day +22 after T-cell transfer, mice were sacrificed, and T cells were purified from their spleens as described in "Materials and Methods." A total of 4 x 104 purified T cells/well was added to BALB/c splenocytes (8 x 104/well) and cultured with media alone (none) or with the indicated stimulation. [3H]Thymidine incorporation was determined after 3 days in culture. Values represent mean ± SE of triplicate cultures. In a parallel plate, T cells were stimulated as above for 48 h and then supernatants were assayed for IFN-{gamma} by ELISA.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
These findings demonstrate that the extra-lymphatic growth of solid tumors is not ignored by the immune system. Instead, active induction of antigen-specific CD4+ T-cell tolerance develops in the lymphoid compartment of tumor-bearing hosts. The induction of this state of unresponsiveness requires BM-derived APCs that take up antigens shed from the extra-lymphatic solid tumor, followed by migration of these cells to the lymphoid organs for presentation of processed antigenic peptides to antigen-specific T cells (cross-tolerance).

Solid malignancies, being tumors derived from epithelial or mesenchymal cells, are mainly localized, at least early during their development, outside the secondary lymphoid organs. This extra-lymphatic localization of solid tumors, beyond the reach of the adaptive immune system, has been recently offered as a potential explanation for their successful growth in an otherwise immunocompetent host. In the absence of tumor invasion to lymphoid organs, it is argued tumor-specific T cells remain largely ignorant to the extra-lymphatic presence of the tumor (8 , 9 , 31) . In this study, however, we have demonstrated that in the absence of any detectable metastases to lymphoid organs, antigen-specific CD4+ T cells nonetheless lose their naïve phenotype and are functionally impaired in tumor-bearing mice. This lack of immune ignorance to tumor antigens is reminiscent of previous studies showing that extra-lymphatic growth of a panel of murine solid tumors is also associated with loss of the naïve phenotype and functional changes in antigen-specific CD8+ T cells residing in the draining lymph nodes of tumor-bearing mice (32, 33, 34, 35, 36) . Notably, the functional outcome of these antigen-specific CD8+ T cells was, however, quite different to the outcome observed in our studies with antigen-specific CD4+ T cells. Although presentation of tumor antigens to antigen-specific CD8+ T cells resulted in productive responses (35 , 37) , similar presentation of tumor antigens to CD4+ T cells led instead to tolerance induction (Fig. 7)Citation . Therefore, early during solid tumor development and long before tumor invasion to the lymphoid organs occurs, antigen-specific T cells are either activated (CD8+ T cells) or rendered anergic (CD4+ T cells), but they definitively do not remain ignorant to the extra-lymphatic growth of solid malignancies.

In the immune response to tumors, multiple immune effector mechanisms are recruited to participate in tumor rejection. However, it is the T-cell arm of the response that achieves tumor specificity and CD4+ T cells in particular that orchestrate an effective and sustained antitumor effect of both antigen-specific as well as nonspecific elements of the tumoricidal response (28, 29, 30) . Given this central role of CD4+ T cells in the overall antitumor responses, our demonstration that CD4+ T-cell tolerance ensues early during solid tumor development may provide an alternative explanation for the successful growth of these tumors in an immunocompetent host. Although cross-presentation of tumor antigens early during tumor development may induce activation of tumor antigen-specific CD8 T cells, such an event, in the absence of antigen-specific CD4+ T-cell help, may be unlikely to control tumor growth and/or prevent metastasis to lymphoid organs. Indeed, Nelson et al. (38) have recently shown that tumor progression occurs despite efficient tumor antigen cross-presentation and activation of tumor antigen-specific CTLs residing in draining lymph nodes of tumor-bearing mice. Similarly, in a tumor model of spontaneously arising insulinomas expressing a defined tumor-associated antigen (Rat Insulin Promoter-tag 2 model), the presence of nontolerized tumor-specific CD8+ T cells at a significantly high frequency was not sufficient to prevent tumor development and progression (36) . Conversion from a nonproductive to effective antitumor CD8+ T-cell responses could be achieved, however, only when sufficient help was provided to antigen-specific CD8+ T cells by activated antigen-specific CD4+ T cells (13) . Unfortunately, such help would be either absent or provided in insufficient amounts by antigen-specific CD4+ T cells that are being or have been already rendered unresponsive at early stages of solid tumor development (Figs. 3Citation and 4Citation ). It is plausible, therefore, that this absence of functional tumor-antigen-specific CD4+ T cells may represent the initial step in a cascade of immunological events associated with tumor invasion to lymphoid organs. In the absence of "help," other elements of the antitumor immune responses may not be recruited and/or be fully activated, allowing for the successful invasion and establishment of tumor cells in secondary lymphoid organs.

That CD4+ T cells become rapidly nonresponsive to antigens expressed by solid tumors is an important observation, but it is equally important to determine how these T cells encounter antigen in the first place. As previously mentioned, one hypothesis proposes that T cells first encounter tumor antigens when malignant cells metastasize to the lymphoid organs. Given the inability of most solid tumors to provide the full complement of costimulatory signaling (signal two), such a direct tumor-T-cell encounter has been postulated to result in the induction of T-cell tolerance rather than T-cell activation (14 , 15) . However, as unambiguously shown in this study, both the encounter of tumor antigens and the induction of antigen-specific CD4+ T-cell tolerance occurs in the absence of obvious tumor metastasis to the lymphoid organs, pointing to cells other than tumor cells themselves as being responsible for tumor antigen presentation and tolerance induction in tumor-bearing mice. Our results using parent-into-F1 BM chimeras provide indeed an alternative explanation for the induction of antigen-specific T-cell tolerance during the growth of solid malignancies. Reminiscent of previous studies highlighting the critical role of BM-derived APCs in the induction of tolerance to self-antigens (24, 25, 26, 27) , we have demonstrated that tolerance to antigens expressed by solid malignancies requires processing and presentation of tumor antigens by BM-derived APCs. The recent demonstration that BM-derived APCs are also critical in the induction of tolerance to tumor antigens expressed by B-cell lymphomas (20) indicates that the intrinsic APC capacity of tumor cells has little influence over T-cell priming versus tolerance, a critical decision that is regulated at the level of BM-derived APCs.

It is now well established that BM-derived APCs play an important role in initiating productive T-cell responses against malignancies (34 , 39 , 40) . Our demonstration, however, that these same cells are also required for the induction of antigen-specific T-cell tolerance to tumor antigens places APCs at the crossroads of immune activation versus immune tolerance. A potential explanation for this dual function of APCs is that perhaps a specialized subset of APCs could preferentially induce tolerance (26 , 41 , 42) while a different subpopulation may be responsible for T-cell priming. Alternatively, it is plausible that the differentiation and/or activation state of the APC population at the time of antigen presentation may represent the central determinant of T-cell priming versus tolerance (27 , 43, 44, 45) . APCs encountering the antigen in the context of inflammation or tissue destructive process, such as those that occur during viral or bacterial infection, most likely will be fully activated and therefore capable of triggering productive antigen-specific T-cell responses. Conversely, in the steady state (absence of inflammation), a host’s APCs may capture antigens in the periphery and then migrate to the lymphoid organs for presentation of the antigen to antigen-specific T cells in a tolerogenic fashion. Although this APC-T-cell encounter resulted in increased number of antigen-specific T cells, (Figs. 3ACitation and 5Citation ), these cells, on a per cell basis, are significantly impaired in their ability to produce IL-2 (Figs. 3ECitation and 6CCitation ). That such "partial activation" state is ultimately followed by the development of T-cell unresponsiveness (Fig. 7)Citation suggests that in the absence of inflammatory signals capable of fully activate APCs and/or able of sustain an ongoing T-cell response, the normal default of a T-cell encounter with tumor antigen presented by APC is tolerance induction rather than T-cell activation.

From a therapeutic perspective, the induction of antigen-specific CD4+ T-cell tolerance mediated by BM-derived APCs (cross-tolerance) imposes a significant barrier to the current generation of immune-enhancing strategies against solid malignancies. Indeed, therapeutic immunization of RencaHA-bearing mice with a potent immunogen-encoding HA (vaccinia-HA) not only failed to break the unresponsive state of antigen-specific CD4+ T cells (Fig. 7)Citation but also did not result in any rejection and/or delay of tumor growth (data not shown). Despite these sobering findings, however, the induction of tolerance to tumor antigens mediated by APCs seems not to be an insurmountable obstacle, as recently demonstrated by strategies manipulating specific signaling pathways in these cells (19 , 46, 47, 48) Integration of these novel approaches into the current generation of immune-enhancing therapies may ultimately lead to strategies to more effectively harness the immune system against solid malignancies.


    FOOTNOTES
 
Grant support: USPHS Grants CA78656, CA87583, CA100850 (to E. M. S.), and CA96888, CA15396 (to H. I. L.). E. M. S. is a Junior Faculty of the Lymphoma Foundation of America.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Eduardo M. Sotomayorm, 12902 Magnolia Drive, MRC 4 East—Room 4072-H, Tampa, FL 33612. Phone: (813) 632-1387; Fax: (813) 979-7264; E-mail: sotomed{at}moffitt.usf.edu; Hyam I. Levitsky, Department of Oncology, The Johns Hopkins University School of Medicine, 720 Rutland Ave., Room 4M51, Cancer Research Building, Baltimore, MD 21205. Phone (410) 614-0552; Fax: (410) 614-9705; E-mail: hy{at}jhmi.edu

Received 3/31/03. Revised 10/ 3/03. Accepted 10/15/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jaffee E. M., Hruban R. H., Biedrzycki B., Laheru D., Schepers K., Sauter P. R., Goemann M., Coleman J., Grochow L., Donehower R. C., Lillemoe K. D., O’Reilly S., Abrams R. A., Pardoll D. M., Cameron J. L., Yeo C. J. Novel allogeneic granulocyte-macrophage colony-stimulating factor-secreting tumor vaccine for pancreatic cancer: a Phase I trial of safety and immune activation. J. Clin. Oncol., 19: 145-156, 2001.[Abstract/Free Full Text]
  2. Vogel C. L., Cobleigh M. A., Tripathy D., Gutheil J. C., Harris L. N., Fehrenbacher L., Slamon D. J., Murphy M., Novotny W. F., Burchmore M., Shak S., Stewart S. J., Press M. Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2-overexpressing metastatic breast cancer. J. Clin. Oncol., 20: 719-726, 2002.[Abstract/Free Full Text]
  3. Shawver L. K., Slamon D., Ullrich A. Smart drugs: tyrosine kinase inhibitors in cancer therapy. Cancer Cell, 1: 117-123, 2002.[Medline]
  4. Fuchs E. J., Bedi A., Jones R. J., Hess A. D. Cytotoxic T cells overcome BCR-ABL-mediated resistance to apoptosis. Cancer Res., 55: 463-466, 1995.[Abstract/Free Full Text]
  5. Shtil A. A., Turner J. G., Durfee J., Dalton W. S., Yu H. Cytokine-based tumor cell vaccine is equally effective against parental and isogenic multidrug-resistant myeloma cells: the role of cytotoxic T lymphocytes. Blood, 93: 1831-1837, 1999.[Abstract/Free Full Text]
  6. Ravetch J. V., Lanier L. L. Immune inhibitory receptors. Science (Wash. DC), 290: 84-89, 2000.[Abstract/Free Full Text]
  7. Pardoll D. T cells and tumours. Nature (Lond.), 411: 1010-1012, 2001.[Medline]
  8. Ochsenbein A. F., Klenerman P., Karrer U., Ludewig B., Pericin M., Hengartner H., Zinkernagel R. M. Immune surveillance against a solid tumor fails because of immunological ignorance. Proc. Natl. Acad. Sci. USA, 96: 2233-2238, 1999.[Abstract/Free Full Text]
  9. Ochsenbein A. F., Sierro S., Odermatt B., Pericin M., Karrer U., Hermans J., Hemmi S., Hengartner H., Zinkernagel R. M. Roles of tumour localization, second signals and cross priming in cytotoxic T-cell induction. Nature (Lond.), 411: 1058-1064, 2001.[Medline]
  10. Sotomayor E. M., Borrello I., Levitsky H. I. Tolerance and cancer: a critical issue in tumor immunology. Crit. Rev. Oncog., 7: 433-456, 1996.[Medline]
  11. Pardoll D. Does the immune system see tumors as foreign or self?. Annu. Rev. Immunol., 21: 807-839, 2003.[Medline]
  12. Staveley-O’ Carroll K., Sotomayor E., Montgomery J., Borrello I., Hwang L., Fein S., Pardoll D., Levitsky H. Induction of antigen-specific T-cell anergy: an early event in the course of tumor progression. Proc. Natl. Acad. Sci. USA, 95: 1178-1183, 1998.[Abstract/Free Full Text]
  13. Surman D. R., Dudley M. E., Overwijk W. W., Restifo N. P. Cutting edge: CD4+ T-cell control of CD8+ T-cell reactivity to a model tumor antigen. J. Immunol., 164: 562-565, 2000.[Abstract/Free Full Text]
  14. Gimmi C. D., Freeman G. J., Gribben J. G., Gray G., Nadler L. M. Human T-cell clonal anergy is induced by antigen presentation in the absence of B7 costimulation. Proc. Natl. Acad. Sci. USA, 90: 6586-6590, 1993.[Abstract/Free Full Text]
  15. Ostrand-Rosenberg S. Tumor immunotherapy: the tumor cell as an antigen-presenting cell. Curr. Opin. Immunol., 6: 722-727, 1994.[Medline]
  16. Kirberg J., Baron A., Jakob S., Rolink A., Karjalainen K., von Boehmer H. Thymic selection of CD8+ single positive cells with a class II major histocompatibility complex-restricted receptor. J. Exp. Med., 180: 25-34, 1994.[Abstract/Free Full Text]
  17. Barnden M. J., Allison J., Heath W. R., Carbone F. R. Defective TCR expression in transgenic mice constructed using cDNA-based {alpha}- and ß-chain genes under the control of heterologous regulatory elements. Immunol. Cell Biol., 76: 34-40, 1998.[Medline]
  18. Morgan D. J., Kreuwel H. T., Fleck S., Levitsky H. I., Pardoll D. M., Sherman L. A. Activation of low avidity CTL specific for a self epitope results in tumor rejection but not autoimmunity. J. Immunol., 160: 643-651, 1998.[Abstract/Free Full Text]
  19. Sotomayor E. M., Borrello I., Tubb E., Rattis F. M., Bien H., Lu Z., Fein S., Schoenberger S., Levitsky H. I. Conversion of tumor-specific CD4+ T-cell tolerance to T-cell priming through in vivo ligation of CD40. Nat. Med., 5: 780-787, 1999.[Medline]
  20. Sotomayor E. M., Borrello I., Rattis F. M., Cuenca A. G., Abrams J., Staveley-O’Carroll K., Levitsky H. I. Cross-presentation of tumor antigens by bone marrow-derived antigen-presenting cells is the dominant mechanism in the induction of T-cell tolerance during B-cell lymphoma progression. Blood, 98: 1070-1077, 2001.[Abstract/Free Full Text]
  21. Kearney E. R., Pape K. A., Loh D. Y., Jenkins M. K. Visualization of peptide-specific T-cell immunity and peripheral tolerance induction in vivo. Immunity, 1: 327-339, 1994.[Medline]
  22. Lopez D. M., Lopez-Cepero M., Watson G. A., Ganju A., Sotomayor E., Fu Y. X. Modulation of the immune system by mammary tumor-derived factors. Cancer Investig., 9: 643-653, 1991.[Medline]
  23. Sotomayor E. M., Fu Y. X., Lopez-Cepero M., Herbert L., Jimenez J. J., Albarracin C., Lopez D. M. Role of tumor-derived cytokines on the immune system of mice bearing a mammary adenocarcinoma. II. Down-regulation of macrophage-mediated cytotoxicity by tumor-derived granulocyte-macrophage colony-stimulating factor. J. Immunol., 147: 2816-2823, 1991.[Abstract/Free Full Text]
  24. Kurts C., Kosaka H., Carbone F. R., Miller J. F., Heath W. R. Class I-restricted cross-presentation of exogenous self-antigens leads to deletion of autoreactive CD8(+) T cells. J. Exp. Med., 186: 239-245, 1997.[Abstract/Free Full Text]
  25. Adler A. J., Marsh D. W., Yochum G. S., Guzzo J. L., Nigam A., Nelson W. G., Pardoll D. M. CD4(+) T-cell tolerance to parenchymal self-antigens requires presentation by bone marrow-derived antigen-presenting cells. J. Exp. Med., 187: 1555-1564, 1998.[Abstract/Free Full Text]
  26. Schinecker C., McHugh R., Shevach E. M., Germain R. Constitutive presentation of a natural tissue autoantigen exclusively by dendritic cells in the draining lymph node. J. Exp. Med., 196: 1079-1090, 2002.[Abstract/Free Full Text]
  27. Belz G., Behrens G. M. N., Smith C., Miller J. F. A. P., Jones C., Lejon K., C. G. F., Mueller S., Shortman K., Carbone F., Heath W. R. The CD8 {alpha}+ dendritic cell is responsible for inducing peripheral self-tolerance to tissue-associated antigens. J. Exp. Med., 196: 1099-1104, 2002.[Abstract/Free Full Text]
  28. Hung K., Hayashi R., Lafond-Walker A., Lowenstein C., Pardoll D., Levitsky H. The central role of CD4(+) T cells in the antitumor immune response. J. Exp. Med., 188: 2357-2368, 1998.[Abstract/Free Full Text]
  29. Pardoll D. M., Topalian S. L. The role of CD4+ T-cell responses in antitumor immunity. Curr. Opin. Immunol., 10: 588-594, 1998.[Medline]
  30. Toes R. E., Ossendorp F., Offringa R., Melief C. J. CD4 T cells and their role in antitumor immune responses [comment]. J. Exp. Med., 189: 753-756, 1999.[Free Full Text]
  31. Dalyot-Herman N., Bathe O. F., Malek T. R. Reversal of CD8+ T-cell ignorance and induction of anti-tumor immunity by peptide-pulsed APC. J. Immunol., 165: 6731-6737, 2000.[Abstract/Free Full Text]
  32. Marzo A. L., Lake R. A., Lo D., Sherman L., McWilliam A., Nelson D., Robinson B. W., Scott B. Tumor antigens are constitutively presented in the draining lymph nodes. J. Immunol., 162: 5838-5845, 1999.[Abstract/Free Full Text]
  33. Robinson B. W., Lake R. A., Nelson D. J., Scott B. A., Marzo A. L. Cross-presentation of tumour antigens: evaluation of threshold, duration, distribution and regulation. Immunol. Cell Biol., 77: 552-558, 1999.[Medline]
  34. Plautz G. E., Mukai S., Cohen P. A., Shu S. Cross-presentation of tumor antigens to effector T cells is sufficient to mediate effective immunotherapy of established intracranial tumors. J. Immunol., 165: 3656-3662, 2000.[Abstract/Free Full Text]
  35. Robinson B., Scott B., Lake R., Stumbles D., Fisher S., Marzo A. Lack of ignorance to tumor antigens: evaluation using nominal antigen transfection and T-cell receptor transgenic lymphocytes in Lyons-Parish analysis—implications for tumor tolerance. Clin. Cancer Res., 7: 811-817, 2001.
  36. Nguyen L. T., Elford A. R., Murakami K., Garza K. M., Schoenberger S. P., Odermatt B., Speiser D. E., Ohashi P. S. Tumor growth enhances cross-presentation leading to limited T-cell activation without tolerance. J. Exp. Med., 195: 423-435, 2002.[Abstract/Free Full Text]
  37. Spiotto M., Yu P., Rowley D., Nishimura M., Meredith S., Gajewski T., Fu Y-X., Schreiber H. Increasing tumor antigen expression overcomes "ignorance" to solid tumors via cross-presentation by bone marrow-derived stromal cells. Immunity, 17: 737-747, 2002.[Medline]
  38. Nelson D., Mukherjee S., Bundell C., Fisher S., van Hagen D., Robinson B. Tumor progression despite efficient tumor antigen cross-presentation and effective "arming" of tumor antigen-specific CTL. J. Immunol., 166: 5557-5566, 2001.[Abstract/Free Full Text]
  39. Huang A. Y., Golumbek P., Ahmadzadeh M., Jaffee E., Pardoll D., Levitsky H. Role of bone marrow-derived cells in presenting MHC class I-restricted tumor antigens. Science (Wash. DC), 264: 961-965, 1994.[Abstract/Free Full Text]
  40. Hsu F. J., Benike C., Fagnoni F., Liles T. M., Czerwinski D., Taidi B., Engleman E. G., Levy R. Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nat. Med., 2: 52-58, 1996.[Medline]
  41. Huang F. P., Platt N., Wykes M., Major J. R., Powell T. J., Jenkins C. D., MacPherson G. G. A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T-cell areas of mesenteric lymph nodes [see comments]. J. Exp. Med., 191: 435-444, 2000.[Abstract/Free Full Text]
  42. Munn D., Sharma M., Lee J., Jhaver K., Jonhson T., Keskin D., Marshall B., Chandler P., Antonia S., Burgess R., Slingluff C., Mellor A. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. Science (Wash. DC), 297: 1867-1870, 2002.[Abstract/Free Full Text]
  43. Lanzavecchia A. Immunology. Licence to kill[news; comment]. Nature (Lond.), 393: 413-414, 1998.[Medline]
  44. Steinman R. M., Hawiger D., Nussenzweig M. Tolerogenic dendritic cells. Annu. Rev. Immunol., 21: 685-711, 2003.[Medline]
  45. den Haan J. M., Lehar S. M., Bevan M. J. CD8+but not CD8-dendritic cells cross-prime cytotoxic T cells in vivo. J. Exp. Med., 192: 1685-1696, 2000.[Abstract/Free Full Text]
  46. Diehl L., den Boer A. T., Schoenberger S. P., van der Voort E. I., Schumacher T. N., Melief C. J., Offringa R., Toes R. E. CD40 activation in vivo overcomes peptide-induced peripheral cytotoxic T-lymphocyte tolerance and augments anti-tumor vaccine efficacy. Nat. Med., 5: 774-779, 1999.[Medline]
  47. Bansal-Pakala P., Jember A. G., Croft M. Signaling through OX40 (CD134) breaks peripheral T-cell tolerance. Nat. Med., 7: 907-912, 2001.[Medline]
  48. Cheng F., Wang H., Cuenca A., Huang M., Ghansah T., Brayer J., Kerr W., Takeda K., Akira S., Schoenberger S. P., Yu H., Jove R., Sotomayor E. M. A critical role for Stat3 signaling in immune tolerance. Immunity, 19: 425-436, 2003.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M.-G. de Goer de Herve, A. Cariou, F. Simonetta, and Y. Taoufik
Heterospecific CD4 Help to Rescue CD8 T Cell Killers
J. Immunol., November 1, 2008; 181(9): 5974 - 5980.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Z.-Z. Yang, A. J. Novak, S. C. Ziesmer, T. E. Witzig, and S. M. Ansell
CD70+ non-Hodgkin lymphoma B cells induce Foxp3 expression and regulatory function in intratumoral CD4+CD25 T cells
Blood, October 1, 2007; 110(7): 2537 - 2544.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Morimoto, X. Tan, R. M. Teague, C. Ohlen, and P. D. Greenberg
Induction of Tolerance in CD8+ T Cells to a Transgenic Autoantigen Expressed in the Liver Does Not Require Cross-Presentation
J. Immunol., June 1, 2007; 178(11): 6849 - 6860.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Zhou and H. I. Levitsky
Natural Regulatory T Cells and De Novo-Induced Regulatory T Cells Contribute Independently to Tumor-Specific Tolerance
J. Immunol., February 15, 2007; 178(4): 2155 - 2162.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. E. Brown, C. Blank, J. Kline, A. K. Kacha, and T. F. Gajewski
Homeostatic Proliferation as an Isolated Variable Reverses CD8+ T Cell Anergy and Promotes Tumor Rejection
J. Immunol., October 1, 2006; 177(7): 4521 - 4529.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. T. Joncker, J. Helft, A. Jacquet, V. Premel, and O. Lantz
Intratumor CD4 T-cell accumulation requires stronger priming than for expansion and lymphokine secretion.
Cancer Res., May 15, 2006; 66(10): 5443 - 5451.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. W. Overwijk, K. E. de Visser, F. H. Tirion, L. A. de Jong, T. W. H. Pols, Y. U. van der Velden, J. G. van den Boorn, A. M. Keller, W. A. Buurman, M. R. Theoret, et al.
Immunological and Antitumor Effects of IL-23 as a Cancer Vaccine Adjuvant
J. Immunol., May 1, 2006; 176(9): 5213 - 5222.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Huang, P.-Y. Pan, Q. Li, A. I. Sato, D. E. Levy, J. Bromberg, C. M. Divino, and S.-H. Chen
Gr-1+CD115+ Immature Myeloid Suppressor Cells Mediate the Development of Tumor-Induced T Regulatory Cells and T-Cell Anergy in Tumor-Bearing Host
Cancer Res., January 15, 2006; 66(2): 1123 - 1131.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Zhou, C. G. Drake, and H. I. Levitsky
Amplification of tumor-specific regulatory T cells following therapeutic cancer vaccines
Blood, January 15, 2006; 107(2): 628 - 636.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Kusmartsev, S. Nagaraj, and D. I. Gabrilovich
Tumor-Associated CD8+ T Cell Tolerance Induced by Bone Marrow-Derived Immature Myeloid Cells
J. Immunol., October 1, 2005; 175(7): 4583 - 4592.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Liu, S. A. Caldwell, and S. I. Abrams
Immune Selection and Emergence of Aggressive Tumor Variants as Negative Consequences of Fas-Mediated Cytotoxicity and Altered IFN-{gamma}-Regulated Gene Expression
Cancer Res., May 15, 2005; 65(10): 4376 - 4388.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Demaria, F. R. Santori, B. Ng, L. Liebes, S. C. Formenti, and S. Vukmanovic
Select forms of tumor cell apoptosis induce dendritic cell maturation
J. Leukoc. Biol., March 1, 2005; 77(3): 361 - 368.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Wang, F. Cheng, A. Cuenca, P. Horna, Z. Zheng, K. Bhalla, and E. M. Sotomayor
Imatinib mesylate (STI-571) enhances antigen-presenting cell function and overcomes tumor-induced CD4+ T-cell tolerance
Blood, February 1, 2005; 105(3): 1135 - 1143.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. Zhou, Z. Lu, J. D. McCadden, H. I. Levitsky, and A. L. Marson
Reciprocal Changes in Tumor Antigenicity and Antigen-specific T Cell Function during Tumor Progression
J. Exp. Med., December 20, 2004; 200(12): 1581 - 1592.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cuenca, A.
Right arrow Articles by Sotomayor, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cuenca, A.
Right arrow Articles by Sotomayor, E. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online